Jump to:

Potential Reduced Exposure Products

Book 7 Tabs 1-68

Date: 1997 (est.)
Length: 587 pages
2063633486-2063634072
Jump To Images
snapshot_pm 2063633486-2063634072

Fields

Document Images

Text Control

Highlight Text:

OCR Text Alignment:

Image Control

Image Rotation:

Image Size:

Page 1: 2063633486 Log in for more options!
---
Page 2: 2063633487 Log in for more options!
---
Page 3: 2063633488 Log in for more options!
Environmental and Molecular Mutagenesis 29:312- 322 (1997) Predicting Rodent Carcinogenicity From Mutagenic Potency Measured in the Ames Salmonella Assay Bethel A. Fetterman,! Byung Soo Kim,2 Barry H. Margolin,° Jonathan S. Schildcrout,1 Melissa G. Smith,1 S. Michelle Wagner,~ and Errol Zeigera ~ Department of Biostatistics, University ~f North Carolina, Chapel Hill, North Carolina 2Department of Applied Statistics, Yor~sei University, Seoul, South Korea 3Environmental Toxicology Program, Nation&l Ins#tote of Environmental Health Sciences, Research Triangle Park, North Carolina Many in vitro tests have been developed to identify chemicals that can damage cellular DNA or cause mutations, and secondarily to identify potential car- cinogens. The test receiving by far the most USe and attention has been the Salmonella (SAL) mutagene- sis test developed by Ames and colleagues [(1973): Proc Natl Acad Sci USA 70:2281-2285; (1975): Murat Res 31:347-364], because of its initial promise of high qualitative (YES/NO) predictivily for cancer in rodents and, by extension, in humans. In addition to the initial reports of high qualitative predictivity, there was also an early report by Mes- elson and Russell [in Hiatt HH et al. (1977): "Ori- gins of Human Cancer, Book C: Human Risk Assess- ment," pp 1473-1481] of a quantitative relation- ship between mutagenic potency measured in SAL and carcinogenic potency measured in rodents, for a small number of chemicals. However, other re-" ports using larger numbers of chemicals have found only very weak correlations. The primary purpose of this study was to determine whether mutagenic potency, as measured in a number of different ways, could be used to improve predictivity of carci- nogenicity, either qualitatively or quantitatively. To this end, eight measures of SAL mutagenic potency were used. This study firmly establishes that the pre- dictive relationship between mutagenic potency in SAL and rodent carcinogenicily is, at best, weak. When predicting qualitative carcinogenicity, only qualitative mutagenicity is useful; none of the quanti- tative measures of potency considered improves the carcinogenicity prediction. In fact, when qualitative mutagenicity is forced out of the model, the quantita- tive'measores are still not predictive of carcinogenic- ify. When predicting quantitative carcinogenicity, several, possible methods were considered for sum- marizing potency over all experiments; however, in 611 cases, the relationship between mutagenic po- tency predictors and quantitative carcinogenicity is very weak. Environ. Mol. Mutagen. 29:312-322, 1997. © 1997 Wiley4.iss, Inc. Key words: statistics; National Toxicology Program; carcinogenic potency; mutagenic potency; Salmonella INTRODUCTION Many in vitro short-term tests (STTs) have been devel- oped to identify chemicals that can damage cellular DNA or cause mutations and, secondarily, to identify potential carcinogens. The somatic mutation theory of carcinogene- sis holds that mutations are a common first step in the development of a cancer cell; consequently, interest in these STI's has been fueled by their ability to identify potential carcinogens. The test receiving by far the most use and attention has been the Salmonella (SAL) muta- genesis test developed by Ames and colleagues [1973, 1975]. The SAL test gets its most extensive use as a prelimi- nary screen during chemical and drug development. The results of this test are often the only toxicology-related information used by industry to decide whether to proceed © 1997 Wiley-Liss, Inc. with development of the chemical and t~o more definitive toxicological tests, or to label it a potential carcinogen, and put it ~ide, with no further testing. Only qualitative responses are used in this process. It would be extremely . valuable for these users of SAL to know if there is a relationship between SAL test potency and rodent cancer potency because it could permit them to proceed with development of chemicals estimated to be weak carcino- gens. Often there are no animal toxicity data at this point. Contract grant sponsor:. National Institute of Environmental Health Sci- ences: Contract grant number:. 273-90-1-0005; Contract grant sponsor: Korea Research Foundation (1995 Overseas Research Program for Uni- versity Professors. *Correspondence to: Dr. Barry Margolin, Department of Biostatistics. CB# 7400. University of North Carolina, Chapel Hill, NC 27599. Received 29 June 1995; revised and accepted 18 September 1996.
Page 4: 2063633489 Log in for more options!
TABLE h Correlation of Mutagenic and Carcinogenic Log Potencies Among Chemicals That are Both Mutagenic in SAL and Carcinogenic in Rodents Study # of Chemicals Correlation Predicting Carcinogenicity From Mutagenic Potency 313 TABLE Ih Comparison of Operating Characteristics of the 73- and 42-Chemical Databases, and their Combination" 73 42 115 chemicals chemicals chemicals Meselson and Russell [ 1977] I 0 0.94~" Meselson and Russell [19771 14 0.36a Meselson and Russell [ 19771 9 0.92~ Parodi et al. [19901 88 0.39 McCann et al. [1988] 80 0.40 McCann et al. [19881 77 0.24d Piegorsch and Hoel [ 19881 28 0.44 aAs cited by Parodi et al. [1990]. bNitroso chemicals not considered. ~As.calculated by McCann et al. [19881 using 9 non-nitroso chdmicals. '~After elimination of "3 extreme values." SAL positives (%) 33 Carcinogen[city positives (%) 60 Positive predictivity ˘%) 83 Negative predictivity (%) 51 Sensitivity (%) 45 Specificity (%) 86 Concordance with rodent cancer (%) 62 Significance of association (P value) 29 32 56 " 59 1130 89 62 55 52 48 100 91 73 66 0.004 <0.001 <0.001 ~Adapt~d froha Haseman et al. [1990] and Zeiger et al. [1990]. The current study is the first in a series of studies that examines the predictivity of carcinogen[city from mutage- nicity, assessed by using four in vitro STTs (SAL, mouse lymphoma, sister chromatid exchange, and chromosome aberrations), alone or in combination. A number of differ- ent potency measures for the Ames SAL test are evaluated and applied to estimate rodent carcinogen[city. The primary force behind the development and exten- sive use of the SAL mutagenicity test has been its ease of use, its low cost, and its initial promise of high qualitative (YES/NO) predictivity for cancer in rodents and, by ex- tension, in humans, Early reports showed approximately 89-95% predictivity of cancer from SAL results, and 87- 93%. concordance between the results of SAL tests and rodent cancer tests [McCann et al., 1975; Purchase et al., 1976; Sugimura etal., 1976]. Later reports using chemi- cals tested by the U.S. National Toxicology Program (NTP) demonstrated a wider range of positive predictivi- ties (69-100%) and lower concordances (61-66%) [Ten- nant et al., 1987; Zeiger, 1987; Zeiger and Tennant, [986; Zeiger et al., 1990]. In addition to the initial reports of high qualitative pre- dictivity, there was also an early report of a significant and substantial quantitative relationship between mutagenic potency measured in SAL and carcinogenic potency mea- sured in rodents. Meselson and Russell [1977] examined the quantitative relationship between mutagenic and car- cinogenic potency for 14 carcinogens and reported a nearly perfect linear relationship (correlation = 0.94) be- tween carcinogenic and mutagenic log potency for 10 of the 14 chemicals. This was particularly exciting because it appeared to extend the SAL assay from the prediction solely of carcinogenic hazard to a test that could also predict carcinogenic risk. Subsequent attempts to replicate this high correlation by using larger numbers of chemi- cals, however, have not been successful (Table I). Because of its interest in the relatiqnship between muta- genicity and carcinogen[city, the NTP developed a data- base of mutagenicity test results in parallel with its carci- nogenesis testing program. The study reported here evalu- ates two groups of chemicals taken from the NTP database: 73 tested for carcinogen[city in rats and mice by the NTP in studies ending December 1976 or later, with peer-review approval dates of January 1985 or earlier [Tennant et al., 1987] and an additional 42 chemicals~ peer-reviewed and accepted between January 1985 and May 1988 [Haseman et al., 1990; Zeiger et al., 1990]. Both groups of chemicals had similar operating character- istics with respect to predicting rodent carcinogen[city [Haseman et al., 1990; Zeiger et al., 1990]. Table II illus- trates the results of the carcinogen[city and SAL mutage- nicity tests for these two groups of chemicals. These studies showed that for the NTP database, which reflects chemicals that are of interest to the federal regula- tory agencies, other government organizations, and the public, the SAL test provides good positive predictivity for carcinogens (89%), but the test "misses" 52% of the carcinogens (48% sensitivity). The studies by Tennant and colleagues [1987], Haseman and colleagues [1990], and Zeiger and colleagues [ 1990] were designed to exam- ine the qualitative relationships between SAL mutagenic- ity and rodent carcinogen[city. There still remains a need to examine thoroughly the quantitative relationships be- tween SAL mutagenicity and rodent carcinogen[city re- sults to determine whether the use of quantitative mea- sures (potency) of the former improves predictivity of the latter. ~ These reports discuss 41 chemicals, rather than 42. This is because tetrakis(hydroxymethyl)phosphonium chloride and tetrakis(hydroxy- methyl)phosphonium sulfate were tested as two separate chemicals but were evaluated as one chemical because they differed only in the salt and produced similar responses in the four STFs and in the carcinogenic- ity assays. However, the measures of interest for our purposes--muta- genic potency and TD50--are different for these two chemicals, so they remain distinct in our evaluation.
Page 5: 2063633490 Log in for more options!
314 Fetterman et al. TABLE III. Frequencies of Salmonella Strain and Activation Experiments for Each Dataset 73 chemicals 42 chemicals Activation TA98 TA 100 TA 1535 TA98 TA 100 TA 1535 None 215 213 207 131 130 108 Rat liver 208 227 214 141 136 103 Hamster liver 213 223 216 142 137 103 Just as qualitative results can vary according to the decision" mechanism used to define a positive response, so there can be more than one working definition of the potency of a response. A number of measures of potency have been used for SAL mutagenicity data; they fall into two general categories: those based on the slope of the dose response, and those based on the concept of an effec- tive dose (e.g., the lowest effective dose). Similarly, po- tency measures of carcinogenicity can be based on the slope of the carcinogenic response, or on an effective dose (e.g., the TD50 [Gold et al., 1984]) as used here. In the current study, eight measures of potency were defined for the SAL test and were compared for their degree of agreement with each other and for their predictivity for carcinogenicity. The potency measures were used to ana- lyze the 73-chemical dataset, and the results obtained were validated by using the 42-chemical dataset. A key consideration in this study was whether the inferences drawn would change depending upon the SAL potency measure used. DESCRIPTION OF THE DATA Because of the specific SAL test protocol used for the NTP database, test data are available for all chemicals in strains TA98 and TAI00. However, as a rule, only chemi- cals that were negative or equivocal in these two strains bta were tested in strains TA1535 or TA1537. If TA1537 were included here, it would contribute 734 experiments (19% of the total database) and be heavily biased toward the nonmutagens. An earlier study [Zeiger et al., 1985] showed that approximately 89% of the NTP-identified mutagens could be identified through the use of strains TA100 and TA98, and 88% through strains TAI00 and TA1535. TA1537 uniquely detected only 4% of the muta- gens. Previous analyses of the NTP database included SAL strain TA1537 [Tennant et al., 1987; Haseman et al., 1990; Zeiger et al., 1990], but this strain was excluded from all of our analyses because it is not currently in use by the NTP as a primary screen, and it has not been used consistently in the past. The dataset used here for the Ames SAL assay consists of three tester strains--TA98, TAI00. and TA1535-- or and three metabolic activation systems--no activation, rat liver S-9. and hamster liver S-9. Table III shows the frequency distribution for strain and activation in each chemical dataset. There are 1936 and 1131 SAL experiments available for estimating potency in the 73-chemical and 42-chemi- cal datasets, respectively. Each of these experiments con- tains a solvent control dose and at least one treatment dose. Table IV shows a frequency distribution for the number of analyzable treatment doses for each dataset; 93% of the experiments in the 73-chemical dataset and 85% in the 42-chemical dataset consisted of a solvent control and five treatment doses, reflecting the design of the NTP SAL protocol. DESCRIPTION OF MUTAGENIC POTENCY MEASURES There is no universally accepted way to measure the potency of a mutagenic response in any existing assay. In order to be thorough, eight measures of mutagenic potency were considered. The first three measures are "specific to the SAL assay because they attempt to esti- mate low-dose mutagenic potency after adjustment for toxicity" [Margolin et al.. 1994]. The other five measures are more general and directly applicable to other STTs. The bM potency measure, described by Margolin and coworkers [1981 ], is based on a family of nonlinear dose- response models of the SAL assay. These models describe "po, the probability that a single treated microbe yields a mutant colony when exposed to dose D of a test chemical, by po = {I - exp[-(a + bD)]}*T(D) where (a + bD) is ~0, and T(D) is one of two functions describing the toxicity of dose D of the test chemical, either T(D) = exp(-gD), T(D) = [2 - exp(gD)]÷,
Page 6: 2063633491 Log in for more options!
Predicting Carcinogenicity From Mutagenic Potency TABLE IV. Frequency Distribution for Number of Treatment Doses 315 Number of analyzable treatment doses Dataset I 2 3 4 5 6 7 8 9 73 chemical 3 II 21 88 1798 I1 0 4 0 42 chemical 6 3 24 120 957 14 0 3 4 where [x]÷ = max(0, x) and (gD) is >0. In these models, b reflects the mutagenic effect per unit dose, adjusted for concomitant toxicity. Doses that exhibit substantial toxicity are excluded from the analysis [Margolin et al., 1988]. The estimate of b from the model, denoted by bra, is used as an estimate of mutagenic potency and reflects the low-dose slope of the dose response. Bernstein and colleagues [1982] describe an estimate of potency based on the assumption that the underlying dose-response curve is initially linear. The slope of the regression line is computed under the assumption of iin- earity; if the observed mean response at the highest dose significantly departs from linearity of the remaining re- sponses, the observations at the highest dose are set aside, and the slope is recomputed from regression on the re- maining data. The process is repeated until no significant departure from linearity occurs. If there are at least three doses (including the control dose) with data remaining, then the estimate of the slope of the regression line for the remaining observations is used as the estimate of po- tency and is denoted by bB~; otherwise the potency esti- mate is undefined. A slight modification of this procedure yields bB2, in which the estimate of the slope of the regression line is used even if there are only two doses with observations remaining after the discard proces~ is concluded. bx An estimate of potency commonly appearing in the mutagenicity literature is the maximum observed pairwise slope for each dose group relative to controls, that is, the maximum observed average colony count per plate per unit dose applied. Let Yk be the mean number of revertants per plate observed at dose Dk, where 0 = Do < Dt < • • • < Dr and r = number of treatment doses. Then bx = max[(Yk - Yo)l(Dk - Do)], k where k is between I and r inclusive. bR br~ is the straightforward estimate of the slope of the linear regression of observed counts per plate regressed on dose, which equals ba~ when no dose groups are dis- c~rded. bo!, bD2 Margolin and Risko [1988] describe the dose per unit increase (DUI) potency measure as the dose needed to induce a unit increase in response over control, based on a model that allows a quadratic dose-response curve. Two estimates of DUI are considered: bot is the inverse of the DUI measure obtained from a linear regression that includes the quadratic term only if it is statistically sig- nificant; b02 is the inverse of the DUI measure obtained from a linear regression that includes the quadratic term whether or not it is statistically significant. Because the inverses of the respective DUI measures are used, bot and b02. are directly comparable to other potency measures. bLED Th~ lowest effective dose (LED) is the lowest dose that has a mean colony count per plate significantly greater than the mean count per plate at the control dose. Significance is assessed using a variance estimate based on the nonlinear dose-response model described for the measure bM and a Bonferroni correction for multiple com- parisons. Note that for all potency measures described except LED, a smaller value corresponds to lower muta- genic potency; for LED a smaller value implies higher mutagenic potency. Therefore, to make the comparison of potency measures simpler, the reciprocal of LED-- denoted bLED--is used as the estimate of mutagenic po- tency. DESCRIPTIVE STATISTICS FOR POTENCY MEASURES The measures bx and bR will always be defined as long as there are data for the control and one treatment dose; however, there are cases in which the other potency mea- sures may not be defined. The Bernstein measures and bB2 require at least two and one remaining treatment doses, respectively, after excluding high doses that depart
Page 7: 2063633492 Log in for more options!
316 Fetterman et al. TABLE V. Percent of Experiments for Which Potency Measure Is Computable Dataset b~ bnt bn2 bx b~ bDi bo2 73 chemical 94 77 100 100 100 99.7 99.7 94 42 chemical 93 77 100 100 100 99.7 99.7 93 TABLE Vl. Percentiles for bM Before and After Logging Percentile bM In( 1 + bM) 0% 0.00 0.00 25% 0.00 0.00 50% 0.00 0.00 75% 0.05 0.05 90t~ 1.93 1.08 95% 55.47 4.03 99% 2035.94 7.62 100% 15864.36 9.67 from linearity of the response. The bM measure requires at least two. treatment doses remaining after excluding high doses that exhibit substantial toxicity. The bL~ mea- sure has the same restriction as that for br~ because it relies on results from the nonlinear dose-response model used for that measure. Table V shows the percent comput- ability of the eight measures for the NTP data. Because the potency measures bM, bin, and bB_, are so similar in principle, these measures were examined more thoroughly to see if they produce similar potency results. The two Bernstein measures are very similar; results for the comparison of bM with bat are almost identical to results for the comparison of br~ with There are 203 experiments for which bB~ or bB2 are defined, but b~a is undefined. Examination of the observed dose-response curves for these experiments shows that, in most cases, there is a peak response at the zero dose or at the first treatment dose, thereby explaining why b~ is undefined. The distribution of estimated potencies obtained for each measure is highly skewed. Logging the measures creates distributions that are better behaved, although still not normally distributed, and have a reasonable range for analysis purposes. The exact transformation used is In (I + potency); adding 1 to the potency before logging allows ~s to deal with potency measures that yield value 0 for some experiments. As an example of the effect of logging on the distribution of estimated potencies, Table VI shows the percentiles for the unlogged and logged b~ measure. Table VII shows the observed Pearson correlations be- tween the various logged potency measures.The correla- tion between bDI and bD2 is very high (r = 0.98) because the two measures are so similar in definition. In fact, the maximum absolute difference between logged bo~ and bm is 5.4, and 99% of the experiments have an absolute difference of 0.91 or less between the two measures. The correlations of bm and ba: with bu are high as well (r = 0.94). This high correlation is expected because each of these measures attempts to estimate the slope of the dose- response curve at low doses. The correlations of ba2 and bu with bx are also high (r > 0.92). Recall that bx is the maximum observed slope between the control and all test doses. For dose-response curves that level off or turn down at high doses, the value for bx would be obtained from the low doses; this should then be similar to ba~. and bM, which also estimate the slope at low doses. SUMMARIZING SALMONELLA EXPERIMENTS Condensing the data for each element in the database is key to the analyses described here. The first issue is how to handle replicate experiments. For a given chemi- cal, within each of the nine strain/activation combinations considered, several replicate experiments were generally available. Although McCann and colleagues [ 1988] used the median to summarize replicate experiments, the choice here was to use the mean as a summary measure. The mean and median summaries are highly correlated (r = 0.96) in this database because most of the experi- ments have only two replicates (in which case the mean and median are identical). Using the maximum as a sum- mary measure was judged to be misleading; if one repli- cate experiment has abnormally high results, its use as a summary measure would not be representative. Thus for each of the eight methods of measuring mutagenic po- tency, there are up to nine possible stra#dactivation co~n- bination potency measures estimated per chemical, ob- tained by averaging replicates. The next step in the summarization of the data before the prediction analysis is to attempt to summarize all the experiments for a given chemical across the different strain/activation combinations. Rather than considering nine different potency measures for a chemical (one for each strain/activation combination), it may be easier to consider only one potency measure per chemical. Pie- gorsch and Hoel [1988] used the maximum over all exper- iments (MAX), ignoring strain and activation distinctions, to summarize mutagenic potency for a given chemical. However, this is not the only possibility. Six possible methods of summarizing the many experiments per chem- ical are considered here (Table VIII): these will be re- ferred to as potency summar3" statistics.
Page 8: 2063633493 Log in for more options!
Predicting Carcinogenicity From Mutagenic Potency TABLE VII. Observed Correlation Matrix for Logged Measures 317 b.u 1.00 bs~ .94 1.00 bs:.94 .91 1.00 bx .92 .94 .94 b~ .79 .77 .79 bo~ .89 .87 .89 bo, .91 .89 .91 bt~o .85 .81 .83 1.00 .77 1.00 .86 .90 1.00 .88 .89 .98 1.00 .79 .82 .87 .89 TABLE VIII. Potency Summary Statistics--Methods of Summarizing All Experiments for a Given Chemical 1. MAX of all experiments [Piegorsch and Hoel, 1988] 2. MEAN of all experiments 3. MEDIAN of all experiments 4. MAX of all 9 strain/activation combinations (averaged over replicates) 5. MEAN of all 9 strain/activation combinations (averaged over replicates) 6. MEDIAN of all 9 strain/activation combinations (averaged over replicates) PREDICTING QUALITATIVE CARCINOGENICITY USING SALMONELLA MUTAGENICITY The main purposes of this investigation were to evalu- ate a number of different measures of SAL mutagenic potency, and to examine the predictivity of the different potency measures for rodent carcinogenicity. Because there is no standard or generally accepted measurement of SAL mutagenic potency, we evaluated a number of different measures that had been used or proposed. Eight measures of potency were selected for this evaluation; most of the potency measures were a function of the mutagenic dose-response, but one was simply a function of dose, without considering the magnitude of the re- sponse. For each of the eight SAL potency measures con- sidered, we computed summary mutagenic potency pre- dictors for each strain/activation combination, and in- cluded the overall qualitative NTP mutagenicity decision. We then compared the predictive abilities of these eight potency measures and determined separately the best pre- dictors for qualitative and quantitative carcinogeni~ity. In order to validate findings obtained, a "split-sample" approach was used for this exploratory analysis. Previous comparisons of the 73- and 42-chemical datasets [Hase- man et al., 1990; Zeiger et al., 1990] have shown that they are not significantly different. Various models of predictivity were examined using the 73-chemical dataset and validated using the 42-chemical dataset. Because vali- dation results from the 42ochemical dataset were almost identical to results from the 73-chemical dataset, the sam- TABLE IX. Models Chosen for Predicting Qualitative Carcinogenicity, for Each Potency Measure Considered Predictors used in logistic regression* Final model selected 1. MUTA not included 2. MUTA included, but not forced into the model 3. MUTA forced into the model first intercept-only model intercept + MUTA intercept + MUTA *In addition to the 9 strain/activation combinations. ples were combined after validation and results are re- ported for the entire set of 115 chemicals. The analyses reported by Tennant and colleagues [1987], Haseman and colleagues [1990], and Zeiger and colleagues [1990] examined the prediction of qualitative (YES/NO) rodent carcinogenicity as a function of qualita- tive (YES/NO) mutagenicity. In our study, the initial anal- ysis was for the prediction of qualitative rodent carcinoge- nicity as a function of qualitative and quantitative mutage- nicity as measured by SAL. Logistic regression is the approach adopted here to explore the prediction of quali- tative (YES/NO) carcinogenicity. All of the mutagenic chemicals in the 42-cbemical dataset have positive carci- nogenicity. Logistic models cannot be fit to data that have only one response level for a particular value of the pre- dictor. Therefore, for the purpose of this analysis, one arbitrarily chosen chemical from the dataset was changed to be mutagenic and noncarcinogenic, so that verification analyses could be performed. Separately for each of the eight individual potency measures, the nine logged strain/activation combinations were considered as predictors in stepwise logistic analy- sis. The effect of qualitative SAL mutagenicity (the NTP decision, denoted by MUTA) on prediction was examined by comparing the results obtained by forcing MUTA to be included first in the model, including MUTA as a predictor but not forcing inclusion, and excluding MUTA from the model. Within each of these three procedures, a stepwise logistic regression analysis was performed for each of the eight potency measures. The same model was chosen regardless of which potency measure was
Page 9: 2063633494 Log in for more options!
318 Fetterman et al. 4 2 1 o Maximum of Logged Rat & Mouse TDSOs Fig. 1. Frequency distribution for maximum of logged rat and mouse TD50s. considered. Table IX lists the predictors used in the step- wise logistic regression procedures and the final model chosen by each procedure, with a significance level of 0.10. When MUTA was excluded from the predictor list, an intercept-only model was statistically significant; none of the nine strain/activation combination predictors were selected for inclusion. When MUTA was included, whether by force or not, MUTA and the intercept were the only predictors with any significance. Another interesting question is, if MUTA is already included in the model, which strain/activation combina- tion best fits next in the model? For each potency measure, we determined which strain/activation combination would be included after MUTA. The "best choice" among all models and all potency measures was strain TA1535 with rat liver activation, which has a P value of 0.16 from the score test for inclusion after MUTA. All other P values are much higher, indicating that no other strain/activation combination even comes close to improving the predic- tivity of carcinogenicity once MUTA is included in the logistic model. Next, for each individual potency measure, an assess- ment was made as to whether any of the overall potency summary statistics listed in Table VIII might be a better predictor than the individual strain/activation combina- tions. Following the same three procedures described above for examining the effect of MUTA, and including the six potency summary statistics in the list of predictors, the same results as those shown in Table IX were ob- tained. The models discussed above compare different meth- ods of summarizing all of the potency information for a chemical, for a given method of estimating mutagenic potency. Finally, the different methods of calculating mu- tagenic potency were compared by including the eight different potency measures in the logistic regression pre- dictor list. The effect of MUTA on the prediction was also considered, as described previously. For both the 73- chemical and the 42-chemical datasets, the results were again the same as those shown in Table IX, regardless of which summary statistic described in Table VIII was used to obtain the potency measures. When the models were fitted to the combined sample of 115 chemicals, results were identical to those shown in Table IX, with two ex- ceptions. When MUTA was not considered in the predic- tion, bR and bB_, were chosen as predictors of carcinogenic- ity for the summary method of MAX over all nine strain/ activation combinations, and bD~ and bx were chosen as predictors of carcinogenicity for the summary method of MEDIAN over all nine strain/activation combinations. Conclusion I No matter how mutagenic potency is measured or sum- marized, only qualitative mutagenicity is useful for the prediction of qualitative rodent carcinogeni˘ity; none of the quantitative measures of SAL mutagenicity improves the prediction of qualitative carcinogenicity. PREDICTING QUANTITATIVE CARCINOGENICITY USING SALMONELLA MUTAGENICITY One measure of the carcinogenic potency of a chemical is the TD50. defined as the "dose rate (in mg/kg body weight/day) which, if administered chronically for the stan- dard life span of the species, will halve the probability of remaining tumorless throughout that period" [Gold et al., 1984]. Carcin~enic potency is inversely related to TD50. Estimates of the TD50 for both rats and mice are available for 67 of the chemicals in the exploratory. 73-chemical
Page 10: 2063633495 Log in for more options!
TABLE X. Models Chosen for Predicting Quantitative Carcinogenicity From Strain/Activation Combinations, for All Chemicals Potency Predictors in F-test measure final model R" P-value Predicting Carcinogenicily From Mutagenic Potency 319 TABLE XI. Models Chosen for Predicting Quantitative Carcinogenicity From Strain/Activation Combinations and Overall MAX, for Combined Sample of 108 Chemicals Pot.~ncy F-test measure Predictors in final model R: P-value bM hi535" 0.05 0.0164 bM bBi hi00. rl00 0.13 0.0097 bn~ bB., hi00. n98, n1535 0.10 0.0108 bx hi00. r1535 0.11 0.0023 bx ba r1535 0.09 0.0019 bR bD~ rl535 0.09 0.0017 bo~ bD., r1535 0.07 0.0057 bD2 bLeD h 1535 0.08 0.0042 *Strain/activation combination. The first letter represents the activation (none, hamster liver, rat liver) and the numbers represent the Salmonella strain. h 1535* 0.05 0.01 64 hi00, rl00 0.13 0.0097 MAX. hi(X), n98, n1535 0.15 0.0023 MAX, rl535 0.13 0.0010 r 1535 0.09 0.13019 rl535 0.09 0.0017 r1535 0.07 0.0057 h ! 535 0.08 0.0042 *Strain/activation combination. The first letter represents the activation (n_one, hamster liver, _rat liver) and the numbers represent the Salmonella strain. dataset, and for 41 of the chemicals in the confirmatory 42-chemical dataset. Figure 1 provides the frequency distri- bution of logged TD50s for the 108 chemicals for which TD50s are available. Note that the noncarcinogenic chemi- cals have higher TD50s than do the carcinogenic chemi- cals, but that there is substantial overla'p. The single carcinogenic potency measure used in the analyses reported here is CARCIN = max[ln(l + rat TD50), ln(l + mouse TD50)]. The TD50s are logged because the predictors are logged; thus the outcome variable will be on the same scale as the predictors. For any one carcinogen, the maximum of rat and mouse TD50s among all the sexes and tissues examined is used as a conservative summary. The '*split-sample" approach was used for these analy- ses as well. Exploratory analysis was performed on the 67-chemical dataset, and validation was performed on the 41-chemical dataset. The samples were then combined, and results are reported for the entire set of 108 chemicals. In order to predict quantitative carcinogenicity (CAR- CIN), stepwise linear regression models were used. First, for each of the eight SAL potency measures, the nine strain/activation combinations were considered as pre- dictors of CARCIN. Table X provides the final model and the model's R-" value for each of the potency mea- sures. The strain/activation combination(s) chosen by the stepwise regression procedure for predicting TD50 vary with the potency measure considered. However, in all cases, R2 is very small, indicating that the relationships between the mutagenic potency measures and TD50 are weak. Piegorsch and Hoel [1988] used the maximum over all experiments (MAX) as a summary mutagenic potency for a given chemical. In order to examine the effect of this TABLE XII. Models Chosen for Predicting Quantitative Carcinogenicity From 6 Summary Statistics, for Combined Sample of 108 Chemicals Summary F-test statistic Predictors in final model Rz P-value bM bx bR bD2 b~ intercept only intercept only MAX over reps, MEAN over reps 0.12 0.0015 MAX over reps, MEAN over reps 0.15 0.0002 MAX over reps, MEAN Overall 0.10 0.0031 MAX over reps, MEDIAN over reps 0.08 0.0150 MAX over reps, MEDIAN over reps 0.08 0.0117 intercept only measure on prediction, MAX was included in the list of predictors and the above stepwise linear regressions were repeated. Results of this analysis are shown in Table XI. In the analysis of the 73-chemical dataset, MAX was the only predictor in the final model for all potency measures except bB~. In the analysis of the 42-chemical dataset, MAX did not enter into any of the final models. In the analysis of the combined sample, MAX enters the final model for two of the potency measures, but other strain/ activation combinations are included as well. In the split- sample and combined analyses, all R: values are very small, indicating very weak relationships between the pre- dictors and TD50. Differences in models chosen among the analyses of different samples can be attributed primar- ily to sample size. Conclusion II When only the nine strain/activation combinations are used to predict quantitative rodent carcinogenicity, the best model for predicting quantitative carcinogenicity depends on the potency measure being considered. Inclusion of the overall MAX in the model does little to improve prediction;
Page 11: 2063633496 Log in for more options!
320 Fetterman et al. TAJ~LE XIIIo Model R2 Values for All Possible Single-Variable Regressions of Summary Statistics on CARCIN, for Each Potency Measure* Potency MAX MEAN MEDIAN MAX MEAN MEDIAN measure overall overall overall over reps over reps over reps bM 0.0190 0.0079 0.0001 0.0244 0.0061 0.0000 bs~ 0.0245 0.0045 0.0003 0.0183 0.0037 0.0001 bB_- 0.0311 0.0127 0.0004 0.0370 0.0122 0.0019 bx 0.0348 0.0155 0.0018 0.0523 0.0142 0.0011 bE 0.0438 0.0288 0.0039 0.0613 0.0334 0.0136 bt~ 0.0361 0.0295 0.0076 0.0516 0.0335 0.0093 bo2 0.0367 0.0250 0.0057 0.0467 0.0277 0.0067 bt.~ 0.0071 0.0048 0.0028 0.0169 0.0061 0.0002 *For each potency measure, the highest R-" value is bolded and the second highest R-' value is italicized to facilitate comparison between best and second best models. TABLE XIV. Models Chosen for Predicting Quantitative Carcinogenicity From 8 Potency Measures, for Combined Sample of 108 Chemicals Predictors in F-test Summary statistic Final Model R'- P-value MAX Overall bt~. bt,eo 0.09 0.0080 MEAN Overall bDt, bDz, bL~t~ 0.11 0.0071 MEDIAN Overall intercept-only MAX over reps bR. bLED 0.09 0.0079 MEAN over reps bot. bD2. bLEI~ 0.12 0.0043 MEDIAN over reps intercept-only the final model chosen again depends on the potency mea- sure being considered, and all R2 values are ~0.15. Next, the six methods of summarizing all the experi- ments for a given chemical (described in Table VIII) were examined. The question of interest here, for each of the eight potency measures separately, is which of the six possible summary statistics is the best predictor of the, TD50? The results of this analysis for the combined sam- ple are shown in Table XII. No single summary statistic stands alone in predicting TD50, although MAX over the nine strain/activation combinations contributes to predic- tion for five of the eight potency measures. Table XIII provides the model R2 for all possible single- variable regressions for each potency measure. This table allows us to answer two questions: If we can choose only one summary statistic for predicting TD50 for a given potency measure, which summary statistic would it be? And how much better is the best model compared to other possible models? For 7 of the 8 potency measures, MAX over reps is the best summary statistic for predicting TD50. However, the R'- values for the "best" and the "'second-best'" models are not very different, and all the R" values are low (<0.07). For each of the six methods of summarizing experi- ments for a chemical, the eight potency measures were examined to determine which best predicts TD50. The TABLE XV. Models Chosen for Predicting Quantitative Carcinogenicity From Strain/Activation Combinations, Overall MAX, and Qualitative MUTA for the Combined Sample of 108 Chemicals Potency Predictors in F-test measure final model R-" P-value bM MUTA, h1535" 0.10 0.0046 bet hi00, rl00 0.13 0.0097 bE_, MUTA 0.07 0.0054 bx MUTA 0.07 0.0054 bR r1535, MUTA 0.13 0.1301 I bD~ r1535, MUTA 0.13 0.0010 bo., MUTA, r1535 0.11 0.0025 bLED h1535, MUTA 0.13 0.0013 *Strain/activation combination. The first letter represents the activation (none, _hamster liver, rat liver) and the numbers represent the Salmonella strain. results of this analysis for the combined sample are pro- vided in Table XIV. The results depend on the summary statistic being considered, but in general bLED most often appears in the final model. Conclusion III In all cases, the R~ values for the "best" and the "sec- ond-best" models are not very different, and all the R2 values are low (<0.07), indicating that the relationship between mutagenic potency, regardless of how it is mea- sured, and quantitative carcinogenicity is weak. All of the models discussed above were reexamined with qualitative mutagenicity (MUTA) included in the predictor lists. In the prediction of CARCIN from the nine strain/activation combinations, MUTA was included in the final model for 7 of the 8 potency measures (see Table XV). However. the inclusion of MUTA improved the model R-~ by only 0.05 or less. In the comparison of summary statistics for each potency measure, and the comparison of potency measures for each summary statis-
Page 12: 2063633497 Log in for more options!
tic, the addition of MUTA to the predictor list yielded final models of "intercept + MUTA" only. Again, the model R" improved by <0.05. Conclusion IV In almost all cases, the inclusion of qualitative mutage- nicity improves prediction of quantitative carcinogenicity from quantitative mutagenicity. However, the improve- ments in the model R-" values are very small (-~0.05). DISCUSSION This study examined whether the potency of the SAL mutagenicity response, measured by a number of different parameters, could be used to improve the predictivity of carcinogenicity, either qualitatively or quantitatively. Qualitative carcinogenicity was determine.d by the posi- tive/negative NTP decision on each chemical, whereas quantitative carcinogenicity was determined by the avail- able TD50s of the chemicals under study. The study being reported is not the first to investigate carcinogenic pre- dictivity from SAL, but it is the first to use and compare different measures of SAL potency. When predicting qualitative carcinogenicity within the NTP dataset of chemicals, only qualitative mutagenicity is useful: none of the quantitative measures improves the carcinogenicity prediction. When predicting quantitative carcinogenicity, MAX over replicates has the highest R2 value for 7 of 8 potency measures. However, all R2 values are less than 0.07. Of the eight different potency measures considered, bLED was most often one of the best predictors of quantitative carcinogenicity. In all cases, however, the relationship between mutagenic potency predictors and quantitative carcinogenicity is very weak, supporting the low correlations between mutagenic and carcinogenic po- tency reported previously (see Table I). Piegorsch and Hoel [ 1988] demonstrated that the corre- lation between mutagenic and carcinogenic potencies could be affected by the chemical structural subsets ana- lyzed. According to their results, although the correlation for the entire set of chemicals was 0.44, the correlations for the various structural subsets (congeneric sets) ranged from 0.25 to 0.99. Similarly, Hatch [1992] showed a higher correlation when the calculations were limited to specific structural classes of chemicals. An interesting alternative was presented by Bogen [1995], who studied only those chemicals that were positive in both the SAL and rodent bioassays. He found an improved prediction of carcinogenic potencies fron~ mutagenic potencies for chemicals positive in rodents and SAL. In contrast, we analyzed the entire diverse set of ~hemicals, rather than subdivide it into chemical or response classes, because there were too few mutagenic chemicals within each subset. Predicting Carcinogenicity From Mutagenic Potency 321 The goal here was to determine whether the results obtained were dependent on a particular potency measure and/or a way of summarizing the data. Our study firmly establishes that the predictive relationship between quan- titative SAL mutagenicity and carcinogenicity is, at best, weak, regardless of the potency measure used. The lack of a strong predictive relationship between SAL mutage- nicity and rodent carcinogenicity hardly seems surprising. Mutagenesis may be only the first step in some pathways that lead to cancer. The inference drawn here, however, is that thi~ DNA damage as measured by mutations in SAL is not the rate-limiting consideration in the ultimate development of cancer in rodents. Currently, similar studies are examining the predictive relationship between mutagenicity and rodent carcinoge- nicity using several other STTs (mouse lymphoma test, sister chromatid exchange, and chromosome aberrations). The purpose of these studies is to determine whether po- tency of the ST'[' responses, alone or in combination, could be used to improve the qualitative or quantitative prediction of carcinogenicity. ACKNOWLEDGMENTS We thank Dr. Lois Gold, University of California, Berkeley, for providing us with the carcinogen TD50 cal- culations used in these analyses, and Dr. Leslie Bernstein for supplying the computer code for analysis of potency. Portions of this research performed at UNC-CH were supported by contract 273-90-1-0005 from the National Institute of Environmental Health Sciences. Dr. Kim's research was partially supported by the Korea Research Foundation through its 1995 Overseas Research Program for University Professors. REFERENCES Ames BN, Durston WE. Yamasaki E, Lee FD (1973): Carcinogens are mutagens: A simple test system combining liver homogenates for activation and bacteria for detection. Proc Natl Acad Sci USA 70:2281-2285. Ames BN, McCann J, Yamasaki E ( 1975): Methods for detecting carcin- ogens and mutagens with the Salmonella/mammalian-microsome mutagenicity test. Mutat Res 31:347-364. Bemstein L, Kaldor J, McCann J, Pike MC ( 1982): An empirical ap- proach to the statistical analysis of mutagenesis data from the Salmonella test. Mutat Res 97: 267-281. Bogen, KT (1995): Improved prediction of carcinogenic potencies from mutagenic potencies for chemicals positive in rodents and the Ames test. Environ Mol Mutagen 25:37-49. Gold LS, Sawyer CB, McGaw R, Buckman GM, deVeciana M, Levin- son R, Hooper NK, Havender WR, Bernstein L. Peto R, Pike MC, Ames BN (1984): A carcinogenic potency database of the standardized results of animal bioassays. Environ Health Perspect 58:9 -22. Haseman JK. Zeiger E, Shelby MD, Margolin BH. Tennant RW f 1990): Predicting rodent carcinogenicity from four in vitro genetic toxic-
Page 13: 2063633498 Log in for more options!
322 Fetterman et al. ity assays: An evaluation of 114 chemicals studied by the N~- tional Toxicology Program. J Am Stat Assoc 85:964-971. Hatch FT, Knize MG, Moore DH II, Felton JS (1992): Quantitative correlation of mutagenic and carcinogenic potencies for betero- cyclic amines from cooked foods and additional aromatic amines. Murat Res 271:269-287. Margolin BH, Kaplan N, Zeiger E (1981): Statistical analysis of the Ames Salmonella/microsome test. Proc Nat[ Acad Sci USA 78:3779 -3783. Margolin BH, Kim BS, Risko KJ (1989): The Ames Salmonella~micro- some mutagenicity assay: Issues of inference and validation. J Am Stat Assoc 84:651-661. Margolin .BH, Kim BS, Smith MG, Fetterman BA, Piegorsch WW, Zeiger E (1994): Some comments on potency measures in muta- genicity research. Environ Health Perspect 102(Suppt 1):91-94. Margolin BH, Risko ICI (1988): The statistical analysis of in vivo geno- toxicity data: Case studies of the rat hepatocyte UDS and mouse bone marrow micronucleus assays. In Ashby J, de Serres FJ. Shelby MD, Margolin BH, Ishidate M Jr, Becking, GC (eds): "Evaluation of Short-Term Tests for Carcinogens: Report of the International Programme on Chemical Safety's Collaborative Study on In Vivo Assays." Cambridge University Press, pp 1.31 - 1.42. McCann J, Choi E, Yamasaki E, Ames BN ( 1975): Detection of carcino- gens as mutagens in Salmonella microsome test: Assay of 300 chemicals. Proe Natl Acad Sci USA 72:5135-5139. McCann J, Gold LS, Horn L, McGill R, Graedel TE, Kaldor J (1988): Statistical analysis of Salmonella test data and comparison to results of animal cancer tests. Murat Res 205:183-195. Meselson M, Russell K (1977): Comparisons of carcinogenic and muta- genie potency. In Hiatt HH, Watson JD, Winsten JA (eds): "'Ori- gins of Human Cancer. Book C: Human Risk Assessment." Cold Spring Harbor, NY: Cold Spring Harbor Press, pp 1473-1481. Parodi S, Taningher M, Romano P, Grilli S, Santi L (1990): Mutagenic and carcinogenic potency indices and their correlation. Teratogen Carcinogen Mutagenen 10:177-197. Piegorsch WW, Hoel DG (19881: Exploring relationships between mum- genie and carcinogenic potencies. Mutat Res 196:161 - 175. Purchase IFH, Longstaff E, Ashby J, Styles JA, Anderson D, Lefevre PA, Westwood FR (I 976~: Evaluation of six short term tests for detecting organic chemical carcinogens and recommendations for their use. Nature 264:624-627. Sugimura T, Sato S, Nagao M. Yahagi T, Matsushima T, Seino Y, Takeuchi M, Kawachi T t 1976): Overlapping of carcinogens and mutagens. In Magee. PN, Takayama S, Sugimura, T, Matsu- shima, T (eds): "Fundamentals of Cancer Prevention." Balti- more: University Park Press, pp 191-215. Tennant RW, Margolin BH. Shelby MD, Zeiger E, Haseman JK, Spal- ding J, Caspary W, Resnick M, Stasiewicz S, Anderson B, Minor R (1987): Prediction of chemical carcinogenicity in rodents from in vitro genetic toxicit), assays. Science 236:933-941. Zeiger E (1987): Carcinogenicity of mutagens: Predictive capability of the Salmonella mutagenesis assay for rodent carcinogenicity. Cancer Res 47:1287-1296. Zeiger E, Haseman JK, Shelby MD, Margolin BH, Tennant RW ( t990): Evaluation of four in ~itro genetic toxicity tests for predicting rodent carcinogenicity: Confirmation of earlier results with 41 additional chemicals. Environ Mol Mutagen 16(Suppl 18): 1 - 14. Zeiger E, Risko KJ, Margolin BH (1985): Strategies to reduce the cost of mutagenicity screening with the Salmonella assay. Environ Mutagen 7:901-911. Zeiger E, Tennant RW (1986): Mutagenesis, clastogenesis, carcinogene- sis: Expectations, correlations, and relations. In Ramel C, Lam- bert B, Magnusson J (eds): "Genetic Toxicology of Environmen- tal Chemicals. Part B: Genetic Effects and Applied Mutagene- sis." New York: Wile.~. pp 75-84. Accepted K. R. Tindall
Page 14: 2063633499 Log in for more options!
2063633499
Page 15: 2063633500 Log in for more options!
Workplace Conditions, Socioeconomi ' 475" Status, and the Risk of Mortality and Acute Myocardial Infarction: The Kuopio Ischemic Heart Disease Risk Factor Study Objectives. This study investi- gated whether the association be- tween workplace conditions and the risk of all-cause and cardiovascular mortality and acute myocardial infarc- tion differed by socioeconomic sta- Methods. Prospective data were used to examine these associations in 2297 Finnish men, with adjustment for prevalent diseases and biological, behavioral, and psychosocial covari- ares, and stratified by employment smam and workplace social support. Results. Elevated age-adjusted relative hazards for all-cause mortal- ity were found for men who reported high demands, low resources, and low income; high demands, high resouro~ and low income; and low demand~ high resources, and low income. Similar patterns were found for cardiovascular mortality. In con- trast, elevated age-adjusted t~iatj_'ve lmzar~ for acute myocardial infarc- tion were observed only in men who reported high demands, low resources, and low income. These result~ did not differ by level of workplace social support or employ- ment status. Conc/us/ons. The negative ef- feet~ of workplace conditions ~ mortality and of myocardial infarc- tion risk depended on income level and were largely mediated by known risk factors. (Am J Public Health~ 1997;87:617-622) John Lynch, PhD, MPH, Niklas Krause, MD, PhD, George A. Kaplan, PhD, Jaakko Tuomilehto, MD, PhD, and Jukka T. Salonen, MD, PhD Introduction Researchers' understanding of how organizational and psychosocial features of work affect morbidity and mortality has been greatly influenced by the idea that poor health outcomes may be associated with work that is psychologically demand- ing but offers few opportunities for control.t-3 This notion has been opemtion- alized in a variety of ways and has received empirical support in a large number of cross-sectional and case- control studies,4 but when studied prospec- tively, the evidence has been more mixed.~-6 In addition, relatively little is known about the pathways through which job characteristics might influence disease risk.7 In their review of these studies, Schnall and Landsbergis~ suggest the need to expand the basic demand/control formulation to include other important workplace characteristics such as social support, physical exertion, job security, and hazardous exposures. They also argue that it is important to adjust the associa- tion between job conditions and disease risk to control for potential confounding by socioeconomic Status (SES). Previous studies have generally adopted this line of reasoning and treated SES as a con- founder of the association between, job characteristics and health outcomes in an attempt to find the "independent" effect of workplace factors on health,s-t° In contrast, we believe that statisti- cally partitioning the independent effects of SES and job conditions on disease risk ignores important structural connections between social class and work.)1 Further- conditions on health. We investigated the association between workplace demands and resources and the risk of all-cause mortality, cardiovascular mortality, and incident acute myocardial infarction at different levels of SES, as measured by economic reward. These associations were examined prospectively in a popula- tion-based sample of Finnish men, with adjustment for prevalent diseases and biological, behavioral, and psychosocial covariates, and in subsamples stratified by employment status and workplace social support. Methods Study Population The subjects were participants in the Kuopio Ischemic Heart Disease Risk Factor Study, which was designed to investigate previously unestablished risk factors for ischemic heart disease, carodd atherosclerosis, and other related out- comes in a population-based sample of men in eastern Finland.t2 Of 3433 eligi- ble men aged 42, 48, 54, or 60 years resident in the town of Kunpio or its surrounding communities, 198 could not be included because of death, serious disease, or migration away from the area; of the remainder, 2682 (82.9%) agreed to John Lynch and Niklas Krause are with the Western Consortium for Pubiic Health. and George A. Kaplan is with the California Depart- merit of Health Services, at the Human Popula- tion Laboratory, Berkeley, Calif. Jaakko Tu- omilehto is with the Nationa/ Public Health Institute, Helsinki, F'mland. Jukka T. Salonen is with the Research Institute of Public Health. University of Kuopio, Kuopio, F'mland. more, it is possible that having high levels Requests for reprints should be sent to John of income or education may provide Lynch. PhD, MPH, Human Population Labora- cognitive and tangible resources that tory, 2151Berkeley Way, Annex2, Berkeley, CA 94704. could reduce the effects of poor working This paper was accepted October ~. 1996. APrif I~3T- rV°f- ST,N'o-4 American Journni of Public Health 617
Page 16: 2063633501 Log in for more options!
participate in the study. Baseline examina- tions were conducted between March 1984 and December 1989. No marked sociodemographic differences have been found between participants and nonpartici- pants.13 Complete information on work- place demands, resources, economic re- ward, and all covadates was available for 2297 men for the mortality analyses. There were 289, 315, 1387, and 306 men in the 42-, 48-, 54-, and 60-year-old age groups, respectively. A total of 570 of these men were excluded from the acute myocardial infarction incidence analyses (n = 1727) because of a prior history of acute myocardial infarction, angina pecto- ris, nitroglycerine use, or positive findings of angina from the London School of Hygiene Cardiovascular Questionnaire.~'~ Assessment of Workplace Demands, Resources, .ayd Economic Reward At the baseline examinations partici- pants completed detailed questionnaires including items on aspects of their work environment, income, and education. Items that conformed to important theoretical domains discussed in the literature were considered for inclusion in the measure- ment of workplace demands.4 In accor- dance with suggestions made in this literature, items on risk of unemployment, accidents, and physical exertion were included to supplement the questions about psychological demands. Partici- pants were asked to rate on a Likert-type scale (0-4) how much mental strain or stress the following things caused them at work: excessive supervision of time sched- ules, troublesome supervisors, trouble- some fellow workers, job responsibility, poorly defined tasks and responsibilities, risk of accidents, risk of unemployment. irregular work schedules, and the mental strenuousness of work. They were also asked how often they had work deadlines, how much stress this caused them, and the physical strenuousness of their work. Scores for the demands scale were im- puted on the basis of nonmissing values for men who had no more than 2 missing items. Men who had more than 2 missing items were excluded from the analyses. The I1 individual items were dichoto- mized at the midpoint of the rating scale, so that only when men reported that the particular aspect of work caused them more .than "average" sla-ain were their responses considered positive. The di- chotomized items were then summed to form the workplace demands scale, which had high internal consistency (Cronbach's alpha = .78). Resources were assessed with ques- tions asking participants to rate statements concerning the degree to which their work was interesting, allowed them to use their skills and capabilities, allowed them to feel composed and competent, was enjoy- able, and was meaningful. Imputation of items and scoring of the resources scale were done in the same way as for demands (Cronbach's alpha = .77). Eco- nomic reward was assessed by self- reported income, dichotomized so that the lowest 40% of income earners were' considered low. Previous analyses had shown that the bottom two quintiles of the income distribution were at significantly elevated risk of mortality and acute myocardial infarction,ts The distributions of scores for demands and resources were dichotomized at the median, producing eight possible combinations of high and low demands, resources, and economic reward. Assessment of Follow-Up Events Participants were followed until the end of December 1994 for the mortality analyses, with a median follow-up of 8.1 years (range: 5.0-10.8). For the acute myocardial infarction analyses men were followed until the end of December I992, for a median of 6.1 years (range: 3.0-8.8). All-cause and cardiovascular mortality were ascertained by linkage to the Na- tional Death Registry, which is main- tained for all Finnish citizens. Classifica- tion of death was based on the underlying cause, reviewed at the National Center of Statistics of Finland. Cardiovascular deaths were classified according to the ninth revision of the International Classifica- tion of Diseases (ICD) for ICD codes 390-459. Of the 189 deaths, 93 were from cardiovascular causes. First-event, nonfatal acute myocar- dial infarctions and coronary deaths were ascertained by linkage to an acute myocar- dial infarction register established under the World Health Organization's MONICA (Monitoring of Trends and Determinants of Cardiovascular Diseases) project,t6 There were 89 fatal or nonfatal incident acute myocardial infarctions recorded in this group of men. Assessment of Covariates As part of the baseline examinations, extensive information was collected on biological, behavioral, and psychosocial covariates. In addition, the prevalence of diseases was assessed by detailed medical histories. All covariates included in these analyses have been shown to be associ- ated with mortality and acute myocardial infarction,is Biological covariates. Biological co- vadates included plasma fibrinogen, high- density lipoprotein, serum apolipoprotein B (APO B), serum triglyceddes, blood hemoglobin and leukocyte count, serum ferritin and copper, hair mercury, systolic blood pressure, body mass index, height, and eardiorespiratory fitness. The meth- ods of assessment for each of these factors have been previously described.tSAT-22 Behavioral covariates. Alcohol con- sumption, measured in grams per week, was assessed by dietary recording for a 4-day period and also for the previous 12 months, by self-administered question- naire.23 Smoking was measured by ques- tionnaire and classified for this analysis as "never smoked, .... former smoker," and "current smoker" (measured in pack- years). The total duration (minutes per week) of conditioning physical activity was assessed from a 12-month leisure- time history,z~ Psychosocial covariates. Depression was assessed from a shortened 180-item version of the Minnesota Multiphasic Personality Inventory that had previously been used in Finnish populations. Hope- lessness was assessed with two question- naire items, scored on a five-point Likert scale.24 Marital status was assessed by questionnaire and categorized as "mar- ried," "single," or "divorced/widowed." Prevalent diseases. Prevalent dis- eases were ascertained from detailed medical histories, medication records, and examinations at baseline. Indicator vari- ables were used to represent a history of cardiovascular disease (symptomatic, asymptomatic, claudication or. cardiomy- opathy, and other), hypertension, stroke, diabetes, respiratory disease, and cancer. Statistical Analysis Associations between workplace de- mands, resources, and economic reward and all-cause mortality, cardiovascular mortality, and acute myocardial infarction were assessed with Cox proportional hazard models.2~ The analyses were con- ducted with the PHREG procedure in SAS version 6.09 on a Sun Spare Station II.26 To assess the impact of covariate adjustment on the age-adjusted relative hazards (RHs), we calculated the propor- tion of excess relative risk (hazard) accounted for by covariate adjustm.ent as [RH~,~j~a~- 1] 618 Atnerican Journal of Public Health April 1997. Vol. 87. No. 4
Page 17: 2063633502 Log in for more options!
Workplace Conditions and Mortality TABLE 1--Workplece Demands, Resources, and Economic Reward and Prevalence of Selected Sociodemographic Characteristics at Baseline among Men in Eastern Finland (n = 2297) Prevalent Level of Demands/ Age 55 or Blue- White- Not Ischemic Heart Low Social Completed Resources/ Older, % Farmers, % Collar, % Collar, % Employed, % Disease, % Support, % High School, % Income No. (%) (n = 346) (n = 341) (n = 984) (n = 944) (n = 96) (n = 570) (752) (n = 393) High/Low/Low 260 (11.3) 11.9 15.0 17.2 4.0 17.7 15.8 13.3 2.5 High/Low/High 353 (15.4) 12.1 5.6 13.8 20.1 17.7 13.9 20.6 19.1 Low/Low/Low 159 (6.9) 9.2 12.6 7.5 4.5 3.1 7.7 7.7 1.8 Low/Low/High 361 (15.7) 9.0 5.9 13.6 21.5 7.3 7.2 14.9 29.3 High/High/Low 261 (11.4) 17.1 19.1 15.4 4.6 18.8 20.5 9.4 1.3 High/High/High 244 (10.6) 11.0 6.7 10.6 12.3 14.6 12.1 10.1 12.2 Low/High/Low 243 (10.6) 12.4 24.1 10.5 5.8 11.5 11.9 10.4 1.8 Low/High/High 416 (18.1) 17.3 11.1 11.5 27.2 9.4 10.8 13.6 32.1 TABLE 2~Workplace Demands, Resources, and Economic Reward and the Relative Hazard (RH) of All-Cause Mortality among Men in Eastern Finland (n = 2297), A~usted forage Plus,.. Adjusted for Age Prevalent Behavioral Psychosocial Biological Level of Demands/ Disease= Covadatesb Covariatesc Covariatesd All Covadates Resources/Income RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) High/Low/Low 3.00 (1.81, 4.98) 2.38 (1.42, 4.01) 2.58 (1.55, 4.31) 2.00 (1.16, 3.42) 2.33 (1.39, 3.89) 1.64 (0.94, 2.87) High/Low/High 0.94 (0.50, 1.76) 0.85 (0.45, 1.60) 0.87 (0.46, 1.64) 0.76 (0.40, 1.44) 0.90 (0.48, 1.70) 0.79 (0.41, 1.50) Low/Low/Low 1.05 (0.51, 2.16) 0.94 (0.45, 1.94) 1.04 (0.50, 2.14) 0.82 (0.39, 1.71) 0.86 (0.41, 1.79) 0.79 (0.38, 1.67) Low/Low/High 0.74 (0.37, 1.47) 0.76 (0.38, 1.51) 0.72 (0.36, 1.42) 0.69 (0.33, 1.33) 0.78 (0.39, 1.56) 0.77 (0.38, 1.55) High/High/Low 2.15 (1.26, 3.68) 1.61 (0.93, 2.80) 1.90 (1.11, 3.25) 1.58 (0.91,2.75) 1.48 (0.86, 2.56) 1.11 (0.62, 1.98) High/High/High 0.59 (0.26, 1.33) 0.53 (0.23, 1.18) 0.58 (0.26, 1.30) 0.52 (0.23, 1.18) 0.53 (0.23, 1.18) 0.47 (0.21, 1.08) Low/High/Low 2.30 (1.35, 3.92) 1.97 (1.15, 3.37) 1.99 (1.16, 3.41) 1.83 (1.06, 3.15) 1.73 (1.01, 2.97) 1.30 (0.74, 2.27) Low/High/High Reference Reference Reference Reference Reference Reference Note. CI = confidence interval. =Cardiovascular disease (symptomatic, asymptomatic, cardiomyopathy, claudication and other), hypertension, stroke, diabetes, respiratory disease, and cancer. bSmoking, alcohol consumption, and physical activity. ˘Hopelessness, depression, and marital status. ~Plasma fibdnogen, high-density lipoprotein, serum apolipoprotein B, serum tdglyceddes, blood hemoglobin and leukooytes, serum ferdtin and copper, hair memury, systolic blood pressure, body mass index, height, and cardiorespiratory f'dness. Results The 27 covariates were grouped into four categodes~prevalent diseases and biological, behavioral, and psychosocial covariates--and analyses conducted in two phases. First, we examined associa- tions with separate adjustment for each group of covariates and age. In the second stage, associations were adjusted for age and all 27 covariates simultaneously. In all cases hazards were relative to the low- demands, high-resources, high-income group. Table 1 shows sociodemographic characteristics for the eight combinations of demands, resources, and income. There were striking differences in the distribu- tion of job demands, resources, and income by age, education, white-collar employment, prevalent ischemic heart disease, and unemployment. Men who had jobs with low demands were almost twice as likely as men in work with high demands to have completed high school (65% vs 35%). Table 2 presents the relative hazards for all-cause mortality by combination of demands, resources, and income, adjusted for age, for age plus each covariate group separately, and for age plus all covariates simultaneously. Significantly elevated age- adjusted relative hazards for all-cause mortality were found for men who re- ported high demands, low resources, and low income (RH = 3.00; 95% confidence interval [CI] = 1.81, 4.98); high de- mands, high resources, and low income (RH = 2.15; 95% CI = 1.26, 3.68); and low demands, high resources, and low income (RH = 2.30; 95% CI = 1.35, 3.92). Separate adjustment for each covari- ate group attenuated the magnitude of the associations. For example, the excess rel- ative hazard for the high-demand, low- resource, low income group was reduced by 31% after adjustment for prevalent disease, by 21% after adjustment for behavioral covariates, by 50% after adjust- ment for psychosocial covariates, and by 34% after adjustment for biological covari- ates. Simultaneous adjustment for all covariates reduced the excess reladve hazard by 68%. Table 3 presents the relative hazards for cardiovascular mortality by combina- tion of demands, resources, and income, with the same adjustments by age and covariates. The pattern of findings was very similar to that for all-cause mortality. Significandy elevated age-adjusted rela- April 1997. Vol, 87. No. 4 American Journal of Public Health 619
Page 18: 2063633503 Log in for more options!
TABLE 3---Workplace Demands, Resources, and Economic Reward and the Relative Hazard (RH) of Cardiovascular Mortality among Men in Eastern Finland (n --- 2297) Adjusted for Age Plus.. Adjusted Level of Demands/ for Age Prevalent Behavioral Psychosocial Biological All Resources/ Disease Covadates Covariates Covariates Covadates Income RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) High/Low/Low 3.12 (1.48, 6.60) 2.05 (0.96, 4.40) 2.59 (1.22, 5.52) 1.94 (0.88, 4.29) 2.28 (1.07, 4.89) 1.54 (0.67, 3.54) High/Low/High 0.97 (0.38, 2.45) 0.80 (0.31,2.03) 0.91 (0.36, 2..32) 0.74 (0.29, 1.90) 0.88 (0.34, 2.24) 0.82 (0.31, 2.14) Low/Low/Low 1.49 (0.57, 3.93) 1.16 (0.44, 3.08) 1.43 (0.54, 3.78) 1.13 (0.42, 3.01) 1.03 (0.38, 2.75) 0.83 (0.30, 2.33) Low/Low/High 0.87 (0.33, 2.28) 0.89 (0.34, 2.35) 0.84 (0.32, 2.20) 0.76 (0.29, 2.01) 0.97 (0.36, 2.56) 0.94 (0.35, 2.55) High/High/Low 2.75 (1.28, 5.90) 1.53 (0.69, 3.37) 2.33 (1.08, 5.03) 1.95 (0.88, 4.29) 1.63 (0.74, 3.58) 1.12 (0.48, 2.61) High/High/High 0.49 (0.14, 1.78) 0.39 (0.11, 1.43) 0.47 (0.13, 1.72) 0.42 (0.11, 1.52) 0.39 (0.11, 1.43) 0.37 (0.10, 1.35) Low/High/Low 2.29 (1.03, 5.06) 1.72 (0.77, 3.82) 1.88 (0.84, 4.21) 1.84 (0.82, 4.13) 1.49 (0.66, 3.35) 0.99 (0.42, 2.30) Low/High/High Reference Reference Reference Reference Reference Reference Note. CI = confidence interval. =Covariates as in Table 2. TABLE 4--Workplace Demands, Resources, and Economic Reward and the Relative Hazard (RH) of Incident Acute Myocardial Infarction among Men in Eastern Finland (n = 1727) Adjusted for Age Plus. Adjusted for Age Behavioral Psychosocial Biological All Level of Demands/ Covadates Covadates Covadates Covariates Resources/Income No. RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) RH (95% CI) High/Low/Low 170 2.59 (1.36, 4.94) 2.30 (1.20, 4.41) 2.18 (1.11, 4.28) 1.94 (1.00, 3.76) 1.57 (0.78, 3.18) High/Low/High 274 0.67 (0.29, 1.57) 0.60 (0.26, 1.41) 0.61 (0.26, 1.48) 0.61 (0.26, 1.44) 0.50 (0.21, 1.20) Low/Low/Low 115 0.62 (0.21, 1.87) 0.60 (0.20, 1.81) 0.56 (0.18, 1.69) 0.54 (0.18, 1.62) 0.41 (0.13, 1.29) Low/Low/High 320 1.25 (0.63, 2.49) 1.22 (0.61, 2.41) 1.24 (0.62, 2.46) 1.30 (0.65, 2.58) 1.11 (0.55, 2.24) High/High/Low 144 1.04 (0.44, 2.44) 0.91 (0.39, 2.15) 0.86 (0.36, 2.07) 0.62 (0.25, 1.50) 0.55 (0.22, 1.35) High/High/High 175 0.63 (0.23, 1.71) 0.60 (0.22, 1.54) 0.59 (0.22, 1.62) 0.52 (0.19, 1.44) 0.43 (0.15, 1.22) Low/High/Low 175 0.93 (0.41,2.10) 0.83 (0.38, 1.89) 0.85 (0.37, 1.95) 0.70 (0.30, 1.60) 0.65 (0.28, 1.52) Low/High/High 354 Reference Reference Reference Reference Reference Note. CI = confidence interval. =Covadates as in Table 2. tive hazards for cardiovascular mortality were found in the same groups as for all-cause mortality. Separate adjustment for each covafiate group attenuated the magnitude of the associations. Simulta- neous adjustment for all covariates re- duced the excess relative hazard by 75%. Table 4 presents the relative hazards for incident cases of acute myocardial infarction by combination of demands, resources, and income, adjusted for age, for age plus each covariate group sepa- rately, and for age plus all covariates simultaneously. As 570 men with preva- lent ischemic heart disease had already been excluded from these analyses, there was no further adjustment for other prevalent diseases. In contrast to mortal- ity. significantly elevated age-adjusted relative hazards for acute myocardial infarction were observed only in men who reported high demands, low resources, and 10'~: iiicome (RH = 2.59; 95% CI = 1.36, 4.94). Simultaneous adjustment for behavioral, psychosocial, and biological covariates decreased the age-adjusted rela- tive hazard for men with high demands, low resources, and low incomes by 64% to 1.57 (95% CI = 0.78, 3.18). Discussion These results show that the effect of job conditions on mortality and acute myocardial infarction depends on the level of economic reward, and that these associations are largely mediated by known risk factors. Our findings are consistent with the effort-reward imbal- ance model proposed by Siegrist, which suggests that the imbalance between high job demands and high psychological immersion in work roles and low eco- nomic and psychosocial rewards is associ- ated with poor health outcomes.27 In addition, these findings are consistent with evidence from other studies, which found stronger associations between poor job conditions and health in less educated men and in blue-collar workers) How- ever, in stratified analyses (not shown), there was no evidence that the patterns of increased mortality and acute myocardial infarction risk differed by the level of workplace social support. Similar patterns of increased risk were found for both all-cause and carclio- vascular mortality. The highest mortality risks were found in men whose work was demanding with low resources and low economic reward, while men with the same levels of demand and economic reward but with high resources had 620 American Journal of Public Health April 1997, Vol. 87. No. 4
Page 19: 2063633504 Log in for more options!
Workplace Conditions and Mortality somewhat lower mortality risks. Surpris- ingly, we found elevated mortality risks in men with low-demand, high-resource, low-income jobs (RH = 2.30). This might be explained as an effect of low income, but men with the same level of job demands and income but low resources were not at increased" risk. As the low- demand, high-resource, low-income group had the highest proportion of farm and forestry workers (31%), it is possible that the measures of demands and resources used in this study did not fully address specific negative job characteristics, such as close exposure to organic and chemical pollution, associated with work in these occupations.2s In addition, the fact that men in jobs with low demands, high resources, and low incomes were not at increased risk of acute myocardial infarc- tion suggests that other factors might be responsible for their increased mortality dsk. When the association between job conditions, income, and mortality was adjusted for covadates, biological risk factors reduced the magnitude of the associations by between 34% and 60%. In addition, psychosocial factors and preva- lent diseases reduced the associations by as much as 50%. However, as job conditions, income, psychosocial charac- teristics, and prevalent diseases were all assessed at the same point in time, it is impossible to disentangle their temporal sequencing. One interpretation of these results is that over time, the effects of poor working conditions and low economic reward lead to feelings of hopelessness and depression, poorer behavioral and biological risk factor profiles, and higher levels of morbidity, which contribute to increased mortality risk. As we have argued elsewhere, adjustment for factors that may be consequences of working in poor conditions with low economic re- wards would constitute overadjustment.29 The association between job condi- tions, economic reward, and incident acute myocardial infarction showed that men in high-demand, low-resource, low- income jobs had an age-adjusted risk of acute myocardial infarction that was more than 2.5 times that of men with low- demand, high-resource, high-income jobs. The magnitude of this association was reduced by more than 40% with adjust- ment for biological risk factors for acute myocardial infarction, and by over 60% with simultaneous adjustment for all covafiates. Several issues should be mentioned before conclusions are drawn from these results. First, the measure of workplace demands may have been subject to reporting bias because it was based on a self-assessment of the extent of stress or strain associated with aspects of work, although mortality and acute myocardial infarction risks remained elevated even after adjustment for depression and hope- lessness. While the most accurate assess- ment of job demands and resources would be achieved by a combination of subjec- tive and objective measures, high correla- tions between subjective assessments and expert ratings of job conditions have been demonstrated,a° Furthermore, there is no rationale for how a bias in the self- reporting of job demands could explain the overall income-dependent pattern of our findings for mortality and acute myocardial infarction. Second, it is pos- sible that the measure of resources used in this study did not fully capture both the "skill discretion" and "decision author- ity" dimensions of workplace control that have been suggested as important modifi- ers of workplace demands.ao Third, our assessment of job de- mands, resources, and income was based on a single measurement and does not take into account changes in job expo- sures over time. Furthermore, structural alterations to the Finnish economy have seen large increases in unemployment and changes in the occupational structure of the region.3~ However, our results were no different in stratified analyses (not shown) that excluded men who reported any change in job title over the last 10 years or in other analyses that excluded men who were either unemployed or retired at baseline. Fourth, while our findings are based on a population of men in eastern F'miand, we believe these results may be applicable to similar populations beyond the immedi- ate confines of the region. Kuopio is the major provincial center in eastern F'miand and has an administrative, industrial, and service-based economy dominated by processing of farm, food, metal, and forest products. Most risk factors for mortality and acute myocardial infarction in Fin- land have been documented in other 32 populations. However, because this sam- ple is limited to middle-aged men, it is unclear whether these findings can be applied to the relationship between work- ing conditions and income and mortality and acute myocardial infarction in women. To our knowledge, this is the first study to show that an increased mortality and acute myocardial infarction risk asso- ciated with organizational, physical, psy- chological, and social aspects of work was concentrated in low-income groups. With respect to informing interventions, our findings could be interpreted in three contexts. First, while there are a myriad of health-related interventions that target the workplace, relatively few--with perhaps the exception of programs to reduce toxic exposures~ectly address the physical, organizational, psychosocial nature of work itself. The majority of so-called workplace programs are individually ori- ented psychosocial and behavioral modifi- cation interventions that use the work- place as the site of program delivery. In this context, our findings imply that these efforts will be most effective by attempt- ing to alter the risk factor profiles of low-income workers. Second, a similar interpretation of our results suggests that interventions that do focus on the actual task requirements and organizational characteristics of work should also focus on those low-income groups that bear the highest cardiovascu- lar disease and mortality burden. These interventions could focus on workplace design by reducing psychological and physical demands and increasing skill utilization, job satisfaction, and economic rewards. This approach would consider low income as an internal feature of the workplace, which, like other job demands and resources, could be modified. While efforts to improve the conditions and economic returns of work would be laudable, it is also important to remember that low income is representative of a whole set of life experiences that extend beyond work life into family, recreational, and social domains. Third, we have shown that jobs with higher demands are more prevalent in Iow-SES groups. In addition, Iow-SES groups have fewer educational and eco- nomic resources with which to gain better jobs over lime, and so may have greater exposure to poor working conditions over the lifecourse. In this way, social position structures both the likelihood and duration of exposure to work that is detrimental to health. Several investigators have argued that the effect of work conditions on health must be considered in the context of the powerful economic, political, and social forces that determine both the distribution of and changes in potentially pathogenic job characteristics across dif- ferent population groups.IL33-37 These broader structural features of society determine the types of jobs that are available for particular sectors of the population. c.rl April 1997. Vol. 87. No. 4 American Journal of Public Health 621
Page 20: 2063633505 Log in for more options!
Lynch et ~1. Interventions that focus on the re- ward and organizational features of extant jobs witl not necessarily affect the power- ful economic, political, social, and tectmo- logical forces that generate and sustain both jobs with poor conditions of employ- ment and the system of social stratifica- tion that constrains employment opportu- nities for Iow-SES workers. Increased economic rewards, job enrichment, and work democratization are important, but they should exist within a broader context of life enrichment and social democratiza- tion for Iow-SES groups. If poor job conditions are just one of many deleteri- ous exposures for people of low SES, then we need to see the relationship between work conditions and health in the broader framework of a series of interacting circumstances, events, and behaviors that cascade over the lifecourse3829 and that ultimately place low-SES groups at higher risk of morbidity and mortality. [] Acknowledgments This work was supported in part by grant HL44199 from the National Heart, Lung, and Blood Institute and by grants from the Acad- emy of Finland and the Famish Ministry of Education. References 1. Karasek R, Tbeorell T. Healthy Work. New York, NY: Basic Books; 1990. 2. Ham M. Job strain and ischacmic heart disease: an epidemiologic study of metal workers. Ann Clin Res. 1988;20:143-145. 3. Johnson JV, Hall EM, Theorell T. Com- bined effects of job s~ain and social isolation on cardiovascular disease morbid- ity and mortality in a random sample of the Swedish male working population. ScandJ Work Environ Health. 1989;15:271-279. 4, Schnall PL, Landsbergis PA. Job strain and cardiovascular disease. Annu Rev Public Health. 1994;15:381-411. 5. Reed DM, Lacroix AZ, Karasek RA, Miller D, MacLean CA. Occupational strain and the incidence of coronary heart disease. Am J Epidemiol. 1989;129: 495-502. 6. Alterman T, Shekelle R.B, Vernon SW, Buran KD. Decision latitude, psychologic demand, job strain, and coronary heart disease in the Western Electric Study. Am J Epidemiol. 1994;139:620-627. 7. Greenlund KJ, Liu K, Knox S, McCreath H, Dyer AR, Gardin J. Psychosocial work characteristics and cardiovascular disease risk factors in young adults: the CARDIA study. Soc Sci Med. 1995;41:717-723. 8. Falk A, Hanson BS, lsacsson S-O, Oster- gren P-O. Job strain and mortality in elderly men: social network, support, and influence as buffers. Am J Public Health. 1992;82:1136-1139. 9. Karasek RA, Theorell T, Schwartz fiE, Schnall PL, Pieper CF, Michela JL. Job characteristics in reladon to the prevalence of myocardial infarction in the US Health Examination Survey (HES) and the Health and Nutrition Survey (HANES). Am J Public Health. 1988;78:910-918. 10. Tbeorell T, Hamsten A, de Faire U, Orth-Gomer K, Perski A. Psychosocial work conditions before myocardial infarc- tion in young men. lntJ CardioL 1987;15: 33-46. 11. Johnson .IV, Hall EM. Class, work and health. In: Amick BC, Levine S, Tarlov AlL Chapman Walsh D, eds. Society and Health. New York, NY: Oxford University Press; 1995;247-271. 12. Salouen .IT. Is there a continuing need for longitudinal epidemiologic research? The Kuopio Ischaemic Heart Disease Risk Factor Study. Ann Clin Res. 1988;20: 13. Lakka TA, Salouen Jr. Physical activity and serara lipids: a cross-sectional popula- fiou study in eastern Finnish men. Am J EpidemioL 1992;136:806-818. 14. Rose GA, Blackburn H, Gillum RF, et al. Cardiovascular Survey Methods. Geneva. Switzerland: World Health Organization; 1982. 15. Lynch JW, Kaplan GA, Salonen R, Cohen RD, Tuomilehto J, Salonen Jr. Do cardio- vascular risk factors explain the relation between socioeconomic status, risk of all-cause mortality, cardiovascular mortal- ity and acute myocardial infarction? Am J Epidemiol. 1996;144:934-942. 16. Tuomilehio J, A~tila M, Kaarsalo E, et al. Acute myocardial infarction (AMI) in Finland---baseline data from the FIN- MONICAAMI register in 1983-1985. Eur Heart J. 1992;13:577-587. 17. Wilson "IN˘, Kaplan GA, Kauhanen J, et al. The association between plasma fibrinogen concentration and five socioeconomic indi- ces in the Kuopio Ischemic Heart Disease Risk Factor Study. Am J Epidemiol. 1993;137:292-300. 18. Salouen Jr, Salonen R, Sepp~en K, et al. HDL, HDL2 and HDL3 cholesterol subfrac- tions and the risk of acute myocardial infarction. A prospective population study in eastern Finnish men. Circulation. 1991; 84:129--139. 19. Salonen JT, Nyyss6nen K, KorpelaA, et al. High stored iron levels are associated with excess risk of myocardial infarction in eastern Fiani~h men. Circulatimt 1992;86: 803-811. 20. Salouen JT, Salonen R, Korpela A, et al. Serum copper and the risk of acute myocardial infarction: a prospective study in men in eastern Finland. Am J EpidemioL 1991;134:268-276. 21. Salonen J'T, Seppgnen K, Nyyss6nen K, et al. Intake of mercury from fish, lipid peroxidation, and the risk of myocardial infarction, and coronary, cardiovascular, and any death in eastern F'trmish men. Circulation~ 1995;91:645-655. 22. Lakka T, Ven~il~inen JM, Rauramaa IL et al. Relation of leisure-time physical activ- ity and cardiorespiratory fitness to the risk . of acute myocardial infarction in men. N EnglJ Med~ 1994;330:1549-1554. 23. Ihanalnen M, Salonen R, Seppanen R, et al. Nutrition data collection in the Kuopio Ischaemi˘ Heart Disease Risk Factor Study: nu~ent intake of middle-aged Finnish men. Nutr Res. 1989;9:597-604. 24. Everson SA, Goldberg DE, Kaplan GA, et al. Hopelessness and risk of mortality, myocardial infarction and cancer inci- dence. Psychosom Med. 1996;58:113-121. 25. Cox DR, Oakes D. Analysis of Survival Data. New York, NY: Chapman Hall; 1984. 26. SAS User's Guide: Statistics. Version 6.09. Cary, NC: SAS Institute Inc; 1990. 27. Siegrist J. Adverse health effects of high effort/low reward conditions. J Occup Health Psych. 1996;1:27-41. 28. Notkola V J, Husman KR, Laukkanen VJ. Momdity among male farmers in Finland during 1979-1983. Scand J Work Environ Health. 1987;13:!24-128. 29. Lynch JW, Kaplan GA, Salonen R, Cohen RD, Salonen JT. Socioeconomic status and earodd atheroselerosis. Circulation. 1995; 92:1786-1792. 30. Karasek R, Baker D, Marxer F, Ahlbom A, Tbeorell T. Job decision latitude, job demands, and cardiovascular disease: a prospective study of Swedish men. Am J Public Health. 1981 ;71:694-705. 31. Hansen EJ, Ringen S, Uusitalo H, Erikson 1L eds. Welfare Trends in the Scandinavian Countries. New York, NY: M. E. Sharpe; 1993. 32. Stamler J. Established major coronary risk factors. In: Marmot M, Elliot P, eds. Coronary Heart Disease Epidemiology. London, England: Oxford University Press; 1992:35-66. 33. Kaplan GA. Job strain and cardiovascular health. Invited address, Academy of Behav- ioral Medicine Research; June 5. 1994; Coopersto.wn, NY. 34. Muntaner C, O'Campo PJ. A critical appraisal of the demand/control model of the psychosocial work environment: episte- mologieal, social, behavioural and class considerations. Soc Sci Med. 1993;36: 1509-1517. 35. Siegrist J, Peter R, Junge A, Cremer P, Seidel D. Low status control, high effort at work and ischemic heart disease: prospec- tive evidence from blue-collar men. Soc Sci Mea~ 1990;31:1127-1134. 36. Marmot M, Theorell T. Social class and cardiovascular disease: the contribution of work. lnt J Health Serv. 1988;18:659-689. 37. Fenwick R, Tausig M. The macroeconomic context of job stress. J Health Soc Behav. 1994;35:266-282. 38. Lynch JW, Kaplan GA, Salonen .IT. Why do poor people behave poorly? Variations in adult health behaviours and psychoso- cial characteristics by stage of the socioeco- nomic life course. Soc Sci Med. 1997;44: 809-820. 39. Lynch JW, Kaplan GA, Cohen RD, et al. Childhood and adult socioeconomic status as predictors of mortality in Finland. lancet. 1994;343:524-527. 622 American Journal of Public Health April 1997, Vol. 87. No. 4
Page 21: 2063633506 Log in for more options!
2063633506
Page 22: 2063633507 Log in for more options!
Int Arch Occup Environ Health (1997) 70:57-60 2~1" ~ © Springer-Verlag 1997 B158 XH827 57 INT ARCH OCO ENV HF..A 97 (C]SPRZNGER VERLAG Rolf Nordlinder • Bengt J~irvholm Environmental exposure to gasoline and leukemia in children and young adults-an ecology study Received: 31 July 1996/Accepted: 29 November 1996 ,1 Abstract Benzene is an established cause of leukemia in adults, especially acute non-lymphocytic leukemia (ANLL). A few studies have indicated that exposure to gasoline is a cause of childhood leukemia. The purpose of this study was to investigate if environmental expo- Introduction !:i sure to benzene from gasoline and car exhaust was' associated with leukemia in children and young adults. The exposure to gasoline and car exhaust was esti- mated by the number of cars per area. In this ecology study, data on the incidence of cancer in each munici- pality of Sweden during an 11-year period (1975-1985) were compared with the number of cars per area. Data on the incidence of cancer for persons aged 0-24 years at diagnosis were collected from the National Swedish Cancer Register. The following diagnoses were stud- ied: non-Hodgkin's lymphoma, a6ute lymphocytic leukemia (ALL), chronic m'yetoid leukemia (CML), and acute myeloid leukemia (AML). We found an associ- ation between AML and car density. In municipalities with more than 20 cars/km~ the incidence of AML was 5.5 [95% confidence interval (CI) 4.4-6.8, n = 89] as compared with 3.4 (95% CI 1.9-5.7, n = 15) cases per 1 million person-years in municipalities with less than 5 cars/km2 (P = 0.05). No association was found for the other sites of cancer studied. The association between AML in young adults and car density might be attributable to exposure to benzene from gasoline vapors and exhaust gases, but further investigations are necessary before any definite conclusion can be drawn. 1 1 i R. Nordlinder (con) - B. J~irvholm Department of Internal Medicine, Section of Occupational Medicine, G/Steborg University, St. Sigfridsgatan 85, S-412 66 GSteborg, Sweden. Fax: +46-31-409728 e-mail: rolf.nordlinder@medicine.gu.se B. J~irvholm Department of Occupational and Environmental Medicine, Northern University Hospital, S-901 85 Ume~t, Sweden NORL NY Key words Gasoline • Leukemia in children • Environmental exposure Benzene is an established cause of leukaemia in adults, especially acute non-lymphocytic leukaemia (ANLL). Increased risks have been found in the workplace where the concentrations of benzene in air have meas- ured around 30 mg/m3 or more (International Agency for Research on Cancer 1982; Rinsky et al. 1987). An association of childhood cancer, especially leukemia, with residential traffic has been suggested (Savitz and Feirgold 1989). An elevated incidence of childhood leukemia around the Sellafield nuclear re- processing plant in Great Britain has been found (Wolff 1993). Children near the plant traveled more frequently by car than did children in the reference group, and it was suggested that the increased incidence was caused by exposure to benzene from automotive sources. However, other studies have not found any association between environmental exposure to benzene and can- cer. An association between gasoline consumption and leukemia was not found in an ecology study in 19 European countries (Swaen and Slangen 1995). The study, however, w~as restricted to age groups of over 35 years. No association was found between exposure to engine exhaust and leukemia in a Swedish case-referent study of persons aged 20-54 years (Flodin et al. 1986). The two major sources of environmental benzene exposure are gasoline exhaust from gasoline-driven cars and tobacco smoke. Exhaust from cars consists of a complex mixture of substances and contains, among other compounds, benzene from unburned gasoline. Gasoline contains benzene in varying concentrations. In Sweden the concentration is currently usually around 3-5% and has been in this range since the 1970s (R. Jarsin, Swedish Petroleum Institute, Stockholm, personal communication). The maximal allowable THIS ARTICLE IS FOR INDIVIDUAL USE ONLY AND MAY NOT BE FURTHER REPRODUCED OR STORED ELECTRONICALLY WITHOUT WRITTEN PERHISSZON FROM THE COPYRIGHT HOLDER. UNAUTHORIZED REPRODUCTION MAY RESULT ZH FZNANOZAL /U~ID OTHER pEHALTZES.
Page 23: 2063633508 Log in for more options!
58 concentration of benzene in gasoline in Sweden has been 5% since 1977. Benzene is also emitted during Results refuelling of cars and due to leakage from gasoline stations and transportation (Akland 1993; Nordlinder and Ljungkvist 1992; Stenberg et al. 1983). Varying concentrations of benzene in ambient air have been reported to range from 0.2 g~/m3 in remote and rural areas to as high as 349 ~tg/m° in industrial centers with a high density of automobile traffic (WHO 1993). Measurements in 17 Swedish cities during the winter season 1992~/1993 showed 6-month average levels of 3-10 I.tg/m~ (Svanberg et al. 1994). Higher concentrations of benzene have been found inside cars as compared with the outside air (CONCAVE 1994; van Wijnen et al. 1995; Weisel et al. 1992). The objective of this study was to investigate a pos- sible association between environmental exposure to benzene from gasoline, in car exhaust or due to refuell- ing, and leukemia in children and young adults. There have not been systematic measurements of exposure to car exhausts or benzene in Sweden that could be used to estimate childhood exposure to these sub- stances. We therefore used the number of cars per area and the amount of gasoline sold per area to estimate the childhood exposure. In this ecology study Car density we investigated if these measures were associated with (cars/~,a2) the incidence of leukemia in persons below the age of 1000 25 years. Subjects and methods We found a high correlation (R --- 0.998) between car density and gasoline density, (Fig. 1). Therefore, only car density is reported in the folio.wing analysis. The 277 municipalities in Sweden were ranked in 4 groups according to car density (Table 1). There was no differ- ence between the ranks of the municipalities according to car density between 1975 and 1985. The maximal car density was 1026 cars/km2 (Stockholm), but 90% of the municipalities had a car density of below 47.9 cars/kinz. Large cities had the highest car densities, whereas the lowest values were found in sparsely populated areas in North Sweden. The smoking habits of pregnant women were almost the same in all car-density groups (Table 2). There seemed to be an association between car den- sity and AML but not the other sites of cancer studied (Table 3). The combined group of municipalities with more than 5 cars/km~ had a significantly higher rate of AML than did the group with less than 5 cars/kinz (95% confidence interval 0.1-4.0 cases per million 100 10 Data on the incidence of cancer in each municipality (n = 277) of Sweden during an 11-year period were compared with the number of cars or amount of gasoline per area, respectively. Data on the incidence of cancer for persons aged 0-24 years at diagnosis for the observation period Of 1975-1985 were collected from the National Swedish Cancer Register. The rates were stratified according to age (5-year intervals), sex, and calendar year. The following diagnoses were studied: non-Hodgkin's lymphoma (ICD 9: 200.1), acute lym- phocytic leukemia (ALL; ICD 9: 204.0), chronic lymphocytic leukemia (CLL; ICD 9: 204.1), acute myeloid leukemia (AML: ICD 9: 205.0), and chronic myeloid leukemia (CML; ICD 9: 205.1). However, there were only three cases of CLL, making an analysis infeas~le. The incidence was calculated by division of the number of cases by the number of persons each year. The population of the municipality on January I of each year was used for calculation of the incidence. From Statistics Sweden we received information on the number of cars as of January 1st, the land area (square kilometers) and the gasoline deliveries (cubic meters) made during the year in all munici- palities for the years 1975 and 1985. The "car density" (cars per square kilometer) and the "gasoline density" (cubic meters per square kilometer) were calculated from these figures. From Statistics Sweden we also received data on the smoking habits of pregnant women in all municipalities for the same periods. <5 Confidence intervals were calculated assuming Poisson distribu- 5-9 tion (Documenta Geigy 1971); the 95% confidence intervals of rate 10-19 differences were calculated by approximation to the normal distri- )20 bution (Rothman 1986). Linear trends of incidence were tested Totals according to a chi-square test (Breslow and Day 1987). • ,~_.~.." ,::" 1 10 1130 I000 Gasoline density (m3/km2) Fig. f Correlation between car density and gasoline density as deter- mined in 277 municipalities in Sweden Table 1 Car density in 1975 as determined in 277 Swedish munici. palities Cars/km~ Frequency Percent 82 29.6 73 26.4 54 19.5 68 24.5 277 100 B | | | | o 0~ co o
Page 24: 2063633509 Log in for more options!
Table 2 Smoking habits as determined in pregnant mothers in relation to car density in 277 Swedish municipalities Car-density Smoking mothers 95% CI (cars/km2) (%) < 5 30.5 29.5-31.5 5-9 30.0 29. t-31.0 10-19 30.3 29.3-31.3 20 31.5 30.3-32.7 person-years). However, the linear trend was not signifi- cant (Z2 = 1.3). The attributable risk, calculated from the risk estimates in this study, was found to be about 40%, or six cases per year, in Sweden in this age group for car densities above 5 cars/km2. Discussion This study suggests that AML in children might be associated with the car density in their living area. There was no association with other diagnoses. CML is a rather rare tumor in this age group, and only very strong associations could be detected. The power to detect an association between ALL and car density is much higher, as ALL is far more common than AML. A possible cause of the association between AML and car density is exposure to benzene from car exhaust or gasoline vapors. An established cause of AML in adults is benzene exposure (Jacobsson et al. 1993), but other constituents of the exhaust may also be important. A causal association is somewhat supported by similar observations in other studies (Savitz et al. 1988; Wolff 1992). Car d~nsity is probably a crude measure of benzene exposure, but the misclassification would be nondif- ferential and such a misclassification usually weakens the association (Soran and Gilthorpe 1994). It is there- fore improbable that a strong dose-response relation- ship would be found, and the linear trend detected in the present study was weak. Furthermore, the diag- nosis of different types of leukemia may sometimes be difficult. If hospitals in areas with a high car density 59 more often used the diagnosis of AML and hospitals in other areas used other diagnoses, an information bias could occur. However, children with these types of cancer are mainly treated and diagnosed at a few large hospitals in Sweden, making such a bias less probable. Any factor that is causally related to AML and associated with living in areas with a high car density, i.e., areas with a high population density, is a possible confounder of the association observed between AML and car density. Below we discuss smoking as well as maternal and paternal occupational exposure to ben- zene and radiation. Smoking is an important environmental source of exposure to benzene (Hoffman et al. 1989; Wallace 1989; Wallace et al. 1987) ). However, there is conflict- ing evidence about an increased risk for AML in smokers (Brownson et al. 1993; Siegel 1993). In a study of smokers aged 60 years and older there was an in- creased risk for AML (Sandler 1993). We are not aware of any study that has found that environmental to- bacco smoke (ETS) causes AML. If ETS is causally related to AML, it is a possible confounder. However, we found the smoking habits of pregnant women to be similar in municipalities with a low car density and municipalities with a high car density, (Table 2). The fathers' smoking habits are unknown, but it is probable that the smoking habits of the mothers correlate posit- ively with those of the fathers. Furthermore, among nonsmokers living with smokers, only 15% of the ben- zene exposure was attributable to ETS in a study of adults (Adlerkofer et al. 1995). Since the 1960s, occupational exposure to benzene in Sweden has almost exclusively involved handling of gasoline or similar petroleum products (Nordlinder 1995). Such exposure has occurred in refineries, trans- portation, and car repair, which may have occurred more frequently in areas with a high car density. These activities have involved very few women. It is also a rather rare form of exposure in men; we estimate that less than 5% of the male population were exposed to benzene in their workplace during the observation peri- od. Maternal or paternal exposure to benzene therefore seems to be an improbable cause of the observed asso- ciation between car density and AML. Table 3 Cancer incidence rates (per 104 person-years) as determined between 1975 and 1985 according to diagnosis and car density in persons aged 0-24 years at diagnosisa Car "density (cars/kmz) Site of cancer <5 5-9 I0-19 ~>20 Non-Hodgkins lymphoma (n =118) 3.2 (1.85-5.4), n =14 ALL (n =657) 21.1 (17.0-25.8), n =92 AML (n = 171) 3.4 (1.9-5.7), n = 15 CML (n =36) 0.5 (0.06-1.7), n =2 4.3 (2.8-6.4), n --24 3.5 (2.3-5.3), n =24 19.9 (16.4-24.0), n =111 22.5 (19.1-26.4), n =153 5.4 (3.6-7.7), n --30 5.4 (3.8-7.5), n =37 1.3 (0.50-2.6), n =7 0.9 (0.32-2.0), n =6 3.5 (2.6-4.5), n =56 18.6 (11.3-21.4), n =301 5.5 (4.4-6.8), n =89* 1.3 (0.80-2.0), n =21 * P =0.05 as compared with <5 cars/km2 ~ 95% confidence intervals are given in parentheses
Page 25: 2063633510 Log in for more options!
60 Children may be exposed to radiation from natural sources, or building material or during medical diag- nosis and treatment. No report is available on the relationship between radiation and urbanization in Sweden. Radiation may come from some building ma- terial, e.g., concrete made of some minerals rich in uranium. Houses in the sparsely populated areas in North Sweden may more often be made of wood, making building materials a possible confounding fac- tor. Measurements in dwellings in Sweden, however, have shown higher exposure to radon in individual houses than in blocks of flats (Swedish Radiation Pro- tection Institute 1995). The use of radiographs in medi- cal examinations of children or pregnant women may be more prevalent in cities where there is better access to advanced medical equipment. Thus, radiation can- not be totally excluded as a confounding factor. On the other hand, an effect of radiation would probably have influenced the occurrence of cancer at some other sites. As no increased risk was found for cancer at those sites, radiation seems less likely to be a confounder. The result of this study must be regarded with cau- tion. It was an ecology study, and uncontrolled con- founding may have occurred. Thus, we cannot be sure that the association detected between AML and car density was caused by car exhaust or gasoline exposure and not by an effect of confounding. Since other investi- gators (Savitz and Feirgold 1989; Wolff 1993) have also found an association between traffic and the occurrence of leukemia in children and young adults, further stud- ies seem important. References Adlerkofer F, Ruppert T, Scherer G, Tricker AR (1995) Significance of exposure to benzene through environmental tobacco smoke. In: Imbdani M, Ghittori S, Pezzagno G, Capodaglio E (eds) Update of benzene: advances in occupational medicine and reha- bilitation vol 1. Fondazione Salvatore Maugeri Edizioni, Pavia, pp 19-26 Akland GG (1993) Exposure of the general population to gasoline. Environ Health Perspect 101 I'Suppl 6]:27-32 Breslow NE, Day NE (1987) Statistical methods in cancer research, vol 2. IARC Scientific publication 82. International Agency for Research on Cancer, Lyon Brownson RC, Novotny TE, Perry MC (1993) Cigarette smoking and adult leukaemia, a recta-analysis. "Arch Intern Med 153:469-475 CONCAVE (1994) Exposure and health risks associated with non- occupational sources of benzene (report 1/94). CONCAVE, Brussels Documenta Geigy (1971) Scientific tables, 7th edn. Documenta Geigy, Basel Flodin U, Fredriksson M, Axelson O, Person B, Hardell L (1986) Background radiation, electrical work and some other exposure associated with acute myeloid leukemia in a case referent study. Arch Environ Health 41:77-84 Hoffman D, Brummemann K, Hoffman I (1989) Significance of benzene in tobacco carcinogenesis. In: Mehlman MA (ed) Ben- zene; occupational and environmental hazards, scientific update. Princeton. Princeton, New Jersey, pp 99-112 International Agency for Research on Cancer (19821 Some industrial chemicals and dyestuffs. (IARC monographs on the evaluation of carcinogenic risks of chemicals to humans, vol 29) IARC. Lyon, pp 93-148 Jackobsson R, Ahlbom A, Bellander T, Lundberg I (19931 Acute myeloid leukaemia among petrol station attendants. Arch En- viron Health 48:255-258 Nordlinder R (I995) Exposure to benzene at different work places. In: Imbriani M, Ghittori S, Pezzagno G, Capodaglio E (eds) Update of benzene: advances in occupational medicine and reha- bilitation vol 1. Fondazione Salvatore Maugeri Edizioni. Pavia, pp 1-8 Nordlinder R, Ljungkvist G (1992) Benzene exposure at service • stations, an occupational and environmental problem. In: Brown R, Curtis M, Saunders K, Vandenriessche S (eds) Clean air at work. Proceedings from an international symposium, 1991, Luxembourg. (Special publications, vol 108) Royal Society of Chemistry, Cambridge, pp 93-95 Rinsky RA, Smith AB, Hornung R, Filloon TG, Young RJ. Okun AH, Landrigan PJ (1987) Benzene and leukaemia: an epi- demiologic risk assessment. N Engl J Med 316:1044-1050 Rothman KJ (1986) Modern epidemiology. Little, Brown and Com- pany, Boston Toronto Sandier DP (1993) Cigarette smoking and risk of acute leukemia: associations with morphology and cytogenetic abnormalities in bone marrow. J Natl Cancer Inst 85:1994-2003 Savitz D, Feingold L (1989) Association of childhood cancer with residential traffic density. Scand J Work Environ Health 15:360-363 Savitz D, Wachtel H, Barnes FA, John EM, Tvrdik JG (19881 Case-control study of childhood cancer and exposure to 60- Hertz magnetic fields. Am J Epidemiol 28:21-38 Siegel M (1993) Smoking and leukemia: evaluation of a causal hypothesis. Am J Epidemiol 138:1-9 Soran T, Gilthorpe MS (1994) Non-differential misclassification of exposure always leads to an underestimation of risk: an incorrect conclusion. Occup Environ Med 51:839-840 Stenberg U, Alsberg, Westerholm R (1983) Emission of carcinogenic components with automobile exhaust. Environ Health Perspect 47:53-63 Svanberg PA, et al. (1994) Levels of SO2, soot, NO., and VOC in ambient air in Swedish urban areas (in Swedish). Report B1154. Swedish Environmental Research Institute, G~Steborg. Swaen GMH, Slangen JJM (1995) Gasoline consumption and leukemia mortality and morbidity in 19 European countries: an ecological study. Int Arch Occup Environ Health 67:85-93 Swedish Radiation Protection Institute (1995) Fakta om radon (facts about radon; in Swedish). Swedish Radiation Protection Insti- tute, Stockholm Wallace LA (1989) Major sources of benzene exposure. Environ Health Perspect 82:165-169 Wallace L, Pellizari E, Hartwelt TD, Perrit R, Ziegenfus R 11987) Exposure to benzene and other volatile compounds from active arid passive smoking. Arch Environ Health 42:272-279 Weisel CP, Lawryk NJ, Lioy PJ (1992) Exposure to emissions from gasoline within automotive cabins. J Expos Anal Environ Epi- demiol 2:79-96 Wijnen JH van, VerhoeffAP, Jans HWA, Bruggen M van (1995) The exposure of cyclists, car drivers and pedestrians to traffic-related air pollutants. Int Arch Occup Environ Health 67:187-I93 Wolff SP (1992) Correlation between car ownership and leukaemia: is non-occupational exposure to benzene from petrol and motor vehicle exhaust a causative factor in leukaemia and lymphoma?. Experientia 48:301-304 Wolff SP (1993) Does environmental benzene exposure cause child- hood leukaemia?. In: Leslie G, Perry R (eds) Volatile organic compounds in the environment. Indoor Air International, London, pp 491-501 WHO (1993) Benzene. Environmental health criteria 150. Interna- tional Program on Chemical Safety. WHO, Geneva II | | | !_
Page 26: 2063633511 Log in for more options!
---
Page 27: 2063633512 Log in for more options!
li -! Neuroscience and Biobehavioral Reviews, Vol. 21, No. 3, pp. 341-359, 1997 Copyright @ 1997 Elsevier Science Ltd Printed in Great Britain. All rights reserved 0149-7634/97 $32.00 + .0C PIh S0149-7634(96)00017-6 Behavioral Functions of Nucleus Accumbens Dopamine: Empirical and Conceptual Problems with the Anhedonia Hypothesis J. D. SALAMONE, X M. S. COUSINS AND B. J. SNYDER Department of Psychology, University of Connecticut, Storrs, CT 06269-1070 USA SALAMONE, J. D., M. S. COUSINS AND B. J. SNYDER. Behavioral functions of nucleus accumbens dopamine: empirical and conceptualproblems with the anhedonia hypothesis. NEUROSCI BIOBEHAV REV. 21(3) 341-359. 1997.--Nucleus aceumbens (DA) has been implicated in a number of different behavioral functions, but most commonly it is said to be involved in "reward" or "reinforcement". In the present article, the putative reinforcement functions of aceumbens DA are summarized in a manner described as the "General Anbedonia Model". According to this model, the DA innervation of the nucleus accumbens is conceived of as a crucial link in the "reward system", which evolved to mediate the reinforcing effects of natural stimuli such as food. The reward system is said to be activated by natural reinforcing stimuli, and this activation mediates the reinforcing effects of these natural stimuli. According to this view, other stimuli such as brain stimulation and drugs can activate this system, which leads to these stimuli being reinforcing as well. Interference with DA systems is said to blunt the reinforcing effects of these rewarding stimuli, leading to "extinction". This general model of the behavioral functions of accumbens DA is utilized widely as a theoretical framework for integrating research findings. Nevertheless, there are several difficulties with the General Anhedonia Model. Several studies have observed substantial differences between the effects of extinction and the effects of DA antagonism or aecumbens DA depletions. Studies involving aversive conditions indicate that DA antagonists and accumbens DA depletions can interfere with avoidance behavior, and also have demonstrated that accumbens DA release is increased by stressful or aversive stimuli. Although accumbens DA is important for drug abuse phenomena, particularly stimulant self-administration, studies that involve other reinforcers are more problematic. A large body of evidence indicates that low doses of dopamine antagonists, or depletions of aceumbens DA, do not impair fundamental aspects of food motivation such as chow consumption and simple instrumental responses for food. This is particularly important, in view of the fact that many behavioral researchers consider the regulation of food motivation to be a fundamental aspect of food reinforcement. Finally, studies employing cost/benefit analyses are reviewed, and in these studies considerable evidence indicates that accumbens DA is involved in the allocation of responses in relation to various reinforcers. Nucleus aceumbens DA participates in the function of enabling organisms to overcome response costs, or obstacles, in order to obtain access to stimuli such as food. In summary, nucleus accumbens DA is not seen as directly mediating food reinforcement, but instead is seen as a higher order sensofimotor integrator that is involved in modulating response output in relation to motivational factors and response constraints. Interfering with accumbens DA appears to partially dissociate the process of primary reinforcement from processes regulating instrumental response initiation, maintenance and selection. © 1997 Elsevier Science Ltd. Dopamine Nucleus accumbens Reinforcement Reward "Motivation Motor Behavioral economics 1. INTRODUCTION IT has been suggested that dopamine (DA), particularly in the nucleus accumbens, is critically involved in the process of reinforcement. Indeed, this idea is currently one of the most popular in all of neuroscience; one can scarcely open a textbook, or peruse the pages of a jour- nal, without encountering this hypothesis. The general outline of this hypothesis typically proceeds as follows: it is thought that DA directly mediates the rewarding effects of natural stimuli such as food, water or sex. In turn, this reward system is activated by other reinforcing tTo whom correspondence should be addressed stimuli such as brairi stimulation or drugs of abuse. The "reward" hypothesis of DA is widely applied to explain a number of results, and is probably as broadly accepted and widely cited as the dual hypothalamic model of motivation was in the 1960s. The purpose of the present review is to offer a critical examination of the hypothesis that DA in nucleus accumbens directly mediates the reinforcing properties of natural stimuli such as food. In order to do so, various research findings and concep- tual issues will be examined. Finally, alternatives to the anhedonia hypothesis will be explored. 341 THIS ARTICLE IS FOR INDIVIDUAL USE ONLY AND HAY NOT BE FURTHER REPRODUCED OR STORED ELEOTRONICALLY WITHOUT WRITTEN PERHISSION FRON THE COPYRIGHT HOLDER.~'~ UNAUTHORIZED REPRODUCTION HAY RESULT IN FINANCIAL ,A~ OTHER PENALTIES.
Page 28: 2063633513 Log in for more options!
342 2. THE ANHEDONIA HYPOTHESIS: SUPPORTING EVIDENCE One of the major functions of a scientific hypothesis is to stimulate research. In this regard, the DA/reinforcement hypothesis has been quite successful. Over the last two dec- ades, hundreds of articles have been published that deal directly or indirectly with the hypothesized involvement of DA systems in reinforcement processes. For the present review, it is useful to begin by examining those results that led to the initial proposal of the DA/reinforcement hypoth- esis, and also to outline those results that have continued to be offered as support for this hypothesis. 2.1. Historical development The 1970s was a period of rapid development in neu- roscience, and particular emphasis was being placed on sin- dies of the behavioral functions of catecholamines: Intracranial self-stimulation (ICSS) was one of the beha- viors that was being widely investigated; at that time, it was hoped that this phenomenon could yield important insights into the brain mechanisms underlying reinforce- ment. Several studies indicated that DA systems were criti- cally involved in ICSS (48,76,84,135). Fouriezos and Wise (76) observed that pimozide-treated rats showed near normal responding during the beginning of ICSS lever press test sessions, but that there was a within-session decline in responding across the session. It was noted that this pattern resembled the effects of extinction, and there- fore it was suggested that DA antagonism was interfering with the basic process of reinforcement. In reviewing the literature on DA and ICSS, Wise (247) suggested that interference with DA systems could be blunting the euphoria produced by ICSS and drugs of abuse. Moreover, it was suggested that additional research should study the effects of DA antagonists on behaviors supported by natural reinforcers such as food. Several studies by Wise and his colleagues were con- ducted to investigate the effects of pimozide on food-rein- forced instrumental responding. Wise et al. (253,254) observed that the effects of pimozide resembled those of extinction under several different conditions. Lever press responding for food or saccharin was suppressed by pimo- zide in a manner that was characterized by a within-session decline in responding. Food-reinforced running in an alley- way showed a gradual slowing over successive trials in pimozide-treated rats. These studies were interpreted to mean that DA antagonism blunted the reinforcing effects of food, which led to "extinction". It should, also be emphasized that these effects on food-reinforced responses were not viewed in isolation, and instead were interpreted in the context of the effects of DA antagonists on amphetamine self-administration and ICSS (253,254). Thus, the general hypothesis was offered that DA critically mediated the reinforcement produced by a wide variety of stimuli, includ- ing food, water, sex, drugs and brain stimulation. There were two important features of this early genera- tion of research that should be emphasized; both of these issues were evident in the ICSS literature and then extended into the arena of the DA/reinforcement hypothesis. First, the hypothesized effect of DA antagonism was referred to as "anhedonia". The use of this term indicated that the effects of DA antagonism were being explained in terms SALAMONE, COUSINS AND SNYDER of a blunting of the emotional effects of reinforcing stimuli. According to Wise et al. (253), neuroleptics were hypothe- sized to "take the pleasure out of normally rewarding brain stimulation, take the euphoria out of normally rewarding amphetamine, and take the 'goodness' out of normally rewarding food". The second major characteristic of the early generation of research on the DAJreinforcement hypothesis was that the effects of DA antagonism on "reinforcement" were conceived of as being completely distinct from any motor effects of these drugs. Concerns about the possible motor effects of DA antagonists grew naturally out of the extensive literature implicating basal ganglia DA in the control of movement. Of course, propo- nents of the anhedonia hypothesis maintained that the same animal could have both "reward" and "motor" effects resulting from administration of DA antagonists (e.g. Wise, 249). Nevertheless, they considered that these effects fall into completely distinct classes, and thus the dichotomy between the "reward" and "motor" effects of DA antagonism was fully drawn. 2.2. Additional evidence supporting the ahhedonia hypothesis As noted above, it was reported that systemic administra- tion of DA antagonists produced effects that were thought to resemble extinction. Several additional lines of evidence are usually cited as support for the DAJreinforcement hypoth- esis. Naturally occurring reinforcers are thought to increase DA release, particularly in nucleus accumbens (94,196). DA antagonists have been shown to reduce consumption of sweet rewards, such as sucrose solutions (103,204- 206,211). Several drugs of abuse have been shown to increase extracellular DA; this appears to be true not only of stimulants but also of drugs from other categories (31,55). Evidence has indicated that DA systems are particularly important for drug-related reinforcement phenomena such as place preference and drug self-administration (22,23,169,179,217). Because much of the work that led to the inception of the anhedonia hypothesis involved the use of systemic neuro- leptic administration, particular DA terminal regions were not initially identified as critical loci for the site at which DA systems mediated reinforcement. Yet, as research in this area developed it became common to identify the nucleus accumbens as the specific area in which DA mediated "reward". The nucleus accumbens is the site at which natural and drug reinforcers are thought to preferentially activate DA systems (31,55,94,100,144). The mesolimbic DA system, which originates in ventral tegmental area (VTA) and termi- nates in nucleus accumbens, has been implicated in drug self- administration. In some ways, the distinction between meso- limbic and neostriatal DA is thought to reflect the dichotomy between reward and motor function. Thus. nucleus accum- bens is thought to be closely related to the emotional processes in which the limbic system participates, while the neostriatum is thought to be involved in motor functions that are more traditionally ascribed to the basal ganglia. 2.3. The general anhedonia model To summarize, it has been suggested that nucleus accum- bens is a critical locus for mediating the reinforcing effects
Page 29: 2063633514 Log in for more options!
BEHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 343 al of stimuli. The DA innervation of the nucleus accumbens is conceived of as a crucial link in the "reward system", which evolved to mediate the reinforcing effects of stimuli such as food. This system is thought to be activated by natural reinforcing stimuli, and this activation mediates the reinforcing effects of natural stimuli. According to this view, other stimuli such as brain stimulation and drugs can activate this system, which leads to these stimuli being reinforcing as well. Interference with DA systems, particu- larly in nucleus accumbens, blunts the reinforcing effects of these rewarding stimuli, leading to "extinction". This gen- eral model of the behavioral functions of accumbens DA is utilized widely as a theoretical framework for research and a pedagogical device (e.g. (13,27,87,248)). Because of the broad nature of this model, and the variety of reinforcing conditions it is meant to explain, it will be referred to as the "General Anhedonia Model". The General Anhedonia Model has been enormously sue-' cessful in that it has offered researchers a framework for linking together various areas of research. Perhaps the great- est influence of this model has been in the field of drug self- administration and abuse. It is evident that the General Anhedonia Model is the most influential wide-ranging model for dealing with drug abuse. This model is used to explain stimulant self-administration and place preference in animals, abuse of a number of stimulant and non-stimu- lant drugs in humans, and even genetic factors leading to drug abuse. Yet, despite its ubiquity and utility, the General Anhedonia Model is not universally supported. The set of hypotheses that form the structure of this model are still fiercely debated. It is possible that some of the tenets of the model are inaccurate or overly simplistic, and that the model may have value for some areas (e.g. stimulant abuse) but not others (e.g. food reinforcement). The purpose of this review is to deconstruct the General Anhedonia Model and consider the limitation of each separate component. In par- ticular, this review will focus on the hypothesis that DA in nucleus accumbens directly mediates food reinforcement. 3. EMPIRICAL AND CONCEPTUAL PROBLEMS wrI'H THE ANHEDONIA HYPOTHESIS As noted above, a major function of a hypothesis is to stimulate research. In fact, not all of the research stimulated by the General Anhedonia Model has provided support for that model. Several research findings cause specific pro- blems for aspects of the anhedonia model. Moreover, there are conceptfial problems inherent in a discussion of brain mechanisms of reinforcement that are not often exam- ined in sufficient detail in the anhedonia literature. 3.1. Lack of similarity between interference with DA systems and the effects of extinction Although it often is cited that DA antagonists produce effects similar to extinction, it has been argued that these similarities are superficial in nature, and that under a broad range of conditions interference with DA systems does not in fact produce effects that closely resemble extinction. Several studies providing a detailed behavioral analysis have shown that there are substantial differences between the effects of extinction and systemic administration of DA antagonists (10, 62, 65, 71, 72, 89, 90, 148, 168, 185, 213, 228,230,244). Injections of flupethixol into the nucleus accumbens failed to produce an extinction-like decline in responding (15). Nucleus accumbens DA depletions also failed to produce effects that were similar to extinction if rats were responding on a continuous reinforcement (CRF) schedule (149,195). Nucleus accumbens DA depletions affect CRF or fixed ratio (FR) 5 responding by producing a slow, steady rate of responding throughout the session rather than a within session decline in responding (149,195,196). Moreover, extinction of CRF responding produces an extinction "burst", of which one manifestation is an "increase" in the proportion of responses with high local rates (195). In contrast, accumbens DA depletions produce the opposite effect, which is a "decrease" in the relative number of high rate responses that manifests itseif as an overall slowing of the local rate of responding (I95). Several studies have indicated that changing the kinetic requirements of an instrumental response can alter the extent to which an "extinction" effect is produced. Doses of DA antagonists that "extinguish" CRF lever pressing fail to produce extinction of differential-reinforcement of low-rate lever pressing (148), nose-poking for electrical stimulation (63), or simple instrumental behaviors such as being in proximity to a food dish (185). There is a conceptual problem with the extinction phe- nomenon as well. It has been stated that a within session decline in responding is prima facie evidence that a motor deficit cannot be in operation. According to Wise et al. (254) the motor hypothesis "demands that there be no period within a pimozide test when response rates are normal", and also "the fact that normal or near normal responding is not seen during the latter part of the sessions must be attributed to some other cause than mere response difficulties". In fact, this is the fut~damental assumption that underlies the entire notion that the within-session decline in responding represents an effect similar to extinction. Yet it should be emphasized that the validity of this assertion has rarely been seriously evaluated. Is it true that if responding is higher in the beginning of a test session, and declines thereafter, then it is impossible to explain this effect by discussing any aspect of motor function? For several years, it has been suggested by several different authors that the "mainte- nance" of movement is affected by DA-related manipula- tions (8,82,186). Fowler and his colleagues have studied the effects of neuroleptics on the duration of individual lever pressing responses, and have observed that neuroleptics increase (i.e. slow) lever press duration in a way that differs substantially from extinction (71,72,79). They also have noted that haloperidol produces within-session increases in the duration of lever press responses (133). Taking all this into account, it is possible that some of the behavioral changes produced by interference with DA can manifest themselves as response maintenance deficits or progressive motor dysfunctions rather than impairments in emotional processes (77,186). 3.2. Accunlbens DA is involved in aversive as well as appetitive conditions There is an extensive literature on the involvement of DA in processes that involve aversive or stressful conditions. Although this research is rarely, if ever, cited by advocates
Page 30: 2063633515 Log in for more options!
344 of the anhedonia hypothesis, it should be emphasized that two recent reviews have thoroughly discussed these find- ings (18,190). A brief review of this area is useful for the present discussion. Perhaps the most important point to make is that accumbens DA is not selectively involved in appetitive behavioral processes. Also, there are substantial similarities between the characteristics of dopaminergic involvement in appetitively and aversively motivated behavior. Just as DA antagonists reliably reduce positively reinforced instrumental responding, it also is widely reported that neuroleptics impair avoidance responding (3,5,14,20,38,39,52,116,164,165,172,238). Nucleus accum- bens DA depletions and intra-accumbens injections of the DA antagonist sulpiride have been shown to impair avoid- ance responding (152,210,234). Although it is frequently cited that DA antagonists interfere with place preference, it should be emphasized that DA antagonists also impair place aversion. Di Scala and Sandner (56) reported that halo- peridol blocked the place aversion produced by the anxio- genic drug FG 7150. SCH 23390 and metoclopramide reduced both amphetamine-induced place preference and SKF-38393-induced place aversion (101). SCH 23390 was shown to block the place aversions produced by naloxone, picrotoxin and phencyclidine (2). Several other features of the effects of neuroleptic drugs on instrumental behavior, such as the within-session decline in responding and the relative preservation of discrimination performance, also have been demonstrated to occur with neuroleptic-treated rats responding on avoidance tasks (9,42,201). As noted above and discussed in greater detail below, appetitive stimulus conditions can be accompanied by increases in accumbens DA release as measured by techni- ques such as voltammetry or microdialysis. At this point, it is important to stress that aversive conditions also are accompanied by increases in accumbens DA release or metabolism. DA turnover or metabolite levels in accumbens or VTA tissue samples have been shown to increase in response to aversive stimuli (53,54,58,59,70,181). Voltam- metry and dialysis studies have shown that accumbens DA release or metabolism can be increased in response to tail shock (1), tail pinch (50) foot shock (212), restraint stress (108,109), forced exercise (5 I), and anxiogenic beta carbo- line drugs (51,150,202). Young et al. (260) reported that DA release in nucleus accumbens increased during the presenta- tion of a stimulus that had been paired with footshock. McCullough et al. (152) observed that lever pressing to avoid shock was accompanied by increases in accumbens DA release. Taking all these results into account, it seems obvious that enhanced accumbens DA release cannot simply be considered as a selective marker for subjective hedonia. 3.3. Accumbens DA release and neuronal activity do not covary specifically with the presentation of positive reinforcers Several studies have examined the dynamic activity of accumbens DA during the performance of positively rein- forced instrumental behavior. Generally, it has been observed that accumbens DA release is increased during performance of food-reinforced lever pressin~ (94,113,123,149,191,194). However, several lines of evi- dence suggest that it is not the presentation of the reinforcer SALAMONE, COUSINS AND SNYDER per se that instigates accumbens DA release or VTA neuronal activity. The effects of presentation of large quantities of food to food deprived animals are somewhat equivocal, with some studies reporting increases in accum- bens DA release (174,245,259), yet other studies reporting no change (29,30,151,194). Studies of VTA DA neuron activity during instrumental training have indicated that presentation of food reinforcement only leads to an increase in DA activity during the initial training period, or when food presentation is novel or unpredictable (139,158,208). If food is regularly presented in an unsignalled manner to animals not making instrumental responses, then food pre- sentation fails to instigate DA neuron activity (139). In well trained animals responding on discrete-trial operant tasks, food presentation fails to elicit a net population response in terms of DA neuronal firing (208). The precise features of instrumental conditioning tasks that lead to increases in DA neuron activity remain unclear. It has been suggested that VTA DA neurons are more responsive to stimuli that signal behaviorally-relevant conditions than they are to the reinforcer itself (139,208). Also, several lines of evidence indicate that accumbens DA activity shows biphasic oscilla- tions during instrumental performance~ with the period of instrumental responding being characterized by an overall increase in responding, but the presentation of the reinforcer being marked by a decrease in DA neuron activity or release ((123,128,166,178), see review in Ref. (191)). 3.4. The role of DA systems in drug self-administration Drug self administration is the area in which DA systems are most frequently linked to the reinforcement process. The General Anhedonia Model is probably the major conceptual scheme that is used'to integrate several diverse findings into a unified approach to the problem of drug abuse. Indeed, the National Institute of Drug Abuse in the United States has spent many millions of dollars on research that is based upon this model. Of course, it is beyond the scope of this paper to review the entire field of drug abuse. Nevertheless, some general features of this literature should be briefly outlined. First of all, it should be noted that there is substantial evidence indicating that accumbens DA is involved in aspects of stimulant self-administration (87,92,100,169,179). There is evidence in favor of the notion that accumbens DA directly mediates the reinforcing effects of non-stimulant drugs, although there also are some findings at odds with that view (49,64,74,85,124,176,200). The question of whether or not accumbens DA is involved in self-administration generally, or stimulant self-administration specifically, is not really the central focus of the present review. Rather, the question being emphasized is whether or not the involvement of accumbens DA in drug self-administration should be used to provide the strongest pillar of support for the General Anhedonia Model. There are several possible explanations of why accumbens DA may be important for drug self administra- tion (e.g. (182,250)). But, does such an involvement neces- sarily provide support for the hypothesis that accumbens DA directly mediates food reinforcement? In fact, there is evidence to the contrary. Roberts et aL (179) showed that accumbens DA depletions that severely affected cocaine self-administration had little effect on lever pressing for food reinforcement. Thus, it is possible that accumbens DA
Page 31: 2063633516 Log in for more options!
BEHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 345 is critically involved in cocaine self-administration, yet the ~00~ General Anhedonia Model is inaccurate because accumbens DA does not mediate food reinforcement. This would 400~- / suggest that the basis of cocaine reinforcement does not ~ lie in the simple assertion that it is based upon the natural ~ 3°°~ ~"~ reinforcement system that evolved to deal with stimuli such ~200~ f . as food. '°°F/ 3.5. Choice and "rate free" measures 0 50 100 150 200 ~50 300 350 400 Another difficulty for the anhedonia hypothesis comes from studies that have focused on response choice measures of the effects of reinforcement. Although reinforcers affect response probability, it also is true that reinforcers control response choice. Several studies have shown that DA antagonis'ts affect response rate or speed in doses that have little effect on response choice. Increasing doses of pimozide increased response latencies in a T-maze light/ dark discrimination task, but did not affect response choice measures (229). More recently, Salamone et al. (192) used a T-maze task in which rats were tested for their ability to discriminate between an arm that contained four 45 mg food pellets and the opposite arm, which contained two food pellets. Although 0.1mg/kg haloperidol substantially slowed run speed, it had no effect on choice of the correct arm. Using a two-lever procedure for studying win-stay hnd lose-shift response strategies, Evenden and Robbins (65) demonstrated that flupenthixol did not affect response choice strategy in a manner similar to extinction, although the drug did slow the rate of response. If the instrumental response involved simply being in proximity to the food dish, a relatively high dose of haloperidol (0.4 mg/kg) dramatically reduced locomotor activity but had no effect on time spent engaged in the reinforced response (185). Several studies showing relatively preserved response choice in neuroleptic-treated rats have used food as the reinforcer (65,185,192,229). Bowers et al. (21) employed a self-stimulation discrimination procedure, and reported that pimozide slowed the rate of responding yet did not alter discrimination choice. Some researchers have suggested that "rate free" mea- sures of behavior, such as reinforcement thresholds, could be used to separate motor and "reward" factors that deter- mine instrumental responding. Essentially, the argument is that conventional response rate measures hopelessly con- found reinforcement and motor processes, and therefore measures should be obtained that more directly represent the rewarding effects of stimuli. Threshold measures and intensity/response functions have been employed in self- stimulation research (61,218,248). Response/reinforcement matching has been used with a variety of reinforcers to obtain a measure of reinforcement value (I 2,95). According to this type of analysis, the relation between reinforcement density and responding on variable interval (VI) schedules is a rectangular hyperbola that basically resembles a dose- response curve. The equation for this hyperbola (see Fig. 1) has been used to fit the relation between reinforcement and responding, and the equation is: B =kR/(R + Re) (1) in which B represents response rate, R represents reinforce- ment density, and k is the constant for maximal responding. Re represents the reinforcement threshold Reinforcements/hour FIG. 1. This figure shows that the relation between reinforcement density and response rate on VI schedules fits a rectangular hyperbola (see Section 6 in text). There are two important parameters (see Eq 1) that are derived from this analysis: the asymptotic response rate (k) and the reinforcement density that generates half-maximal response rate (Re). In this case, k = 500 and Re = 100. (i.e. the reinforcement level that generates 50% of maxi- mum response rate), which is analogous to the ED50 in a pharmacology experiment. Although the "rate free" measures described above have received considerable attention, it is nevertheless true that there are several problems with the interpretation of these kinds of results. The major conceptual problem is that these measures, despite their apparent independence from response rate, are not in fact independent of all aspects of motor function. For example, DA antagonists were reported to increase self-stimulation thresholds (61,111,218), and this effect has been interpreted to mean that these drugs are blocking the reward value of stimulation (248). Some research suggests that DA antagonists decrease reinforce- ment value of food (i.e. increase Re) in matching experi- ments (96,97,171). DA antagonists have been shown to increase sucrose consumption thresholds, or decrease sucrose consumption in a manner similar to reducing sucrose concentration, and these findings have been inter- preted as indicative of a "reward" deficit (103,211). Yet despite these reports, several difficulties remain. It has been shown that the stimulation threshold is not a pure index of reward, and that this measure can be increased by motor factors such as task difficulty (75,81). As noted by Fouriezos et al. (75) "shifts in rate-frequency functions must be interpreted with caution when such shifts are obtained by CNS lesions or drugs". Similar cautions must be maintained when considering results of sucrose consumption thresholds as well. Sensory psychologists discovered long ago that threshold measurements were not "pure" measures of sensation, and i'nstead reflected the interaction between sensory, motor and decision making processes; this is the very reason why signal detection theory (91) has become so popular. Although "rate tree" measures such as stimulation thresholds and reinforcement thresholds from matching experiments do not produce a datum that is itself a response rate, the measure is influenced by motor factors because the threshold intensity still represents a value that is defined by a "response" criterion. Thus, the measure being generated does represent the outcome of a sensorimotor interaction process. This point is particularly vital, because several investigators have suggested that the basal ganglia are very important for the process of sensorimotor integration
Page 32: 2063633517 Log in for more options!
346 SALAMONE, COUSINS AND S~qYDEI~ (107,134,145,203,221,224,233,239). Although proponents of the anhedonia hypothesis often state that the deficits produced by low doses of neuroleptics are not sensory or motor (e.g. (211)), this terminology is familiar to those who have studied the sensorimotor functions of basal ganglia. According to Teuber and Proctor (224) "Somehow, the usual distinction of purely motor and purely sensory symp- toms fails us when it comes to an experimental analysis of basal ganglia function and dysfunction. It is almost as if we needed two categories to describe some of the symptoms which are neither sensory nor motor but reflect peculiarities of sensorimotor interaction". Behavioral deficits in DA depleted and haIoperidol-treated rats, as well as those shown by human parkinsonian patients, can be partially ameliorated by providing additional sensory stimulation (140,170,209). Rats that are akinetic due to striatal DA 'depletions combined with injections of haloperidol can nevertheless respond to intense sensory stimuli (115). The increase in stimulation or reinforcement .threshold produced by DA antagonists simply means that a higher level of stimulation is necessary for producing a response, which is indicative of a drug-induced decrease in responsiveness to stimulation (239). As noted by White (239), early studies of the effect of DA depletion on sucrose consumption thresh- olds could be interpreted as reflecting sensorimotor deficits induced by DA depletion. According to Muscat and Willner (162) "The 'dopamine hypothesis of (sweet) reward' may thus be a misrepresentation of data derived under limited conditions of reinforcement. The blunting of reward by DA antagonists may be a special case of a more general attenuation of the influence of sensory stimuli over behavior". Therefore, the reduction in behavioral reactivity to conditioned stimuli produced by DA antagonists or depletions can easily be interpreted within the general framework of the sensorimotor functions of DA systems (5,18,28,44,188-190). There are additional problems with drug-induced changes in curve fitting parameters such as Re being interpreted as equivalent to drug-induced reductions in the reward value of a stimulus (186,189). The attn'bution of reward-related effects to actions on Re is based upon the idea that k (maximal response rate) is the only parameter that is influenced by motor factors and Re is only influenced by motivational factors. In fact, there is some dispute about these points in the matching literature (e.g. (98,241)). Also, it is questionable whether increases in Re should be viewed as an irreducible index of decreases in the reinforcement value of a stimulus, such as food. As noted above, Re is a parameter that is equivalent to the ED50 in a drug experi- ment. Yet, ED50s are clearly influenced by a variety of factors, including affinity for a receptor, duration of action and penetration into the target tissue. It is possible that a number of factors, including some related to aspects of motor function, could influence the apparent Re. Baum (12) reported that responding on VI schedules in response/ reinforcement matching experiments could by influenced by response-related factors such as effort or response preferences (i.e. response bias). Thus, another way of describ- ing the effects of DA antagonists in matching experiments would be to state that interference with DA may not be directly affecting reinforcement value, but instead may be altering the bias between responses with different requirements (186). Williams (241) gives equations for hyperbolae that include a measure of bias (b). In these equations B = k bRl(bR + Re) or B = k RI(R + Re~b) it can be seen that the apparent Re value from Eq. 1 could be represented by a composite parameter (Re/b in Eq. 3) that is influenced by bias. In fact, previous matching experiments studying the effects of neuroleptics have basically assumed that bias is either unimportant, or thatit remains unchanged by drug treatment. One can fit Eqs 2 or 3 to neuroleptic data, and if one assumes that Re does not change, then the effects of DA antagonism can be fitted to a drug-induced decrease in b (i.e. a bias away from lever pressing and towards other, less vigorous responses). A related way of interpreting effects upon Re is to point out that increases in Re do not necessarily mean decreases in the reinforcement value of a food stimulus. Instead, increases in Re reflect a decrease in the overall reinforcement value of lever pressing for and consuming food. Thus, neuroleptics could be producing sen- sorimotor effects that make the motor activity of lever press- ing less reinforcing. According to the regulatory or motivational view or reinforcement (see below), this would mean that the motor activity of lever pressing would be less preferred, or that the preferred level of lever pressing activity would be decreased. Clearly, this is an interpretation that is not really consistent with the anhedonia model or the absolute reward/motor distinction. " 4. WHAT IS "REINFORCEMENT"? (2,3) I ! I ! ! 4.1. Behavioral approaches to the concept of "reinforcement" One of the greatest problems with the hypothesis that DA in nucleus accumbens directly mediates reinforcement is the fact that the meaning of the term "reinforcement" is not often discussed in detail in the neuropharmacology litera- ture. As implied by the very use of the term "hedonia", reinforcement is often treated as being synonymous with "pleasure". Indeed, a close examination of the literature dealing with the General Anhedonia Model indicates that this connection between reinforcement and pleasure was no accidental and unfortunate slip of the pen. As discussed above, it clearly was intended that the effects of neuroleptics on instrumental behavior be ascribed to actions on emotional processes and not motor functions (e.g. (248,253,254). Of course, anyone familiar with the behavioral literature on instrumental conditioning would recognize that subjective pleasure is not usually emphasized as the defining characteristic of the process of reinforce- ment. Clearly not compatible with Skinnerian behaviorism, such hedonic views of reinforcement also have a long tradition of being rejected by learning theorists (99,155). The most common description of reinforcement is that developed by Skinner, which is known as the Empirical Law of Effect. According to this view, which is a modifica- tion of Thorndike's original Law of Effect, the defining characteristic of reinforcement is rooted in the relations between response probabilities and the presentation of stimuli. Thus, if a response is followed by presentation of a stimulus, and the response thereafter shows an increase in relative probability, then the process of positive reinforce- merit is said to have occurred. The stimulus that was presented to produce this effect is known as a reintbrcer. i ! I I
Page 33: 2063633518 Log in for more options!
d ,). ~EHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 347 Throughout his long and productive career, Skinner focused on specifying the relations between reinforcement and response output, and he rarely considered the question of which specific characteristics determine the properties of reinforcing stimuli. Of course, if one maintains that a parti- cular brain structure mediates reinforcement, then the. pro- blem of defining the basic characteristics of reinforcing stimuli would have to be one of the most critical questions to be considered. Several behavioral researchers have addressed this question, and despite the differences between each of their particular views, it is important to emphasize the common elements that are apparent across several different investigators. A number of researchers have emphasized that reinforcers are stimuli towards which the behavior of organisms is directed, i.e. organisms will approach, consume, interact with, or increase the proximity or availability of reinforcing stimuli. Thorndike (225) defined a "satisfier" as a stimulus that the "the animal does nothing to avoid, often doing such things as to attain and preserve it". According to Premack (173), reinforcing activities occur with a relatively high probability, or are relatively preferred. Bindra (17) and Glickman and Schiff (86) emphasized that reinforcers elicit approach and con- summatory responses. According to response deprivation theory (7,227) reinforcing activities can be described as being relatively deprived, and the process of reinforcement involves the restoration of the response equilibrium that was disturbed by deprivation. Consistent with the role of rein- forcers in regulatory or homeostatic processes, some researchers have emphasized the role of reinforcement in providing feedback that guides motor output (226). In a recent review (189) it was noted that this "motivational" or "regulatory" view of reinforcement actually is quite con- sistent with Skinner's Empirical Law of Effect. Skinner defined reinforcement in terms of the effects of a stimulus on response probability, while the motivational perspective is centered on the behavior of the organism and how it modifies its environment. If there is a contingent relation between an instrumental response and a reinforcer, then it must be true that the organism is increasing the probability of reinforcer presentation by engaging in the instrumental response. As observed previously "a motivational corollary of the Empirical Law of Effect is that a reinforcer is a stimulus that is increased in probability by the organism" (189). This fundamental property of reinforcers to elicit approach responses has been referred to as the uncondi- tioned rewarding or reinforcing property of a stimulus (217). Behavioral investigators also emphasize other character- istics of reinforcing stimuli. As noted by Mackintosh (141,142), organisms do not simply approach reinforcing stimuli. Animals are capable of learning very specific associations between an instrumental response and a stimu- lus. and learn to repeat a form of the previously reinforced response in the future. According to Timberlake and Allison (226,227), even if response deprivation describes the regu- latory basis of reinforcement, animals would still need to learn "what leads to what". This would indicate that response/reinforcer associative processes also are important for the process of reinforcement (37,142,177). Moreover, instrumental responses are instigated not simply in the presence of the reinforcer, but they typically are elicited by conditioned stimuli that occur when the organism is temporally and spatially distant from the reinforcer. These conditioned stimuli form another aspect of the associative structure of instrumental behavior (177). Another important aspect of reinforcers is that they can have behaviorally activating properties, which have several manifestations. First, the periodic presentation of a reinforcer such as food to a food deprived animal can result in high levels of motor activity (119,120). This phenomenon can result in the induction of a variety of different "adjunctive" behaviors, and also serve to support operant response rates (121). In addition, organisms can perform very high levels of motgr output in order to gain access to reinforcers. Rats will run in alleys or mazes, vigorously press levers or forage over wide areas in order to gain access to food or other significant stimuli. To summarize, reinforcers have a number of dif- ferent characteristics. These include: (1) positive reinforcers are stimuli towards which behavior is directed, and organ- isms behave in such a way as to increase the probability of (i.e. self-administer) such stimuli; (2) reinforcer presen- tation is one of the stimulus events that is embedded in a complex associative structure linking stimuli and responses; (3) reinforcers provide feedback control over motor output; and (4) reinforcers can have behaviorally activating effects. It is probably true that instrumental behavior is not an elemental conditioning process, but. rather is a complex phenomenon that emerges from the interaction of the factors mentioned above, as well as other conditions (e.g. biological constraints). 4.2. DA and reinforcement: a reexamination In light of this overview of the characteristics of reinfor- cing stimuli, it is important to reconsider the data linking DA to food reinforcement. First of all, it should be empha- sized that DA, particularly in nucleus accumbens, has been implicated in the process of behavioral activation (24, 118, 127, 151,159, 180, 185-191,242,243,250). Thus, accumbens DA clearly is involved in aspects of the reinfor- cement process. Yet, difficulties emerge when one considers the specific nature of such an involvement. Does dopami- nergic involvement in behavioral activation mean that DA mediates hedonia? Indeed, the "reward" vs "motor" dis- tinction begins to take on the appearance of an artificial dichotomy when one considers that several of the behavioral characteristics of reinforcing stimuli are fundamentally connected to aspects of sensorimotor function. Behavioral activation clearly represents an area of overlap between motivational and motor function, and several other aspects of reinforcement processes also fall into a gray area between learning and motor processes. Instrumental conditioning is fundamentally a form of motor learning. The ability of reinforcers to provide feedbaclt control over responding, and the ability of responses and reinforcers to become associated, reflect higher order sensorimotor integrative functions that may require the involvement of basal ganglia DA (28,170). Thus, it is important to distinguish between the literature that implicates DA in aspects of the reinforce- ment process from the notion that accumbens DA is involved in hedonic aspects of reinforcement that have nothing whatsoever to do with any aspect of motor function. As discussed above, appetitive motivation is considered to be a fundamental aspect of the reinforcement process. Thus, it is important to discuss the effects of DA antagonism and accumbens DA depletions on food acquisition and
Page 34: 2063633519 Log in for more options!
348 consumption. Consummatory behaviors have sometimes been used as a measure of "reward" or "reinforcement" (103,162,251,252). Proponents of the General Anhedonia Model have emphasized the effects of neuroleptic drugs on the maintenance of food consumption (248), and on the unconditioned responses elicited by food (248). Wise (248,249) has relied very heavily upon Bindra's ideas of incentive motivation, and clearly has supported the notion that appetitive motivation is an important aspect of reinfor- cement. But a close examination of the literature in this area causes some difficulties for the anhedonia model. Sucrose consumption is impaired by DA antagonists (204-206,211) and it has been argued that this effect is not attributable to motor problems because the local frequency of licking is not altered by neuroleptics. Yet, it appears as though the local rate of licking is a poor indicator of the motor effects of DA antagonists, because the lick rate is unaffected even by cataleptic doses of haloperidol (78). It is likely that the lick rate is set by brainstem pattern generator mechanisms (78,240), and that basal ganglia DA may have little effect on that particular parameter. Other motor parameters related to licking are affected by DA antagonists, including lick efficiency (103,204,206), lick duration (78,80,88) and lick ".force (78,80). Jones and Mogenson (112) reported that injections of low doses of spiroperidol directly into nucleus accumbens impaired lap volume and tongue extension in a water licking procedure. Also, the attribution of sucrose consumption deficits to reward impairments seems uncer- tain in view of the studies showing that whole forebrain DA depletions or acute neuroleptic administration did not alter appetitive taste reactivity to sucrose (16,231). Higher doses of DA antagonists suppress chow feeding, and evidence indicates that this effect is largely attributable to motor problems that reduce the rate of feeding and impair food handling (4 I, 199). Several DA antagonists have been shown to decrease feeding rate (32,41,199), and pre-feeding to reduce food motivation predominantly affects feeding dura- tion, with little or no effect on feeding rate (40,199). In a direct comparison, the effects of pre-feeding on chow intake differed substantially from the effects of haloperidol (199). It has been demonstrated that neuroleptic drugs can sub- stantially reduce lever pressing for food at lower doses that do not impair simple food approach responses or food con- sumption (19,73,183,185). These results are typically inter- preted to mean that a fundamental aspect of food reinforcement (i.e. the tendency to approach and consume food) is intact in rats treated with moderate doses of DA antagonists. Perhaps the first report of this phenomenon was by Rolls et al. (183), who interpreted their findings to mean that DA antagonists interfered with "complex motor responses". Another early report was by Fibiger et al. (73), who stated that "the decreased bar pressing for food was not the result of anorexia or reduced motivation for food", and later that DA antagonists were not "interfering with reward". Ljungberg, in several papers, has shown that DA antagonists impair water-reinforced lever pressing at doses that do not impair water intake (136-138). In the initial report (136), it was stated that "'the attenuation of operant responding after low doses of neuroleptics cannot be explained by an effect on the ability of animals to regulate their body water (i.e., on ~motivation' or on 'reinforcing properties' of the water)." Blackbum et al. (19) also obtained related findings, in that they observed that SALAMONE, COUSINS AND SI~YDER" food-related anticipatory reactions were more greatly impaired than food consumption by low doses of pimozide. These authors concluded that their results could not be attributed to a "reward" deficit. In view of the fact that low doses of DA antagonists that suppress lever pressing for food do not reduce food consumption, it seems difficult to argue that the unconditioned reinforcing properties of food must be suppressed in order for DA antagonists to impair lever pressing for food. The effects of DA antagonism on basic processes of stimulus-stimulus associations remain uncertain, and some aspects of associative processes may be impaired while others remain intact (4,14,235). Studies of classical conditioning indicate that DA antagonists appear to blunt the conditioned and unconditioned excitatory or arousal properties of stimuli (93). Yet in the context of this discus- sion, it should be stressed that there is quite a diffe~'ence between the "excitatory properties of stimuli" and "hedo- nia"; DA antagonists could be altering arousal functions that are related to aspects of associative processes yet still not directly affect primary reinforcement. In discussing the effects of flupentixol on the development of place prefer- ence, Agmo et al. (4) stated that although the DA antagonist may have affected associative processes, the doses given did not affect sucrose consumption and therefore "the reward value of food or water was not reduced". Another line of investigation has involved attempts to assess the behavioral reactivity of neuroleptic-treated rats to food presentation. The locomotor activity induced by scheduled food presentation is substantially reduced by haloperidol (i 87). Yet other aspects of behavioral reactivity to food are relatively intact in neuroleptic-treated rats. Berridge et al. (16) demonstrated that extensive forebrain DA depletions that involved both striatum and nucleus accumbens did not affect appetitive taste reactivity to sucrose solutions. In a more recent study, it was shown that acute neuroleptic administration did not alter appetitive taste reactivity to sucrose (231). Kirkpatdck and Fowler (122) studied the relation between emitted lever pressing force and the concentration of sucrose reinforcement. Typi- cally, untreated rats emit greater forces in response to higher sucrose concentrations, and administration of pimozide failed to affect this pattern (122). An operant psychophysi- cal procedure was employed by Martin-Iverson et aL (147) to study the effects of haloperidol on perceived reward quantity, and this DA antagonist failed to alter responding in a manner consistent with a reduction in perceived hedonic value. In summary, several lines of evidence indicate that low doses of DA antagonists that can suppress lever press- ing for food do not impair the primary reinforcing properties of food. 4.3. Behavioral effects of accumbens DA depletions Much of the work related to the anhedonia hypothesis has focused upon the effects of systemically administered neu- roleptics. Because nucleus accumbens DA has specifically been implicated in food reinforcement, it is important to examine in detail the literature linking accumbens DA to food-related behaviors. Given the hypothesized importance of'accumbens DA for food reinforcement, it is relevant to consider that accumbens DA depletions, intra-accumbens injections of haloperidol and large ibotenic acid lesions of
Page 35: 2063633520 Log in for more options!
~ B 'EHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 349 accumbens actually have little effect on lab chow consump- tion (11,125,197,233,236). Nucleus accumbens DA deple- tions did not affect total food intake, total time spent feeding, feeding rate or forepaw usage during feeding (197). Recently, it was shown that accumbens DA deple- tions did not alter discrimination of reinforcement magni- tude, nor did they affect response selection in a T-maze task based upon reinforcement magnitude (192). Although the focus of the present review is upon food motivation., it also is useful to examine the role of accum- bens DA in sexual motivation. Interference with accumbens DA does not affect preference for female sex partners in male rats as assessed in a maze choice task (104). Yet interference with accumbens DA does slow down the rate at which male rats run through a maze to approach female rats (104). Depletions of accumbens DA have little effect on male sexual behavior, but one of the effects is a slowing of the initiation of copulation (67). Although periods of lordo~ sis may be coincident with increases in accumbens DA release (156), DA depletions do not suppress lordosis. Thus, as shown with food-related tasks, interference with accum- bens DA does not substantially alter the consummatory behaviors associated with primary sexual motivation, and leaves important aspects of sexual reinforcement intact. A few experiments have examined the effects of accum- bens DA depletions on instrumental lever pressing. Although substantial increases in accumbens DA release accompany lever pressing on a CRF schedule, the effects of accumbens DA depletions on total number of CRF responses emitted are actually very mild and transient (149,195). Despite the fact that the total number of lever presses on a CRF schedule is only marginally affected by substantial DA depletions, some parameters of responding are affected considerably. Accumbens DA depletions pro- duce an initial reduction of response rates during CRF sessions, which results in a slow but steady rate of respond- ing throughout the session that does not resemble extinction (149,195). Depletions of accumbens DA also produce a slowing of the local rate of responding on both CRF and fixed ratio (FR) schedules, as measured by the analysis of interresponse times (195,196). The slowing of the local rate of FR 5 responding produced by accumbens DA depletions can last for several weeks after surgery, even though the total number of responses tends to recover more quickly (196). Although accumbens DA depletions have little effect on lab chow intake, they do substantially reduce the motor activity induced by periodic food presentation (151,197). Amphetamine-induced enhancement of responding sup- ported by conditioned reinforcers is reduced by accumbens DA depletions (223), and several studies have linked accumbens DA to conditioned incentive processes (25,26,68,69,117,182). Yet local injections of D1 or D2 agonists into the nucleus accumbens that affect conditioned reinforcement have no effect on intake of the water reinforcer, indicating that "alterations in primary moti- vation do not underlie the changes in response to condi- tioned reinforcement" (255). Future research should focus on the specific "core" and "shell" subregions of accum- bens to determine the degree of regional heterogeneity of function (53,143,157,262,263). Yet some conclusions can be drawn based upon the information available so far. DA depletions in the core region appear to have little effect on the unconditioned reinforcing properties of food. Nevertheless, DA depletions of accumbens core do affect processes related to reinforcement; DA depletions do pro- duce a slight slowing of instrumental responding, reduce behavioral activation and blunt behavioral reactivity to conditioned stimuli. 5. COST/BENEFIT ANALYSIS: INVOLVEMENT OF DA IN THE RELATIVE ALLOCATION OF RESPONSES IN RELATION TO CONSTRAINTS 5. I. Behavioral economics of reinforcement processes As discussed above, behavioral researchers have focused upon the characteristics of stimuli that function as reinforcers. Although researchers usually discuss individual reinforcing stimuli in isolation, it should be recognized that the environment is rarely so simple; organisms typically make choices between a variety of different reinforcers. Research into response/reinforcement matching has emphasized that reinforcement is a relative, and not an absolute, process. Thus, an important aspect of reinforce- ment is that animals select activities based upon their reinforcement value relative to other currently available sti- muli. Yet despite the importance of reinforcement value as a determinant of stimulus selection, it should also be recognized that there are response-related factors as well. The vast array of reinforcing stimuli are rarely if ever present in an uncon- strained environment. Organisms must perform instrumental responses to gain access to reinforcers, and these responses typically involve work. Several behavioral investigators have emphasized the importance of response "costs" or "con- stralnts" for determining instrumental response selection (34,83,106,114,153,175,186,189, 214,215). In view of the role of both reinforcement value and response costs in determining instrumental responding, it is important to consider that instrumental behavior basically involves ongoing choices between reinforcers of different values contingent upon responses with different costs. Such cost/benefit or "economic" approaches have become more common in studies of instrumental behavior (6,7,35, 105,132). Moreover, it should be recognized that cost/ben- efit analyses are generally important in a number of different fields, including various aspects of psychology (267), bio- logical studies of optimal foraging (129,130,216) and, of course, economics. Considering that DA systems have been implicated in behavioral activation, it is important to ponder the role of DA in the "cost" side of the cost/benefit interaction (163). It is possible.that accumbens DA is not involved in directly mediating reinforcement value per se, but instead is involved in enabling organisms to overcome response costs or constraints. It has been suggested that accumbens DA is involved in the process of allocating responses in relation to various reinforcing stimuli (102,186,188-190). As reviewed below, research with var- ious cost/benefit tasks has indicated that interference with accumbens DA alters the allocation of instrumental responses away from more vigorous or effortful responses and towards the selection of less effortful responses. 5.2. hzvolvetnent of DA in the relative allocation ~ respotlses In order to study food-related responses with different costs, a behavioral choice procedure was developed that
Page 36: 2063633521 Log in for more options!
350 SALAMONE, COUSINS AND SN~/DER increases in chow consumption have been shown after • .~---....~ ~ Chow acute injections of the D2 antagonist haloperidol, the D I l,~[- ~ × Pellets ~ antagonist SCH 23390, and the non-selective DA antagonist ~til ~ flupentix°l (47)" Thus' DA antag°nists with a wide variety !i of characteristics all have been shown to decrease lever pressing and increase chow consumption. Several drugs have been investigated that do not produce the same pattern ~ of effects on the FR5/chow feeding task. The stimulant and appetite suppressant, amphetamine, suppressed both lever 0~- ~ pressing and chow intake (47). The muscarinic agonist FR1 FR5 FR10 FR20 FIG. 2. Demand curve showing the effect of ratio on food obtained through lever pressing (open squares, "pellets") and lab chow consumption (x, "chow") for a group of rats (n = 24) tested on the concurrent lever press- ing/feeding task. These rats had been trained initially using FRI, 5, 10 and 20 schedules without any chow present, after which they were tested on FR1, 5, 10 and 20 schedules with lab chow concurrently available. Each rat spent I week on each schedule component, and schedule order was counter- balanced across rats. The data shown represent the mean food intake for an' entire week under each ratio schedule, and the overall effects of schedule on Bioserve pellet and lab chow consumption were statistically significant (see Snyder, B., unpublished Masters Thesis, University of Connecticut, USA). Data for lever pressing arc shown as Bioserve pellet intake (no. of reinforcers × 45 mg) so that lever pressing and chow data could be shown on the same scale. has allowed for the concurrent assessment of the effects of DA antagonists or DA-depleting brain lesions on lever pressing and food consumption (198). In this instrumental lever pressing/feeding procedure, a preferred food (Bioserve pellets) is available by pressing a lever on a fixed ratio (FR) schedule, while a less preferred food (lab chow) is also available concurrently in the operant chamber. Rats show a strong preference for Bioserve pellets over lab chow, and haloperidol did not affect this preference in free feeding preference tests (198). In versions of the FR/feeding choice task that involve low ratio values (i.e. FR1 or FR5), untreated or control rats typically obtain virtually all of their food by lever pressing for the preferred food, and eat little of the available lab chow (44,45,196). Increasing work requirement by using higher ratio values such as FR10 and FR20 leads to a shift in behavior away from lever pressing to obtain the preferred food and towards the acquisition and consumption of lab chow. Figure 2 is a "demand curve" showing the relation between ratio value and the intak~ of food obtained both from lever pressing and chow con- sumption. In this figure it can be seen that, in the range from FR1-FR20, as the ratio value increases food obtained from lever pressing decreases and chow consumption increases. "Thus, the concurrent lever pressing/feeding proce- dure has some of the characteristics of a cost/benefit task, in the sense that this procedure has been shown to be sensitive to increasing work requirements. Several studies have been performed with the instrumental lever press/feeding task, most of which have employed the FR5 schedule as the requirement for obtaining the preferred food. Using FR1 and FR5 versions of the lever press/feeding task, systemic administration of haloperidol was shown to reduce lever pressing but significantly increase chow con- sumption (198). This effect did not mimic the characteristics of reduced food motivation, as it was shown that pre-feeding acted to reduce both lever pressing for food and chow consumption (198). Decreases in lever pressing and pilocarpine failed to increase chow intake in doses that did suppress lever pressing (47). Sodium pentobarbital increased chow intake and decreased lever pressing at only one dose of all those investigated (47), which stands in marked contrast to the DA antagonists that suppress lever pressing and increase chow intake over a 2-3-fold dose • range. Thus, these results show that all drugs that suppress lever pressing do not act over a wide dose range to increase the intake of chow that is concurrently available. The fact that several DA antagonists decrease FR5 lever pressing and increase chow intake indicates that these drugs can suppress lever pressing in doses that do not produce profound deficits in food motivation or sedation that would also act to suppress food intake. The haloperidol-induced shift in behavior from lever pressing to chow intake also manifests itself as a high inverse correlation between lever pressing and chow intake across individual animals after acute administration (193). Thus, animals that show greater suppressions of lever pressing after haloperidol administration also show greater increases in chow consumption• The impairments in lever pressing produced by haloperidol, SCH 23390 and flu- penthixol are occurring at low/moderate doses that leave the rats directed toward the acquisition and consumption of food, which indicates that the lever pressing deficit is not due to a general loss of food motivation. The relative preservation of appetitive motivation in neuroleptic-treated rats is important, considering that many investigators have suggested that appetitive motivation provides a fundamental basis for the process of reinforcement (see discussion above). These results have been interpreted to mean that moderate doses of DA antagonists decreased lever pressing but did not alter the unconditionally rewarding character- istics of food consumption (44,45,47,198). 5.3. The role of accumbens DA #~ response allocation In order to study the brain mechanisms involved in the performance of the concurrent FR5/feeding task, the effects of DA depletions in different brain regions have been investigated. Considerable research has identified the nucleus accumbens as the critical brain locus for producing the decrease in lever pressing coupled with an increase in feeding (44,45,198)• Injections of haloperidol directly into the nucleus accumbens decreased lever pressing and increased chow consumption (198). The neurotoxicant 6- hydroxydopamine (6-OHDA) has been injected directly into several DA terminal regions, including the nucleus accum- bens and neostriatal sites, in order to determine the effects of local DA depletion on pertbrmance of the FR5/feeding task. Depletions of DA in accumbens lead to a dramatic shift in behavior, in which there is a significant decrease in FR5 lever pressing but a significant increase in consumption of
Page 37: 2063633522 Log in for more options!
B~HAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 351 d lab chow (44,45,198). DA depletions in the medial striatum did not significantly affect lever pressing or chow consump- tion, and the nucleus accumbens is the only site at which DA depletions mimic the effects of administration of low doses of systemic neuroleptics. Thus, depletions of nucleus accumbens DA do not produce a general reduction in food motivation, although accumbens DA depletions do decrease instrumental lever pressing for food when alternative food sources are available (44). Depletions of DA in the ventrolateral neostdatum (VLS) reduced both lever pressing for food and chow consumption (44). Based only upon this result, it may appear superficially that the VLS is the long sought "reward center" for food. Yet such a statement is without any basis in fact; there is no evidence whatsoever that VLS has any "reward" functions related to food, and there is an enormous body of evidence demonstrating that the VLS is involved in skilled motor usage of the forepaw and head regions. In an initial study, (110), it was observed that DA depletions in the VLS produced profound feeding deficits, and also produced tremulous oral movements. In a subsequent study, 6- OHDA was injected into the nucleus accumbens, antero- ventromedial striatum, and VLS. Detailed behavioral observations demonstrated that the 6ritical region in which DA depletions disrupt feeding is the VLS; rats with VLS DA depletions have pronounced deficits in food intake, feeding rate and forepaw usage during feeding (197). Thus, these results indicate that a classic result of striatal DA depletion (i.e. feeding deficits (60,146,219,232) can be localized to a particular striatal subregion, i.e. the VLS). Rats With VLS DA depletions are directed towards food consumption; most of these rats will vigorously consume wet mash, will attempt to eat large dry pellets, and will attempt to grasp small food pellets (184,197). Yet, rats with VLS DA depletions have severe motor/sensorimotor impairments that interfere with their ability to reach, grasp, handle and chew pellets (197). This conclusion is consistent with previous work demonstrating that severe impairments in reaching and grasping with the contralateral forepaw are produced by DA depletions in lateral striatum (66,237) or, more specifically, the VLS (184). Also, these results are consistent with anatomical data showing that the lateral neostriatum receives massive projections from sensorimotor neocortex (36,154). Additional experiments have been conducted to characterize the effects of local DA depletions on the microstructure of operant responding. Computerized behavioral analyses were conducted to obtain various measures of instrumental responding, includ- ing the interresponse time (IRT) for each operant response. Each IRT represents the reciprocal of the local response rate. As noted above, accumbens DA depletions produced a slight decrease in FR5 lever pressing and a modest slowing of the IRT distribution. In contrast, VLS DA depletions produced profound motor deficits that resulted in substantial and persistent reductions in lever pressing and a dramatic slowing of the IRT distribution (196). Subsequent work has shown that VLS DA depletions alter both the initiation and duration of lever pressing responses (46). Thus, VLS DA depletions clearly produce profound deficits in skilled motor usage, which affect the ability of rats to eat large food pellets or press levers to obtain food. In contrast, the effects of accumbens DA depletions are much more subtle. Accum- bens DA depletions do not impair chow intake, and only slightly affect lever pressing on CRF or FR5 schedules. Nevertheless, when chow is available concurrently along with lever pressing on FR5 schedules, accumbens DA depletions alter the path that the animal uses to obtain food, such that lever pressing is decreased and chow con- sumption is increased. One of the major goals of this research was to determine whether accumbens DA depletions caused a decrease in lever pressing and an increase in chow consumption because of motor deficits that set an absolute limit on the number of lever presses that could be emitted. In a recent study (45), rats were tested on days 1, 3, and 5 of a 5-day test week using the concurrent FR5/feeding procedure. On days 2 and 4 of each week lab chow was not concurrently available, and rats could only lever press on the FR5 schedule for pellets to obtain food. DA depletions produced by intra-accumbens injections of 6-OHDA produced dramatic decreases in lever pressing and increases in chow consumption on days when lab chow was available. Yet, lever pressing was not sig- nificantly reduced in DA-depleted rats on days when chow was not available, although there was a significant correla- tion between lever pressing and accumbens DA levels. These results again suggest that accumbens DA depletions do not produce a general deficit in food motivation, ankl also indicate that accumbens DA does not appear J~o be critical for the execution of individual motor acts involved in lever pressing. Therefore, the shift from lever pressing to chow consumption following accumbens DA depletions is not due to a motor deficit that sets an absolute ceiling on the number of responses that the rats could emit. Rather, these results are consistent with the notion that accumbens DA regulates the higher-order processes that are involved in response allocation relative to a variety of motivational stimuli. 5.4. A T-maze versiori of the cost~benefit procedures: involvetnent of accumbens DA in crossing energy barriers Although many studies have been performed using the instrumental FR5/chow feeding procedure, several impor- tant questions remain. Possibly, the shift from lever pressing to chow consumption that was produced by accumbens DA depletions could have occurred because these DA deple- tions selectively affect only "instrumental" behaviors such as lever pressing, but do not'affect "consummatory" behavior. In considering this question, it should of course be emphasized that food consumption also relies upon simple instrumental responses such as approaching and remaining in proximity to food (198,252). Yet despite such considera- tions, it is important to investigate cost/benefit procedures under conditions in which explicit instrumental responses are being selected. To address these concerns, a novel T- maze version of the cost/benefit paradigm was developed (192). For this task, one arm of the T-maze contains an alleyway that leads to two food pellets, whereas the other arm contains a 44 cm wire barrier that must be climbed in order to reach four food pellets (see Fig. 3). Well-trained rats continue to cross the barrier to receive four pellets. A low dose of haloperidol caused animals to shift away from the arm with the barrier, and towards the no-barrier arm that had a lower magnitude of reinforcement. However, this dose of haloperidol did not cause a shift away from the arm with four pellets if there was no barrier present. Accumbens DA depletions also decreased selection of the arm that contained
Page 38: 2063633523 Log in for more options!
352 Top view Barrier ~ FIG. 3. Top view of the T-maze apparatus descibed in the text is shown. The start arm of the maze was a box 29 × 21 × 21 era. The test arm ar~.a was a box 99 x 32 X 59 cm, which was constructed of wooden walls and a wire mesh floor. The connection between the start arm and the test arms was a sliding aluminium door. The barrier (shown here on the left) was 44 cm high and was made from a metal grating with parallel bars 2.5 cm apart. the barrier, and increased selection of the no-barrier arm that contained only two pellets. Yet accumbens DA depletions did not alter selection based on reinforcement magnitude when there was no barrier present in either ann. These results closely resemble those obtained from the operant procedure, and indicate that the shift away from the arm with the barrier is not due to a loss of preference for the higher reward magnitude (192). Halopeddol-treated and DA depleted rats remain directed towards food acquisition and consumption, yet these animals altered their behavior to select the less effortful path to obtain food. A subsequent study was also performed using the T-maze barrier task (43). Under one test condition, one ann of the maze contained a high reinforcement density (four × 45 mg Bioserve pellets) and the other arm contained a low rein- forcement density (two × 45 mg pellets). The barrier was placed in the arm that contained the high density of food reinforcement. In the second test condition, a separate group of rats was trained in the same T-maze, in which there were four food pellets in the arm that was obstructed by the barrier, yet there were no food pellets in the unobstructed arm. After training rats received intra-accumbens of injec- tions 6-OHDA or ascorbate vehicle. Accumbens DA deple- tions substantially decreased the number of selections of the obstructed arm with the high reinforcement density when the unobstructed arm also contained two food pellets. DA- depleted rats in this condition showed increased selection of the no-barrier arm as well as decreased entry into the arm that contained the barrier. These effects persisted through- out the three weeks of post surgical testing. Nevertheless, when the unobstructed arm contained no food pellets, and the only way to obtain food was to climb the barrier, rats with accumbens DA depletions showed only a modest effect on choice of the obstructed arm, which recovered by the second week of testing. DA-depleted rats that were tested with food in the unobstructed arm showed significantly fewer barrier crossings than DA-depleted rats that were tested with no food in the unobstructed arm. Thus, these findings were not consistent with the notion that accumbens DA depletion rendered the animals unable to climb the SALAMONE, COUSINS AND SI~YDER" barrier, or set an absolute ceiling on the number of barrier crossings the animals could perform. Instead, these results indicated that accumbens DA depletions affected the relative allocation of barrier climbing responses if alterna- tive food sources were available. Although rats with accumbens DA depletions crossed the barrier if this was the only source of food, these rats did have significant latency deficits (43). Interestingly, latency to leave the start box was significantly longer in this group, despite the fact this particular measure would not be affected directly by the time it takes to climb the barrier. Thus, DA depleted rats that eventually crossed the barrier took longer to inititate their responses. It is possible that this increased latency to leave the start box reflects a deficit in the planning stage of a complex movement such as barrier climbing, although the DA-depleted rats do eventually leave the start chamber and climb the barrier. 6. CONCLUSIONS The behavioral functions of nucleus accumbens DA remain complex and enigmatic. Certainly, it is unwise sim- ply to describe the functions of accumbeps DA with the unqualified use of such terms as "motor", "motivation", "reinforcement" or "reward". These terms are extremely blunt instruments, and they are inadequate for the task of precisely defining the functions of this structure. As noted above, there is considerable evidence that would cause one to question the notion that accumbens DA directly mediates the primary "rewarding" effects of food stimuli. Thus, it may be most useful to try and resist the current "zeitgeist", which would have one simply state that DA in nucleus accumbens directly mediates "reward". The processes of reir~forcement, motor control and moti- vation are not irreducible in nature; each term refers to several different components. Moreover, there is consider- able overlap between these processes (131,189). The gen- eration of,responses is affected by reinforcement, but it is also an aspect of motor control and sensorimotor function. The ability to form associations between stimuli and responses is an aspect of reinforcement, an aspect of learn- ing and an aspect of sensorimotor integration. The beha- vioral activation induced by motivational stimuli is an aspect of motivation, an aspect of reinforcement and an aspect of motor control and sensorimotor responsiveness. The work of Zeigler (264-266) has shown that lesions of sensory trigeminal circuits disrupt both sensorimotor and motivational aspects of feeding. One of the difficulties in identifying the behavioral functions of accumbens DA is that its functions lie in the areas of overlap between motivational and motor processes. Thus, one way of "describing the functions of accumbens DA would be to state that it is involved in higher order motor and sensor- imotor processes that are important for activational aspects of motivation, response allocation, and responsiveness to conditioned stimuli. Unfortunately, this may not roll off the tongue quite as fluently as the word "reward". Never- theless, the statement given above may be more useful and informative than any single word yet invented in the English language or technical lexicon. Essentially, it is being argued that the absolute distinction between "motor" and "reward" functions of DA, an idea which is so critical for the General Anhedonia Model, has I I I I I°
Page 39: 2063633524 Log in for more options!
BEHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 353 in 10 tO has reached the end of its useful life and should be discarded. ~For the overlap between motor and motivational years, pro- cesses has been emphasized by behavioral researchers (57,261). Cofer and Appley (33) suggested that conditioned ~stimuli activated an "anticipation-invigoration mechan- ism" that induced motor activities and increased the vigor of instrumental responding. These important behavioral functions, which for so long were described in the absence ~of any understanding of brain mechanisms, seem highly suitable as descriptions of the behavioral functions of accumbens DA. It has been suggested that DA systems are important for overall energy regulation (45,186,222). ~lIn contrast to the use of the term "anhedonia", the term "anergia" has been used to describe the effects of DA antagonism and accumbens DA depletion (192). [[Various phrases have been used to describe these functions of accumbens DA, including "behavioral activation", "behavioral reactivity", "motivational arousal", and. "psychomotor stimulation" (111,167,187-191,207,208, 1 248-250). In order to capture the integrative nature of these functions of DA, researchers have employed terms such as "sensorimotor" and "limbic-motor" (18,160,161, 188,189,220,256-258). I| A r/ecessary part of this rejection of the motor/reward !1 dichotomy must also be a revision of our understanding of the motor functions of nucleus accumbens. Considerable i, evidence indicates that locomotor activity is reduced by II accumbens DA depletions (44,125-127,246). Yet it should be emphasized that nucleus accumbens DA neurons are several synapses removed from the actual production of ~motor acts; indeed, they are ill suited for the task of directly controlling motor output, and there is little evidence that they are phasically active in specific relation to particular motor acts (191). It has been shown that accumbens lesions did not alter the .motor pattern of locomotion (236) and that accumbens DA depletions did not affect food intake or food handling (197). Interference with accumbens DA does not produce paralysis, and does not lead to the severe motor deficits produced by lateral stdatal DA depletions. The behavioral functions of accumbens differ from those of neostriatum, and these differences probably reflect the functional heterogeneity of striatal subregions as well as the hierarchical organization of frontal lobe and basal ganglia motor circuits (189,196). Nevertheless, accumbens DA depletions produce motor slowing, and appear to make the animal less behaviorally reactive to stimuli, so that higher levels of stimulation are necessary for instigating vigorous instrumental behaviors (43). This would indicate that nucleus accumbens DA is involved in modulating behavioral responsiveness to motivational stimuli, which represents ~in aspect of sensorimotor function. Accumbens DA appears to be involved in the regulation of motor activities but not the specific execution of motor acts. Release of DA in accumbens may prepare organisms for movement, but other structures more directly participate in the execution of motor acts ( 189,191). Depletions of accum- bens DA alter the temporal characteristics of movement, the probability of spontaneous movement being generated, and the ability of stimuli to elicit movement. Accumbens DA depletions do not irreversibly impair the ability to lever press or climb barriers to obtain food, but instead set constraints upon which instrumental response is selected. The general effect of accumbens DA depletions is to alter the relative allocation of responses with different kinetic requirements, such that behavior is biased in the direction of lower effort alternatives. Thus, accumbens DA participates in the process of enabling animals to overcome the obstacles that separate them from significant stimuli such as food. In economic terms, nucleus accumbens DA is important for the relative inelasticity of demand for food reinforcers. Nucleus accumbens DA may participate in the motor planning functions of prefrontal and premotor cortices (43), and may also be involved in modulating some of the conditioned and unconditioned excitatory properties of stimuli (93). DA in nucleus accumbens is important for responding to con- ditioned stimuli, and for responding to stimuli that are spatially and temporally distant from the organism. Are these functions purely sensory, purely motor, or exclusively motivational? Without further qualifications, such terms are not sufficient for describing the behavioral functions of accumbens DA. Perhaps it is better to move towards a different set of terms and embrace a more complex view of the various processes involved in behavioral regulation. ACKNOWLEDGEMENTS Many thanks to K. Sabol, J. Richards, D. Neill, S. Fowler and G. Heyman for their helpful discussions. REFERENCES 1. Abercrombie, E. A.; Keefe, K. A.; DiFdschia, D. A.; Zigmond, M. J., Differential effect of stress on in vivo dopamine release in st_datum, nucleus accumbens and medial frontal cortex. J. Neurochem. 52:1655-1658; 1989. 2. Acquas, E.; Carboni, E.; Leone. P.; Di Chiarra, G., SCH 23390 blocks drug-conditioned place-preference and place aversion: Anhedonia (lack of reward) or apathy (lack of motivation) after dopamine receptor blockade. Psychopharmacol. 99:151-155; 1989. 3. Ader, R.; Clink, D. W., Effects of chlorpromazine on the acquisition and extinction of an avoidance response in the rat..I. Pharmacol. Exp. Ther. 121:144-148; 1957. 4. Agmo, A.; Galvan, A.; Talamantes, B.. Reward and reinforcement produced by drinking sucrose: Two processes that may depend on different neurotransmitters. Pharmacol. Biochem. Behav. 52:403- 414; 1995. 5. Ahlenius; S. Pharmacological evaluation of new antipsychotic drugs. In: Witlner, P., ed., Behavioral Models in Psychopharmacology. Cambridge, England: Cambridge University Press, 1990. 6. Allison J. Economics and operant conditioning. In: Harzem P, Zeiler, M. D., eds., Predictability, Correlation and Contiguity. New York: John Wiley and Sons;1981: 321-353. 7. Allison, J., Response deprivation, reinforcement, and economics. J. Exp. Anal. Behav. 60:129-140; 1993. 8. Anisman, H.; Remington, G.; Sklar, L. S., Effect of inescapable shock on subsequent escape performance: Catecholaminergic and chotinergie mediation of response initiation and maintenance. Psychopharmacol. 61 : 107-124; 1979. 9. Anisman, H.; Corradini, A.; Tombaugh, T. N.; Zacharko, R. M., Avoidance performance, cue and response-choice discrimination after neuroleptic treatment. Pharmacol. Biochem. Behav. 17 1245-1249; 1982. o
Page 40: 2063633525 Log in for more options!
354 SALAMONE, COUSINS AND*S~NYDE1~, 10. Asin, K. E.; Fibiger, H. C., Force requirements in lever-pressing and responding after haloperidol. Pharmacol. Biochem. Behav. 20:323- 326; 1984. 11. Bakshi, V. P.; Kelley, A. E., Dopaminergic regulation of feeding behavior: I., Differential effects of haloperidol microinjection in three striatal subregions. Psychobiol. 19:223-232; 1991. 12. Baum, W. M, On two types of deviation from the matching law: bias and undermatching. J. Exp. Anal. Behav. 22:231-242; 1974. 13. Beatty, J. Principles of Behavioral Neuroscience. Madison, WI: Brown and Benchmark; 1995. 14. Beninger, R. J,; Mason, S. T.; Phillips, A. G.; Fibiger, H. C., The use of conditioned suppression to evaluate the nature of neuroleptic- induced avoidance deficits. J. Pharmae. Exp. Ther. 213:623-627; 1980. 15. Beninger, R. J.; Ranaldi, R., Microinjections of flupenthixol into the candate-putamen but not the nucleus accumbens, amygdala or frontal cortex of rats produce intra-session declines in food-rewarded oper- ant responding. Behav. Brain Res. 55:203-212; 1993. 16. Berridge, K. C.; Venier, I. L.; Robinson, T. E., Taste reactivity analysis of 6-hydroxydopamine-induced aphagia: implications for arousal and anhedonia hypotheses of dopamine function. Behav. Neurosci. 103:36-45; 1989. 17. Bindra, D., How adaptive behavior is produced: a perceptual- motivational alternative to response-reinforcement. Behav. Brain Sci. 1:41-91; 1978. 18. Blackburn, J. R.; Pfaus, J. G.; Phillips, A. G., Dopamine functions in appetitive and defensive behaviours. Prog. Neurobiol. 39:247-279; 1992. 19. Blackburn, J. R.; Phillips, A. G.; Fibiger, H. C., Dopamine and preparatory behavior:. I effects of pimozida.. Behav. Neurnsei. 101:352-360; 1987. 20. Blackburn, J. R.; Phillips, A. G., Enhancement of freezing behavior by metoclopramide: implications for neuroleptie-indueed avoidance deficits. Pharmacol. Biochem. Behav. 35:685-691; 1990. 21. Bowers, W.; Hamilton, M.; Zacharcho, R. M.; Anisman, H., Differ- ential effects of pimozide on response-rate and choice accuracy in a self-stimulation paradigm in mice. Pharrnacol. Biochem. Behav. 22:521-526; 1985. 22. Bozarth, M. A.; Wise, R. A., Involvement of the ventral tegmental dopamine system in opioid and psychomotor stimulant reinforcement. Life Sci. 28:551-555; 198l. 23. Bozarth, M. A.; Wise, R. A., Heroin reward is dependent on a dopaminergie substrate. Life Sci. 29:1881-1886; 1981. 24. "Broekkamp, C. L.; van Dongen, P. A.; van Rossum, Neostriatal involvement in reinforcement and motivation. In: Cools, A. R., Lohman, A. M., van den Berken, J. H., eds, Psychobiology of the Striatum. Amsterdam: Elsevier North Holland; 1977. 25. Cador, M.; Robbins, T. W.; Everitt, B. J., Involvement of the amygdala in stimulus-reward associations: interactions with the ventral striatum. Neurosci. 30:77-86; 1989. 26. Cador, M.; Taylor, J. R.; Robbins, T. W., Potentiation of the effects of reward-related stimuli by dopaminergic-dependent mechanisms in the nucleus accumbens. Psychopharrnacol. 104:377-385; 1991. 27. Carlson, N. Foundations of Physiological Psychology. Needham Hights, MA: Allyn an Bacon, 1995;. 28. Carr, G. D.; White, N. M., The relationship between stereotypy and memory improvement produced by amphetamine. Psychopharmacol. 82:203-209; 1984. 29. Cenci, M. A.; Kalen, P.; Mandel, R. J.; Bjorklund, A., Regional differences in the regulation of dopamine and noradrenaline release in medial frontal cortex, nucleus accumbens and caudate- putamen: a microdialysis study in the rat. Brain Res. 581:217-228; 1992. 30. Cenci, M. A.; Kaien, P.; Duan, W. M.; Bjorkland, A., Transmitter release from transplants of fetal ventral mesencephalonor locus coeruleus in the rat frontal cortex and nucleus accumbens: effects of pharmacological and behaviorally activating stimuli. Brain Res. 641:225-248; 1994. 31. Chert, J.; Paredes, W.; Li, J.; Smith, D.; Lowison, J.; Gardner, E. L., 9-tetrahydrocannabinol produces naloxone blockable enhancement of presynaptie basal dopamine efflux in nucleus accumbens of concious, freely-moving rats as measured by intracerebral microdialysis. Psychopharrnacol. 102:156-162; 1990. 32. Cliftun, P. G.; Rusk, [. N.; Cooper, S. J., Effects of dopamine D1 and dopamine D2 antagonists on the free feeding and drinking patterns of rats. Behav. Neurosci. 105:272-281; 1991. 33. Cofer, C. N.; Appley, M. H. Motivation: Theory and Research. New York: John Wiley & Sons; 1964. 34. Collier, G. H.; Jennings, W., Work as a determinant of instrumental performance. J. Comp. Physiol. Psychol. 68:659-662; 1969. 35. Collier, G. H.; Johnson, D. F.; Hill, W. L.; Kaufman, L. W., The economics of the law of effect. J. Exp. Anal. Behav. 46:113-136; 1986. 36. Collins, R. C., Kindling of neuroanatomic pathways during recurrent focal penicillin seizures. Brain Res. 150:503-517; 1978. 37. Colwill, R. M.; Rescorla, R. A. Associative s/.ructures in instrumental learning. In Bower G. H. ed. The Psychology of Learning and Motivation, New York, Academic Press;1986:55-104. 38. Cook, L.; Catania, C., Effects of drugs on escape and avoidance behavior. Fed. Proc. 23:818-835; 1964. 39. Cook, L.; Weidiey, E., Behavioral effects of some psychopharma- cological agents. Ann. NY Acad. Sci. 66:740-752; 1957. 40. Cooper, S. J.; Francis, J., A microstructural analysis of the effects of presatiation on feeding behavior in the rat. Physiol. Behav. 53:413- 419; 1993. 41. Cooper, S. J.; Sweeny, K. F., Effects of spiperone alone and in combination with anorectic agents on feeding parameters in the rat. Neuropharmacol. 19:997-1003; 1980. 42. Corradini, A.; Tombaugh, T.; Anisman, H., Effects of pimozide on escape and discrimination performance in a water-escape task. Behav. Neurosci. 98:96-106; 1984. 43. Cousins, M. S.; Atherton, A.; Turner, L.; Salamone, J. D.; Nucleus accumbens dopamine depletions alter relative response allocation in a T-maze cost/benefit task. Behav. Brain Res. 74:189-197; 1996. 44. Cousins, M. S.; Sokolowski, J. D.; Salamone, J. D., Different effects of nucleus accumbens and ventrolateral striatal dopamine depletions on instrumental response selection in the rat. Pharmacol..Biochem Behav. 46:943-951; 1993. 45. Cousins, M. S.; Salamone, J. D., Nucleus accumbens dopamine depletions in rats affect relative response allocation in a novel cost/ benefit paradigm. Pharmacol. Biochem. Behav. 49:85-91; 1994. 46. Cousi~as, M. S.; Salamone, J. D., Involvement of ventrolateral striatal dopamine in movement initiation and execution: A microdialysis and behavioral investigation. Neurosci. 70:849-859; 1996. 47. Cousins, M. S.; Wei, W.; Salamone, J. D., Pharmacological char- acterization of performance on a concurrent lever pressing/feeding choice procedure: effects of dopamine antagonist, chulinomimetic, sedative and stimulant drugs. Psychopharmacol. 116:529-537; 1994. 48. Crow, T. J., Catecholamine-containing neurones and electrical self- stimulation: a review of some data. Psychol. Med. 2:414-421; 1972. 49. Cunningham, C. L.; Malott, D. H.; Dickinson, S. D.; Risinger, F. O., Haloperidol does not alter expression of ethanol-induced conditioned place prefernce. Behav. Brain Res. 50:1-5; 1990. 50. D'Angio, M. B.; Serrano, A.; Rivy, J. P.; Scatton, B., Tail-pinch stress increases extracellular DOPAC levels (as measured by in vivo vol- tammetry) in rat nucleus accumbens but not frontal cortex: Antagon- ism by diazepam and zolpidem. Brain Res. 409:169-174; 1987. 51. D'Angio, M. B.; Serrano, A.; Scatton, B., Mesocorticolimbic dopaminergie systems and emotional states. J. Neurosci. Meth. 34:135-142; 1990. 52. Davidson, A. B.; Weidley, E., Differential effects of neuroleptic and other psychotropic agents on aquisition of avoidance in rats. Life Sci. 18:1279-1284; 1976. 53. Deutch, A. Y.; Cameron, D. S., Pharmacological characterization of dopamine systems in the nucleus accumbens core and shell. Neurosci. 46:49-56; 1992. 54. Deutch, A. Y.; Tam, S. Y.; Roth, R. H., Footshock and conditioned stress increase 3,4-dihydroxyphenylacetic acid (DOPAC) in the ventral tegmental area but not substantia nigra. Brain Res. 333:143-146; 1985. 55. Di Chiara, G.; Imperato, A., Preferential stimulation of dopamine release in the nucleus accumbens by opiates, alcohol and barbitu- rates: studies with transcerebral dialysis in freely moving rats. Ann. NY Acad. Sci. 473:367-381; 1986. 56. DiStain, G.; Sandner, G., Conditioned place aversion produced by FG 7142 is attenuated by haloperidol. Psychopharmacol. 99:176- 180; 1989. 57. Duffy, E. Activation and Behavior. New York: John Wiley & Sons; t963. 58. Dunn, A., Stress-related activation of cerebral dopaminergic systems. Ann. NY Acad. Sci. 537:124-137; 1988. i.
Page 41: 2063633526 Log in for more options!
~cd ess ~bic eth. Sci. n of hell. ,reed , the Res. mine ~---~ ~bitu- Ann. 8~HAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 355 59. Dunn,. A.; File, S. E., Cold restrain alters dopamine metabolism in frontal cortex, nucleus accumbens and neostriatum. Physiol. Behav. 31:511-513; 1983. 60. Dunnett, S. B.; Iversen, S. D., Regulatory impairments following selective 6-OHDA lesions of the neostriatum. Behav. Brain Res. 4:195-202; 1982. 61. Edmonds, P. E.; Gallistel C. R. Parametric analysis of brain stimulation reward in the rot: effect of performance variavles on the reward summation function. J. Comp. Physiol. Psychol. 87:876- 883; 1974. 62. Ettenberg, A.; Carlisle, H. J., Neuroleptie-induced deficits in operant responding for temperature reinforcement. Pharmacol. Biochem. Behav. 22:761-767; 1985. 63. Ettenberg, A.; Koob, G. F.; Bloom, F., Response artifact in the .measurement of neurolepdc-induced anhcdoni& Science 209:357- 359; 1981. 64. Ettenberg, A.; Petfit, H. O.; Bloom, F. E.; Koob, G.; Heroin and cocaine self-administration in rats: mediation by separate systems. Psychopharmacol. 78:204-209; 1982. 65. Evenden, J. L.; Robbins, T.W., Dissociable effects old-amphetamine, chlordiazepoxide and alpha-flupenthixol on choice and rote measures of reinforcement in the rat. Psychopharmacol. 79:180-186; 1983. . 66. Evenden, L L.; Robbins, T. W., Effects of unilateral 6-hydroxy dopaminc lesions of the caudate-putamen on skilled forelimb use in the rat. Behav. Brain Res. 14:61-68; 1984. 67. Everitt, B. J., Sexual motivation: A neural and behavioral analysis of the mechanisms underlying appetitive and copulatory responses of male rats. Neurosei. Biobehav. Rev. 14:217-232; 1990. amygdala and ventral striamm in stimulus-reward association: studies assessing a second-order schedule of sexual reinforcement. Neurosci. 30:63-75; 1989. 69. Everitt, B. J.; Morris, K. A.; O'Brien, A.; Robbins, T. W., The basolateral amygdala-ventral striatal system and conditioned place preference: Further evidence of limbic-striatal interactions under- lying reward-related processes. Neurosci. 42:1-18; 1991. 70. Fada, F.; Argiolas, A.; Melis, M. R.; Tissari, A. H.; Onaii, P. C.; Gessa, G. L., Stress-induced increase in 3,4-dihydroxyphenylacetie acid (DOPAC) levels in the cerebral cortex and in nucleus aecum- bens: reversal by diazepam. Life Sei. 23:2219-2224; 1978. 71. Faustman, W. 04 Fowler, S. C., Use of operant response duration to distinguish effects of haloperidol from non-reward. Pharmacol. Biochem. Behav. 15:327-329; 1981. 72. Faustman, W. O.; Fowler, S. C., An examination of methodological refinements, clozapine and fluphenazine in the anhedonia paradigm. Pharmacol. Binchem. Bchav. 17:987-993; 1982. 73. Fibiger, H. C.; Carter, D. A.; Phillips, A. G., Decreased intracranial self-stimulation after neuroleptics or 6-hydroxydopaminc: evidence for mediation by reward deficits rather than by reduced reward. Psychopharmacol. 47:21-27; 1976. 74. Finlay, J. M.; Damsma, G.; Fibiger, J. C., Banzodiazepine-induced decreases in extracellular concentrations of dopamine in the nucleus accumbens after acute and repeated administration. Psychopharmacol. 106:202-208; 1992. 75. Fouriezos, G.; Bielajew, C.; Pagotto, W., Task difficulty increases threshold of rewarding brain stimulation. Behav. Brain Res. 37:1-7; 1990. 76. Fouriezos, G.; Wise, R. A., Pimozide-induced extinction of intracra- nial self-stimulation: Response patterns rule out moto performance deficits. Brain Res. 103:377-380; 1980. 77. Fowler, S. C. Neurolepdcs produce within-session decrements: facts and theories. Drug Dee. Res. 1990. 78. Fowler, S. C.; Das, S., Haloperidol-induced decrements in force and duration of rats tongue movements during licking are attenuated by concomitant anticholinergic treatment. Pharmacol. Biochem. Behav. 49:813-817; 1994. 79. Fowler, S. C.; LaCerra, M. M.; Ettenberg, A., Effects of haloperidol on the biophysical characteristics of operant responding: Implica- tions for motor and reinforcement processes. Pharmacol Biochem Behav. 25:791-796; 1986. 80. Fowler, S. C.; Mortell, C., Low doses of haloperidol interfere with rat tongue extensions during licking: a quantitative analysis. Behav. Neurosci. 106:1-9; 1992. 81. Frank, R.; Williams. H., Both response effort and current intensity affect self-stimulation train duration thresholds. Pharmacol Biochem Behav. 22:527-530; 1985. 82. Gaddy, J. R.; Neill, D. B., Differential behavioral changes following intrastiatal applications of 6-hydroxydopamine. Brain Res. 119:439- 446; 1977. 83. Garmon, K. N.; Smith, H. V.; Tiemey, K. J., Effects of procure- ment cost on food consumption in rats. Physiol Behav. 31:331- 337; 1983. 84. German, D. C.; Bowden, D. M., Catecholamine systems as the neural substrate for intraeranial self-stimulation: a hypothesis. Brain Res. 73:381-419; 1974. 85. Gerrits, M.; Ramsey, N. F.; Wolterink, G.; van Ree, J. M., Lack of evidence for an involvement of nucleus accumbens dopamine D1 receptors in the initiation of heroin self-adm/nistration. Psychopharmacol. 114:486-494; 1994. 86. Glickman, S. E.; Schiff, B. B., A biological theory of reinforcement. Psychol. Rev. 74:81-109; 1967. 87. Gold, M. S.; Miller, N. S.; Jonas, J. M. Cocaine (and crack): Neurobiol- ogy. In Lowinson, J. H. and P. Ruiz, Robert MAilman eds. Substance Abuse. Baltimore: William and Wilkins; 1992: 222-235.; 88. Gramling, S. E.; Fowler, S. C., Effects of neuroleptics on rate and duration of operant versus reflexive licking in rats. Pharmacol. Biochem. Behav. 22:541-545; 1985. 89. Gramling, S. E.; Fowler, S. C.; Collins, K. R., Some effects of pimozide on nondepdved rats licking sucrose solutions in an arahedonia paradigm. Pharmacol. Biochem. Behav. 21:617-624; 1984. 90. Gramling, S. E.; Fowler, S. C.; Tizzano, I. P., Some effects of pimozide on nondeprived rats' lever pressing maintained by a sucrose reward in an anhedonia paradigm. Pharrnacol. Biochem. Bchav. 27:67-72; 1987. 91. Green, D. M.; Swetts, J. A. Signal Detection Theory and Psycho- physics. New York Wiley; 1966. 92. Gunne, L. M.; Anggard, E.; Jonsson, L. E., Clinical trials with amphetamine-blocking drugs. Psychiat, Neurol. Neuro. 75:225- 226; 1972. 93. Harvey, J. A.; Gormezano, I., Effects ofhaloperidol and pimozide on classical conditioning of the rabbit nictitating membrane response. J. Pharmacol. Exp. Ther. 218:712-719; 1981. 94. Hemandez, L.; Hoebel, B. G., Food reward and cocaine increase extracellular dopamine in the nucleus accumbens as measured by ,microdialysis. Life Sci. 42:1705-1712; 1988. 95. Herrnstein, R. J., Formal properties of the matching law. J. Exp. Anal. Behav. 21:159-164; 1974. 96. Hcyman, G. M., A parametric evaluation of hedonic and motodc effects of drugs: pimozide and amphetamine. J. Exp. Anal. Behav. 40:113-122; 1983. 97. Heyman, G. M.; Kirmie, D. L.; Selden, L. S., Chlorpromazine and pimozide alter reinforcement efficacy and motor performance. Psychopharrnacol. 88:346-353; 1986. 98. Hcyman, G. M.; Monaghan, M. M., Effects of changes in response requirement and deprivation on the parameters of the matching law equation: new data and review. J. Exp. Psychol. An. Behav. Proc. 13:384-394; 1987. 99. Hilgard, E. R. Marquis, D. G. Conditioning and Learning. Appleton- Century Co., New York; 1940.; 100. Hoebel, B. G.; Monaco, A. P.; Hemandez, L.; Aulisi, E. F.; Stanley, B. G.; Leonard, L., Self-injection of amphetamine directly into the brain. Psychopharmacol. 81:158-163; 1983. 101. Hoffman, D. C.; Beninger, R. J., The effects of selective dopamine D1 or D2 receptor antagonists on the establishment of agonist- induced place conditioning in rats. Pharmacol. Biochem. Behav. 33:273-279; 1989. 102. Hsiao, S.; Chcn, B. H., Complex response competition and dopaminc blocking: Choosing of high cost sucros~ solution vs. low cost water solution in rats. Chin. J. Physiol. 38:99-109; 1995. 103. Hsiao, S.; Smith, G. P., Raclopride reduces sucrose preference in rats. Pharmacol. Biochem. Behav. 50 (1):121-125; 1995. 104. Hull, E. M.; Weber, M. S.; Eaton, R. C.; Dua, R.; Markowski, V. P.; Lumley, L.; Moses, J., Dopaminc receptors in the ventral tcgmental area affect motor, but not motivational or reflexive, components of copulation in male rats.~-~'cain Res. 554:72-76; 199 I. 105. Hursh, S. R., Behavioral Economics. J. Exp. Anal. Behav. 42:435- 452; 1984. 106. Hursh, S. R.; Raslear, T. G.; Shurtleff, D.; Bauman, R.; Simmons, L., A cost-benefit .analysis of demand for food. J Exp Anal Behav. 30:419-440; 1988. 107. Huston, J. P.; Steiner. H.; Weiler, H.; Morgan, S.; Schwarting, R. K.W., The basal ganglia-orofacial system: studies on neuro-beha-
Page 42: 2063633527 Log in for more options!
356 SALAMONE, COUSINS AND SNYDER vioral plasticity and sensory-motor tuning. Neurosci. Biobehav. Rev. 14:433-466; 1990. 108. lmperato, A.; Angelucei, L.; Casolini, P.; Zocchi, A.; Puglisi- Allegra, S., Repeated stressful experiences differently affect limbie dopaminc release during and following stress. Brain Res. 577:194- 199; 1992. 109. Imperato, A.; Puglisi-Allegra, S.; Casoline, P.; Angclucci, L., Changes in brain dopamine and acetylcholine release during and following stress are independent of the pituitary-adrenocortical axis. Brain Res. 538:111-117; 1991. 110. Jicha, G. A.; Salamone, J. D., Vacuous jaw movements and feeding deficits in rats with ventrolateral striatal dopamine depletions: possible relation to parkinsonian symptoms. J Neurosci. 11:3822- 3829; 1991. 11 I. Johnson, P. L.; Stellar, J. R., Effects of accumbens DALA micro- injections on brain stimulation reward and behavioral activation in intact and 6-OHDA treated rats. Psyehopharmacol. 114 (4):665-671; 1994. 112. Jones, D. L.; Mogenson, G. L., Oral motor performance following control dopamine receptor blockade. Eur. J. Pharmacol. 59:11-21; 1979. 113. Joseph, M. H.; Hedges, H., Lever pressing for food reward and changes in dopamine turnover and uric acid in rat caudate and nucleus accumbens studied chronically by in vivo voltammera3,. J. Neurosci. Meth. 34:143-149; 1990. 114. Kaufman, L. W., Foraging cost and meal patterns in ferrets. Physiol Behav. 25:139-141; 1980. 115. Keefe, K. A.; Salamone, J. D.; Zigmond, M. J.; Stricker, E. M., Paradoxical kinesia in Parkinsonism is not caused by dopamine release: studies in an animal models. Arch. Neurol. 46:1070-1075; 1989. 116. Kelleher, R. T.; Morse, W. H., Escape behavior and punished behavior. Fed. Prec. 23:808-817; 1964. 117. Kelley, A. E.; Dells, J. M., Dopamine and conditioned reinforcement II: contrasting effects of amphetamine mierninjeetion into the nucleus accumbens with peptide mieroinjection into the ventral tegmental area. Psychopharmacol. 103:197-203; 1991. 118. Kelley, A. E.; Stinus, L., Disappearance of hoarding behavior after 6- hydroxydopamine lesions of the mesolimbic dopamine neurons and its reinstatement with L-DOPA. Behav. Neurosci. 99:531-5435; 1985. 119. Killeen, P., On the temporal control of behavior. Psychol. Rev. 82:g9-115; 1975. 120. Killeen, P. Incentive theory. In: Bernstein D. ed. Response structure and organization. University of Nebraska Press, Lincoln Nebraska; 1981. 121. Killeen, P.; Hanson, S.; Osbourne, S., Arousal: its genesis and manifestation as response rate. Psychol. Rev. 85:571-581; 1978. 122. Kirkpatrick, M. A.; Fowler, S. C., Force-proportional reinforcement: pimozide does not reduce rats' emmission of higher forces for sweeter rewards. Pharmacol. Biocbem. Behav. 32:499-504; 1989. 123. Kiyatkin, E. A.; Gratton, A., Electrochemical monitoring of extra- cellular dopamine in nucleus accumbens of rats lever pressing for food. Brain Res. 652:225-234; 1994. 124. Kiyatkin, E. A.; Wise, R. A.; Gratton, A., Drug- and behavior- associated changes in dopamine-related electrochemical signals during intravenous heroin self-administration in rats. Synapse 14:60-72; 1993. 125. Koob, G. F.; Riley, S. J.; Smith, S. C.; Robbins, T. W., Effects of 6- hydroxydopamine lesions of the nucleus accumbens septi and olfac- tory tubercle on feeding, locomotor activity, and amphetamine anorexia in the rat. J. Comp. Physiol. Psychol. 92:917-927; 1978. 126. Koob, G. F.; Stinus, L.; Le Meal, M., Hyperactivity and hypoactivity produced by lesions to the mesolimbic dopamine system. Behav. Bmin Res. 3:341-359; 1981. 127. Koob, G. F.; Swerdlow, N. R., The functional output of the mesolimbic dopamine system. Ann. N. Y. Acad. Sci. 537:216-227; 1988. 128. Kosobud. A. E.; Harris, G. C.; Chapin, J. K., Behavioral associations of neuronal activity in the ventral tegmental area of the rat. J. Neurosci. 14:7117-7129; 1994. 129. Krebs, J. R. Optimal foraging: Decision rules for predators. In Krebs, J. R., Davies, W. B., eds. Behavioral Ecology. Sunderland, MA: Sinaue Associates; 1978. 130. Krebs, J. R., Optimal foraging: theory and experiment. Nature 268:583-584; 1977. 131. Kuo, Z. Y. The dynamics of behavior development: An epigenetic view. New York, Random House; 1967. 132. Lea, S. E. G., The psychology and economies of demand. Psychol. Bull. 85:441-466; 1978. 133. Liao, R~ M.; Fowler, S. C., Halopeddol produces within-session increments in operant response duration in rats. Pharmacol. Biochem. Behav. 26:1999-2010; 1990. 134. Lidsky, T. I4 Buehwald, N. A.; Manetto, C.; Schneider, J. S.. A consideration of sensory factors involved in the motor functions of the basal ganglia. Brain Res. Rev. 9:133-146; 1985. 135. Lippa, A. S.; Antleman, S.; Fisher, A.; Canfield, D., Neurochemical mediation of reward: a significant role for dopamine. P.harmacol. Biochem. Behav. 1:25-28; 1973. 136. Ljungberg, T., Blockade by neuroleptics of water intake and operant responding in the rat: anhedonia, motor deficit or both?. Pharmacol. Biochem. Behav. 27:341-350; 1987. 137. Ljungberg, T., Scopolamine reverses haloperidol-attenuated lever pressing for water but not halopeddol-attenuated water intake in the rat. Pharmacol. Biochem. Behav. 29:205-208; 1988. 138. Ljungberg, T., Differential attenuation of water intake and water- rewarded operant responding by repeated administration of haloper- idol and SCH 23390 in the rat. Pharmacol. Biochem. Behav. 35:111- 115; 1990. 139. Ljungberg, T.; Apicella, P.; Schultz, W., Responses of monkey dopamine neurons during learning of behavioral reactions. J. Neurophysiol. 67:145-163; 1992. 140. Lynch, M. R.; Carey, R. J., Environmental stimulation promotes recovery from haloperidol-induced extinction of open field behavior in rats. Psychopharmacol. 92:206-209; 1987. 141. Mackintosh, N. J., Limits on reinterpreting instrumental conditioning in terms of classical conditioning. Behav. Brain Sci. 1:67; 1978. 142. Mackinstosh, N. J. Conditioning and Associative Learning. NY, Oxford University Press; 1983. 143. Maldonado-Irizarry, C. S.; Kelley, A. E., Differential behavioral , effects following microinjection of an NMDA antagonist into nucleus aecumbens subregions. Psychopharmacol. 116:65-72; 1994. 144. Mark, G. P.; Schwarz, D. H.; Hernandez, L.; West, H. L.; Hoebel, B. G. Application of microdialysis to the study of motivation and conditioning: Measurements of dopamine and serotonin in freely- behaving rats. In Robinson, T. E., Justice, J. B., Microdialysis in the Neuroseiences; 1991:369-385. 145. Marshall, J. F.; Levitan, D.; Stricker, E. M., Activation-induced restoration of sensorimotor functions in rats with dopamine-depleting brain lesions. J. Comp. Physiol. Psychol. 90:536-546; 1976. 146. Marshall, J. F.; Richardson, J. S.; Teitelbaum, P., Nigrostriatal bundle damage and the lateral hypothalamic syndrome. J. Comp. Physiol. Psychol. 87:808-830; 1974. 147. Martin-Iverson, M. T.; Wilke, D.; Fibiger, H. C., Effect of haloper- idol and d-amphetamine on perceived quantitiy of food and tones. Psyehopharmacol. 93:374-381; 1987. 148. Mason, S. T.; Beninger, R. J.; Fibiger, H. C.; Phillips, A. G., pimozide- induced suppression of responding: evidence against a block of food reward. Pharmacol. Biochem. Behav. 12:917-923; 1980. 149. McCullough, L. D.; Cousins, M. S.; Salamone, J. D., The role of nucleus accumbens dopamine in responding on a continuous rein- forcement operant schedule: a neurochemical and Behavioral study. Pharmac. Biochem. Behav. 46:581-586; 1993. 150. McCullough, L. D.; Salamone, J. D., Anxiogenie drugs beta-CCE and FG 7142 increase extracellular dopamine levels in the nucleus accumbens. Psychopharmacol. 109:379-382; 1992. 151. McCullough, L. D.; Salamone, J. D., Involvement of nucleus accumbens dopamine in" the motor activity induced by periodic food presentation: a microdialysis and behavioral st.udy. Brain Res. 592:29-36; 1992. 152. McCullough, L. D.; Sokolowsi, J. D.; Salamone, J. D.. A neuro- chemical and behavioral investigation of the involvement of nucleus accumbens dopamine in instrumental avoidance. Neurosci. 52:919- 925; 1993. 153. McDowell, J. J.; Kessell, R., A multivariate rate equation for variable- interval performance. J. Exp. Anal. Behav. 31:267-283; 1979. 154. McGeorge, A. J.; Faull, R. L.M.. The organization of the projection from the cerebral cortex to the striatum in the rat. Neuroscience 29:503-537; 1989. 155. Wleehl, P. E., On the circularity of the law of effect. Psychol. Bull. 47:52-75; 1950. 156. Meisel, R. L.; Camp, D. M.; Robinson. T. E., A microdialysis study
Page 43: 2063633528 Log in for more options!
!I ~ing 169. ~dle ,iol. fles. 171. ood 172. ~" of ein- 173. "dY" I ~ 174. 'CE leus l-lj leus 175. ~dic. Res. 176. BEHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 177. tudy 357 of ventral striatal dopamine during sexual behavior in female Syrian hamsters. Behav. Brain Res. 55:151-157; 1993. Meredith, G. E.; Blank, B.; Groenewegen, H. J., The distribution and compartmental organization of the cholinergic neurons in the nucleus accumbens of the rat. Neurosci. 31:327-345; 1989. Mirenowicz, J.; Schultz, W., ImpoRanee of unpredictability for reward responses in primate dopamine neurons. J. Neurophys. 72 (2):1024-1027; 1994. Mitchell, J. B.; Gratton, A., Opiod modulation and sensitization of dopamine re/ease elicited by sexual/y relevant sdmuli: a high speed chronoamperometrie study in freely behaving rats. Brain Res. 551:20-27; 1991. Mogenson, 'G.; Jones, D.; Yim, C. Y., From motivation to action: Functional interface between the limbie system and the motor system. Prog Neurobiol. 14:69-97; 1980. Mogenson, G. J.; Yang, C. R.; Yim, C. Y., Influence of dopamine limbic inputs to the nucleus accumbens. Ann. NY Acad. Sci. 537:86- i00; 1988. Muscat, R.; Willner, P., Effects of dopamine receptor antagonists on sucrose consumption and preference. Psyehopharmacol. 99:98-102; 1989. Neill, D. B.; Justice, J. B. An hypothesis for a behavioral function of. dopaminergie transmission in nucleus accumbens. In: Chronister, R. B., Defrance, J. F., eds., The Neurobiology of the Nucleus Accum- bens. Brunswick, Canada: Hue Institute; 1981. Niemegeers, C. J. E.; Verbmggen, F. J.; Janssen, P. A.J., The influence of various neuroleptic drugs on shock avoidance respond- ing rats. Psychopharmacol. 16:161-174; 1969. Niemegeers, C. J. E.; Verbruggen, F. J.; Janssen, P. A.J., The influence of various neuroleptie drugs on shock avoidance respond- ing in rats. Psyehopharmaeol. 16:175-182; 1969. Nishino, H.; Ono, T.; Muramoto, K.; Fukuda, M.; Sasaki, K., Neuronal activity in the ventral tegmental area (VTA) during motivated bar press feeding in the monkey. Brain Res. 413:302- 313; 1987. Parada, M. A.; Parada, M. P.D.; Hoebel, B. G., Rats self-inject a dopamine antagonist in the lateral hypothalamus where it acts to increase extracellular dopamine in the nucleus accumbens. Pharma- col. Biochem. Behav. 52 (1):179-187; 1995. Phillips, A. G.; Fibiger, H. C., Decreased resistance to extinction after halopeddol: Implications for the role of dopamine in reinforcement. Pharmacol. Biochem. Behav. 10:751-761; 1979. Phillips, G. D.; Robbins, T. W.; Everitt, B. J., Bilateral intra- accumbens self-administration of d-amphetamine: Antagonism with intra-accumbens SCH-23390 and sulpiride. Psychopharmacol. 114:477-485; 1994. Packard, M. G.; Hirsh, R.; White, N. M., Differential effects of fornix and caudate nucleus lesions on two radial maze tasks: evidence for multiple memory systems. J. Neurosci. 9:1465-1472; 1991. Porter, J. H.; Villanueva, H. F., Assessment of pimozide's motor and hedonic effects on operant behavior in rats. Pharmacol. Biochem. Behav. 31:779-786; 1989. Posluns, D., An analysis of chlorpromazine-induced suppression of the avoidance response. Psychopharmacol. 3:361-373; 1962. Premack, D., Toward empirical behavior laws I: positive reinforcement. Psychot. Rev. 66:219-233; 1959. Radhakishun, F. S.; van Ree, J. M.; Westerink, B. H.C., Scheduled eating increases dopamine release in the nucleus accumbens of food- deprived rats as assessed with on-line brain dialysis. Neurosci. Lett. 85:35t-356; 1988. Rashotte, M. E.; Henderson, D., Coping with rising food costs in a closed economy: feeding behavior and nocturnal hypothermia in pigeons. J. Exp. Anal. Behav. 50:441-456; 1988. Rassnick, S.; Stinus, L.; Koob, G. F., The effects of 6- hydroxydo- pamine lesions of the nucleus accumbens and the mesolimbic dopamine system on oral self-administration of ethanol in the rat. Brain Res. 623:16-24; 1993. Rescorla, R. A., The role of information about the response-outcome relation in instrumental learning. J. Exp. Psychol. An. Behav. Prec. 16:262-270; 1990. Richardson, N. R., Change, A. Gratton, N. R., dopamine efflux in nucleus accumbens during operant responding for food: effects of reinforcement value and schedule. Soc. Neumsci. Abs. 20:822; 1994. Roberts, D. C. S.; Corcoran. M. E.; Fibiger, H. C., On the role of ascending catecholaminergic systems in intravenous self-administra- tion of cocaine. Pharmacol. Biochem. Behav. 6:615-620; 1977. 180. Robbins, T. W.; Koob, G. F., Selective disruption of displacement behaviour by lesions of the mesolimbic dopamine system. Nature 285:409-412; 1980. 181. Robinson, T. E.; Becker, J. B.; Young, E. Jk.; Akil, H.; Castenada, E., The effects of footshock stress on regional brain dopamine metabo- lism and pituitary beta-endorphin release in rats previously sensitized to amphetamine. Neuropharmaool. 26:679-691; 1987. 182. Robinson, T. F_,; Berridge, K. C., The neural basis of drug craving: an incentive-sensitization theory of addiction. Brain Res. Rev. 18:247- 291; 1993. 183. Roils, E. T.; Rolls, B. J.; Kelly, P. H.; Shaw, S. G.; Wood, R. J.; Dale, R., The relative attenuation of self-stimulation, eating and drinking produced by dopamine receptor blockade. Psychopharmacol. 38:219-230; 1974. 184. Sabol, K. E.; Neill, D. B.; Wages, S. A.; Church, W. H.; Justice, J. B., Dopamine depletion in a striatal subregion disrupts performance of a skilled motor task in the rat. Brain Res. 335:33-43; 1985. 185. Salamone, J. D., Different effects of haloperidul and extinction on instrumental behaviors. Psychophannacul. 88:18-23; 1986. 186. Salamone, J. D., The actions of neuroleptie drugs on appetitive instrumental behaviors. In Iversen L. L., Iversen S. D., Snyder S. H., eds. Handbook of Psychopharmacology. New York: Plenum Press;1987: 575-608. 187. Salamone, J. D., Dopaminergic involvement in activational aspects of motivation: effects of halopeddol on schedule-induced activity, feeding and foraging in rats. Psychobiol. 16:196-206; 1988. 188. Salamone, J. D., Behavioral pharmacology of dopamine systems: A new synthesis. In: Willner, P., Scheel-Kruger, J., eds., The Meso- limbic Dopamine System: From Motivation to Action. Cambridge, England: Cambridge University Press;1991: 599-613. 189. Salamone, J. D., Complex motor and sensorimotor functions of accumbens and striatal dopamine: Involvement in instrumental behavior processes. Psyehopharmaeol. 107:160-174; 1992. 190. Salamone, J. D., The involvement of nucleus accumbens dopamine in appetitive and aversive motivation. Behav Brain Res. 61:117-133; 1994. 191. Salamone, J. D., The behavioral neurochemistry of motivation: Methodological and conceptual issues in studies of the dynamic activity of nucleus accumbens dopamine. J. Neurosci. Meth. 64:137- 149 1996. 192. Salamone, J. D.; Cousins, M. S.; Bucher, S., Anhedonia or anergia? Effects of haloperidol and nucleus accumbens dopamine depletion on instrumental response selection in a T-maze cost/benefit procedure. Behav. Brain Res. 65:221-229, 1994. 193. Salamone, J. D.; Cousins, M. S.; Maio, C. Champion, M.; Turski, T.; Kovach, J., Different behavioral effects of haloperidol, clozapine and thioridazine in an instrumental lever pressing/feeding procedure. Psychopharmacol. 125:105-112; 1996. 194. Salamone, J. D.; Cousins, M. S.; McCullough, L. D.; Carriero, D. L.; Berkowitz, R. L., Nucleus accumbens dopamine release increases during instrumental lever pressing for food but not food consumption. Pharmacol. Biochem. Behav. 49:25-31; 1994. 195. Salamone, J. D.; Kurth, P. A.; McCullough, L. D.; Sokolowski, J. D., .The effects of nucleus accumbens dopamine depletions on continu- ously reinforced operant responding: contrasts with the effects of extinction. Pharmacol. Biochem. Behav. 50:437-443; 1995. 196. Salamone, J. D.; Kurth, P. A.; McCullot/gh, L. D.; Sokolowski, J. D.; Cousins, M. S., The role of brain dopamine in response initiation: effects of halopeddol and regionally-specific dopamine depletions on the local rate of instrumental responding. Brain Res. 628:218-226; 1993. 197. Salamone, J. D.; Mahan, K.; Rogers, S., Ventrolateral striatal dopamine depletions impair feeding and food handling in rats. Pharmacol. Biochem. Behav. 44:605-610; 1993. 198. Salamone, J. D.; Steinpreis, R. E.; McCullough, L. D.; Smith, P.; Grebel, D.; Mahan, K., Haloperidol and nucleus accumbens dopa- mine depletion suppress lever pressing for food but increase free food consumption in a novel food-choice procedure. Psychopharmacot. 104:515-521; 1991. 199. Salamone, J. D.; Zigmond, M. J.; Stdcker, E. M., Characterization of the impaired feeding behavior in rats given haloperidol or dopamine- depleting brain lesions. Neurosci. 39:17-24; 1990. 200. Samson, H. H.; Tolliver, G. A.; Haraguchi, M.; Kalivas, P. W., Effects of d-amphetamine injected into the nuclues accumbens on ethanol reinforced behavior. Brain Res. Bull. 27:267-27I; 1991.
Page 44: 2063633529 Log in for more options!
358 cotJs s AND 201. Sanger, D. J., Response decrement patterns after neurolepfie and non- neuroleptie drags. Psychopharmacol. 89:98-104; 1986. 202. Scatton, B.; D'Angio, M.; Driscoll, P.; Serrano, A., An in vivo voltammetric study of the response of mesocortical and mesoaccum= bens dopaminergic neurons to environmental stimuli in strains of rots with differing levels of emotionality. Ann. NY Acad. Sci. 537:124- 137; 1988. 203. Schneider, J. S., Basal ganglia role in behavior: importance of sensory gating and its relevance to psychiatry. Biol. Psychiat. 19:1693-1710; 1984. 204. Schneider, L. H.; Davis, J. D.; Watson, C. A.; Smith, G. P., Similar effects of raclopride and reduced sucrose concentration on the micmstmcture of sucrose sham feeding. Eur. J. Pharmacol. 186:61-70; 1990. 205. Schneider, L. H.; Gibbs, L; Smith, G. P., D-2 selective receptor antagonists suppress sucrose sham feeding in the rat. Brain Res. Bull. 17:605-61 l; 1986. 206. Schneider, L. H.; Watson, C. A.; Davis, J. D.; Smith, G. P., Microstructurai analysis of the inhibition of sucrose sham feeding by SCH 23390. Appetite 12:236; 1989. 207. Schultz, W., Responses of midbrain dopamine neurons to behavioral trigger stimuli in the monkey. J. Ncurophysiol. 56:1439-1461; 1986. 208. Schultz, W.; Apicella, P.; Ljungbcrg, T., Responses of monkey dopamine neurons to reward and conditioned stimuli during succes- sive steps of learning a delayed response task. J. Neurosci. 13:900- 913; 1993. 209. Schwab, R. S. and Zieper, I. Effects of mood, motivation, stress and altermess on the pcrforrnancc in Parkinson's disease. Psychiat. NeurobioL, 150:345-357; 1965. 210. Schwarting, R.; Carey, R. J., Deficits in inhibitory avoidanc, after neurotoxic lesions of the ventral striatum are neurochemieally and behaviorally selective. Behav. Brain Res. 18:279-283; 1985. 211. Smith, G. P., Dopamine and food reward. Prog. Psyehobiol. Physiol. Psychol. 16:83-144; 1995. 212. Sorg, B. A.; Kalivas, P. W., Effects of cocaine and footshock stress on extracellular dopamine levels in the ventral striatum. Brain Res. 559:29-36; 1991. 213. Spivak, K. J.; Amit, Z., Effects of pimozide on appetitive behavior and locomotor activity: dissimilarity of effects when compared to extinction. Physiol. Behav. 36:457-463; 1986. 214. Staddon, J. E. R., Operant behavior as adaptation to constraint. J. Exp. Psyehol. Gen. 108:48-67; 1979. 215. Staddon, J. E. R. Adaptive behavior and learning. Cambridge, England: Cambridge University Press; 1983.; 216. Steele, M. A.; Weigl, P. D., Energeties and patch use in the fox squirrel Sciurus niger: responses to variation in prey profitability and patch density. Am. Midl. Nat. 128:156-167; 1992. 217. Stefurak, T. L.; van der Kooy, D., Tegmental pedunculopontine lesions in rats decrease saccharin's rewarding effects but no its memory-improving effects. Behav. Neurosei. 108:972-980; 1994. 218. Stellar, J. R.; Kelley, A. E.; Corbett, D., Effects of peripheral and central dopamine blockade on lateral hypothalamie self-stimulation: evidence for both reward and motor deficits. Pharmacol. Biocbem. Behav. 18:433-442; 1983. 219. Stdcker, E. M.; Zigmond, M. J. Recovery of function after damage.to central catecholamine-containing neurons: A neuroehemieal model for the lateral hypothalamie syndrome. In: Sprague, J. M., ed., Progress in Psychobiology and Physiological Psychology. New York: Academic Press;1976: 121-173. 220. Swanson, L. W.; Mogenson, G. J.; Gerfen, C. R.; Robinson, P., Evidence for a projection from the lateral preoptic area and substantia innominata to the "mesencephalic locomotor region". Brain Res. 295:161-178; 1984. 221. Swerdlow, N. R.; Braff, D. L.; Taaid, N.; Geyer, M. A., Assessing the validity of an animal model of deficient sensodmntor gating in schizophrenic patients. Arch. Gen. Psychiat. 51:139-154; 1994. 222. Szechtman, H.; Talangbayan, H.; Ganaran, G.; Dal, H.; Eilam, D., Dynamics of behavioral sensitization induced by the dopamine agonist quinpirole and a proposed central energy control mechanism. Psychopharmacot. 115:95-104; 1994. 223. Taylor, J. R.; Robbins, T. W., 6-Hydroxydopamine lesions of the nucleus accumbens but not the candate nucleus attenuate responding with reward-related stimului produced by intm-accumbens d- amphetamine. Psychopharmacol. 90:390-397; 1986. 224. Teuber, H.-L.; Proctor, F., Some effects of basal ganglia lesions in subhuman primates and man. Neuropsychol. 2:85-93; 1964. 225. Thorndike, E. L. Animal Intelligence. New York Macmillan; 1911. 226. Timberlake, W., Behavior systems and reinforcement: an integrative approach. J. Exp. Analy. Behav. 60:105-128; 1993. 227. Timberlake, W.; Allison, J., Response deprivation: an empirical approach to instrumental performance. Psyehol. Rev. 81:146-164; 1974. 228. Tombaugh, T. N.; Anisman, H.; Tombangh, J., Extinction and dopamine receptor blockade after intermittent reinforcement train- ing: failure to observe functional equivalence. Psychopharmacol. 70:19-28; 1980. 229. Tombangh, T. N.; Szostak, C.; Mills, P., Failure of pimozide to disrupt acquisition of light-dark and spatial discrimination problems. Psychnpharmaeoi. 79:161-168; 1983. 230. Tombaugh, T. N.; Szostnk, C.; Voomeveld, P.; Tombaugh, J. W., Failure to obtain functional equivalence between dopamine receptor I i blockade and extinction: evidence supporting an sensory-motor conditioning hypothesis. Pharmacol. Biochem. Behav. 16:67-72; 1982. 23 I. Treit, D.; Bea--ridge, K. C., A comparison of benzodiazepine, seroto- nin, and dopamine agents in taste-reactivity paradigm. Pharmaeol. Biocbem. Behav. 37:451-456; 1990. 232. Ungerstedt, U., Aphagia and adipsia after 6-hydroxydopamine induced degeneration of the nigro-striatal dopamine system. Acta Physiol Seand. 82 (suppl 367):95-122; 1971. 233. Ungerstedt, U.; Ljungberg, T., Central dopamine neurons and sen- sory processing. J. Psychiat. Res. 55:149-150; 1974. 234. Wadenberg, M. L.; Ericson, E.; Magnusson, O.; Ahlenins, S., Suppression of conditioned avoidance behavior by the local appli- cation of (-)-sulpiride into the ventral, but not the dorsal, striatum of I i the rat. Biol. Psychiat. 28:297-307; 1990. 235. Weiner, I.; Feldon, J., Facilitation of latent inhibition by haloperidol in rats. Psyehopharmaeol. 91:248-253; 1987. 236. Whishaw, I. Q.; Koroelsen, R. A., Two types of motivation revealed by ibotenie acid nucleus accumbens lesions: dissociation of food carrying and hoarding and the role of primary and incentive motivation. Bchav. Brain Res. 55:283-295; 1993. 237. Whishaw, I. Q.; O'Connor, W. T.; Dunnctt, S. B., The contributions of motor cortex, nigrostriatal dopamine and candate-putamcn to skilled forelimb use in the rat. Brain 109:805-843; 1986. 238. White,, I. M.; Ciancone, M. T.; Haraez, J. L.; Rebec, G. V., A lever- release version of the conditioned avoidance paradigm: Effects of haloperidol, clozapine, sulpiride and BMY-14802. Pharmacol. Bio- chem. Behav. 41:29-35; 1991. 239. White, N. M., Control of sensorimotor functions by dopaminergic nigrostriatal neurons: influence on eating and drinking. Neurosci. Biobehav. Rev. 10:15-36; 1986. 240. Wicscnfeld, Z.; Halpern, B. P.; Tapper, D. N., Licking behavior: evidence of a hypoglossal oscillator. Science 196:1122-1124; 1977. 241. Williams, B. A. Reinforcement, choice, and response strength. In Atkinson, R. C., Herrnstein, R. J., Lindzey, G., Lute, R. D. (eds.) Stevens' Handbook of Experimental Psychology, v.2; New York: John Wiley and Sons;1988:167-244. 242. Wiliner, P., Dopamine and depression: a review of recent evidence 11: theoretical approaches. Brain Res. 6:225-236; 1983. 243. WHiner, P. Depression: A Psychobiological Synthesis. New York: Wiley; 1985.; 244. Willner, P.; Chawala, K.; ~ampson, D.; Sophokleons, S.; Muscat, R., Tests of functional equivalence between pimozide pretreatment, extinction and free feeding. Psychopharmacol. 95:423-426; 1988. 245. Wilson, C.; Nomikos, G. G.; Collu, M.; Fibiger, H. C., Dopaminergic correlates of motivated behavior: importance of drive. J. Neurosci. 15:5169-5178; 1995. 246. Winn, P.; Robbins, T. W., Comparative effects of infusions of 6- hydroxydopamine into nucleus accumbcns and anterolateral hyl~)- thalamus induced by 6-hydroxydopamine on the response to dopa- mine agonists, body weight, locomotor activity and measures of exploration in the rat. Neuropharmacol. 24:25-31; 1985. 247. Wise, R. A., Catecholaminc theories of reward: a critical review. Brain Res. 152:215-247; 1978. 248. Wise, R. A., Neuroleptics and operant behavior: the anhedonia hypothesis. Behav. Brain Sci. 5:39-87; 1982. 249. Wise, R. A., The anhedonia hypothesis: mark IlL Behav. Brain Sci. 8:178-186; 1985. 250. Wise, R. A.; Bozarth, M. A., A psychomotor stimulant theory of addiction. Psychol. Rev. 94:469-492; 1987.
Page 45: 2063633530 Log in for more options!
rg~,c , )pa - rv. ot' [" it-~,. BEHAVIORAL FUNCTIONS OF NUCLEUS ACCUMBENS DOPAMINE 359 251. Wise, R. A.; Colle, L. M., Pimozide attenuates free feeding: best scores analysis reveals a motivational deficit. Psychopbarmacol. 84:446-45l; 1984. 252. Wise, R. A.; Raptis, L., Effects of pre-feeding on food-approach latency and food consumption speed in food deprived rats. Physiol. Behav. 35:961-963; 1985. 253. Wise, R. A.; Spindler, J.; De Witt, H.; Gerber, G. J., Neuroleptic- induced "anhedonia" in rats: pimozide blocks reward quality of food. Science 201:262-264; 1978. 254. Wise, R. A.; Spindler, J.; Legult, L., Major attenuation of food reward with performance-sparing doses of pimozide in the rat. Can. J. Psychol. 32:77-85; 1978. 255. Wolterink, G.; Phillips, G.; Cador, M.; Donselaar-Woltednk, I.; Robbins, T. W.; Everitt, B. J., Relative roles of ventral striatal D1 and D2 dopamine receptors in responding with conditioned reinforcement. Psychopharmacol. 110:264-355; 1993. 256. Yang, C. R.; Mogenson, G. J., Electrophysiological responses of neurons in the nucleus accumbens to hippocampal stimulation and the attenuation of the excitatory responses by the mesolimbic dopaminergic system. Brain Res. 324:69-84; 1984. 257. Yang, C. R.; Mogenson, G. J., Hippocarnpal signal transmission to the pedunculopontine nucleus and its regulation by dopamine D-2 receptors in the nucleus accumbens: An electrophysiological and behavioral study. Neurosci. 23:1041-1055; 1987. 258. Yim, (2. Y.; Mogenson, G. J., Responses of nucleus accumbens neurons to amygdala stimulation and its modification by dopamine. Brain Res. 239:401-405; 1982. 259. Yoshida, M.; Yokoo, H.; Mizoguchi, K.; Kawahara, H.; Tsuda, A.; Nishikawa, T.; Tanaka, M., Eating and drinking cause increased dopamine release in the nucleus accubens and ventral tegmental area in the rat: Measurement by in vivo microdialysis. Neurosci. Lett. 139:73-76; 1992. 260. Young, A. M. J.; Joseph, M. H.; Gray, J. A., Latent inhibition of conditioned dopamine release in rat nucleus accumbens. Neurosci. 54:5-9; 1993. 261. Young, P. T. Motivation and Emotion. New York: John Wiley & Sons; 1961. 262. Zahm, D. S.; Brog, L S., On the significance ofsubterritories in the • 'accumbens" part of the rat ventral striatum. Neurosci. 50:751-767; 1992. 263. Zahm, D. S.; Heimer, L., Two transpallidal pathways originating in the rat nucleus accumbens. J. Comp. Neurol. 302:437-446; 1990. 264. Zeigler, H. P., Trigeminal deafferentation and hunger in the pigeon (Columba livia). J. Comp. Physiol. Psychol. 89:827-844; 1975. 265. Zeigler, H. P.; Jaequin, M. F.; Miller, M. G., Trigeminal orosensation and injestive behavior in the rat. Prog. PsychobioL Physiol. Psychol. 11:63-196; 1985. 266. Zeigler, H. P.; Miller, M. M.; Levine, R. R., Trigeminal nerve and eating in the pigeon (Columba livia): neurosensory control of the consummatory response. J. Comp. Physiol. Psychol. 89:845-858; 1975. 267. Zipf, G. K. Human Behavior and the Principle of Least Effort. Cambridge, MA: Addison-Wesley Press; 1949.
Page 46: 2063633531 Log in for more options!
206363353
Page 47: 2063633532 Log in for more options!
~ram (1997) rained with relationship ttation Res. :cogitations me aberra- ~ Research, romosomal ical Report es, Science • MN from uman lym- od, Radiat. Effect of ,n analysis 4- 1-47. -'thotrexate 57 (1975) I~UTAT RES-GEN TOX EH 97 (C)ELSEVlER SCIEHOE BV HE ELSEVIER Mutation Research 391 (1997) 99-1 I0 Genetic Tox~cotogy and Environmental Mulagenesis The use of a urine mutagenicity assay in the monitoring of environmental exposure to genotoxins v Milena Cerna a,*, Anna Pastorkovfi a, Steven R. Myers b, Pavel R~Sssner Blanka Binkov~ c ~ National Institute of Public Health, Division of Environmental Health, ~robrrot'a 48, 100 42 Prague, Czech Republic b Universi~. of Louisville, School of Medicine, Department of Pharmacology and Toxicology, Louisville, KY 40292, USA hzstitute of ~rperimental Medicine, Academy of Sciences of the Czech Repttblic and Regional Institute of Hygiene of Central Bohemia, Wdehsk6 1083, 142 20 Prague, Czech Republic Received 3 December 1996; revised 12 February 1997; accepted 12 February 1997 ) 47-53. Abstract Urinary bacterial mutagenicity was used as a biomarker of exposure to ambient air pollution in a group of women working outdoors in the city of Teplice (TP; Northern Bohemia) with higher levels of air pollution than a similar group of women in the city of Prachatice (PT; Southern Bohemia). The Sabnonella ~.'phhnurium plate incorporation assay with the TA98 and YGI041 strains and microsuspension assay with the YGI041 strain were used for testing the urinary mutagenicity. PAH and their metabolites were analyzed by HPLC and GC/MS methods. The significantly higher values of most PAHs/metabolites detected in a TP group confirmed the differences of PAH exposures between both ~oups. In the plate incorporation assay, the TA98 strain was not able to detect the increase in urinary mutagenicity, but, for the YGI041 strain, the urinary mutagenicity was clearly determined with a significant difference in number of ĄG1041 + $9 revertants between the TP and PT groups. The microsuspension assay increased the mean response by about 10-fold over the standard plate test; however, no statistical difference between TP and PT groups was found due to high interindividual variability and small sample size. Comparing the urinary PAH/metabolites to urinary mutagenicity, significant correlations were observed between the plate incorporation mutagenicity results with the YGI04I revertants in the presence of metabolic activation and several of the urinary PAH/metabolites. On the contrary, in the microsuspension assay, several urinary PAH/metabolites correlated significantly with the YGI041 revertants only in the absence of metabolic activation. This may indicate the influence of different treatment conditions of assays on the urinary mutagenicity results. The results suggest the insufficient sensitivity of the TA98 tester strain to determinate low urinary level of mutagens. On the contrary, the use of the YGI041 tester strain increases the probability of detecting an effect of environmental exposure and seems to be applicable to biological monitoring. To definitely replace the standard plate incorporation assay with the microsuspension method is not possible without further comparative studies. Keywords: Biomonitoring; Ambient air exposure; Polycyclic aromatic hydrocarbon: Metab0iite: Urinary mutagenicity; Ames test; Kado assay; YG tester strain Corresponding author. Tel.: +42 (2) 6708-2378; Fax: +42 (2) 6708-2378. 1383-5718/97/$17.00 Copyright tD 1997 Elsevier Science B.V. All rights reserved. PII SI383-5718(97)00058-2 THIS ARTICLE 15 FOR IHDZVIDUAL USE OHLY AHD HAY HOT BE FURTHER REPRODUCED OR STORED ELECTRONICALLY ~ZTHOUT ~RZTTEN PER~ISSIOH FRO~ THE COPYRIGHT HOLDER. UHAUTHORZZE9 REPRODUCTIOH HAY RESULT ZN FINANCIAL AND OTHER pEHALTXES.
Page 48: 2063633533 Log in for more options!
Ioo M. ~ernd et al. / Mutation Research 391 (1997) 99-/10 1. Introduction Exposure to genotoxic substances in the environ- ment is frequently viewed as a major risk factor to human health. To assess the risk, it is necessary to obtain biologically relevant exposure data. Different biological monitoring techniques have frequently been used for the evaluation of exposure to geno- toxic chemicals or their biologically effective dose Ill, Urine mutagenicity assessment is one of these traditional biomarker tools. The bacterial mutagenic- ity test (Ames test) has been most frequently used as a short-term test for about 20 years for this purpose [2,31. The first reports indicated the presence of muta- genicity in the urine of patients treated with either cytostatics [4] or other therapeutic agents, e.g., metronidazole [5]. Urine mutagenicity tests have since been often applied to monitor occupational exposure to genotoxic chemicals in different work- places [6]. Some of these studies suggested that urinary mutagen levels reflected occupational expo- sure to genotoxic carcinogens, whereas others em- phasized the importance of possible interference with many confounding factors not related to definite occupational exposure, like active or passive smok- ing, diet, drugs, and hobbies, which lowered the detectability of defined occupational exposure. The use of urine mutagenicity testing for monitor- ing human exposure to genotoxins from the general environment depends on the careful consideration of confounding exposures, given that the concentrations of mutagenic compounds in the environment are substantially lower than in occupational exposures. Urinary mutagen levels may also reflect complex exposure related to personal habits and lifestyle in addition to mutagenic pollutants in the environment [7]. Ho~'ever, the sensitivity of the urine mutagenic- ity test can be increased by using a microsuspension assay modification [8] and recently developed YG indicator strains capable of detecting mutagenic metabolites formed from nitroarenes and aromatic amines [9]. The aim of this study was to evaluate exposure to genotoxic contaminants in the environment by the means of both urinary mutagenicity assays (plate incorporation and microsuspension). The urinary mu- tagenicity assay results were completed with the results of the analysis of urinary polycyclic aromatic hydrocarbons (PAHs) and their metabolites per- formed in the same urine samples. The study subjects were from the city of Teplice" (TP) located in an area of Northern Bohemia pol- luted by brown coal combustion (annual average of air pollution data in ~xg/m3: SO2, 62.9; NO.,, 80; TSP, 110). A comparative group of subjects was from the city of Prachatice (PT) with a lower annual average of air pollution (SO2, 21.6; NO.~, 19.7; TSP, 38.5). The study was conducted within the Teplice Program [ 10]. 2. Materials and methods 2.1. Subjects and sampling A group of 30 healthy women with approximately 6 h of daily outdoor work exposure (postal workers, gardeners, nursery school teachers), aged 20-50 years and residents of the district for at least 5 years, was selected in each district. Prior to beginning the study, the informed consent of each subject was obtained. A qfiestionnaire was administered to each subject to determine their individual life style. The results of personal exposure monitoring (the last week in November, 1992 for TP, the first week in December, 1992 for PT) are presented elsewhere [10]. Spot urine samples from each person were col- lected twice: at the end of the working day and the next morning at the end of the personal exposure monitoring. The aliquots for the PAH metabolite analysis were separated. For the urinary mutagenicity analysis, both urine samples were pooled. Urinary creatinine was evaluated by the modification of the Jaffe colorimetric method [11]. All samples were stored frozen in polypropylene bottles until analysis. 2.2. Urinary. PAH metabolite analysis PAH and their metabolites were analyzed by high-performance liquid chromatography (HPLC) and gas chromatography/mass spectrometry (GC/MS). The method is briefly summarized here. Urine aliquots (5-7 ml) were adjusted to pH 5.0, incubated with 13-glucuronidase/arylsulphatase. The metabo cartrid~ of mett and the extractt reverse metabo metabo and ev: analysi The quantit; using ~ Table I Standar~d Sample I 9 10 14 15 16
Page 49: 2063633534 Log in for more options!
lic aromatic ~olites per- of Teplice .hernia pol- average of NO.~, 80; bjects was wet annual 19.7; TSP, he Teplice !1 !| !1 !1 M. ~emd et aL/ Mutation Research 391 (1997) 99- I I0 101 metabolites were extracted using the Sep-Pak Ct8 cartridges (Waters, Milford, MA), eluted with 10 ml of methanol and evaporated at 60°C under nitrogen and the residue was dissolved in 200 Ixl methanol for HPLC and GC/MS analyses. The aliquots of the extracted metabolites (2-5 ~zl) were analyzed by reversed-phase HPLC. The scanning fluorescent detector was programmed to detect the specific metabolites quantitated. The individual PAH/ metabolites fractionated by HPLC were collected and evaporated to dryness under nitrogen prior to the analysis by GC/MS selective ion monitoring (SIM). The PAH/metabolite data reported here were quantitated by three separate determinations each using both HPLC and GC/MS/SIM and the mean v,qlues are reported as ng of PAH metabolite per mg creatinine. 2.3. Urinar3' mutagenici~. Fifty-two urine samples obtained from 20 non- smokers and 8 smokers (3-20 cigarettes/day) from Teplice, and from 24 non-smokers from Prachatice, were tested for mutagenicity in the plate incorpora- -tion assay. Two samples from TP and 6 samples from PT were excluded because of the insufficient amount of urine. The urine samples were thawed at room tempera- ture and filtered through a paper filter. One hundred and fifty millilitres of each sample was incubated Table 1 Standard plating test: individual mutagenicity results in the Teplice group "oximately 1 workers, Sample 'd 20-50 i in°'ars, . Smoking status TA98 - $9 TA98 + $9 YGI041 L $9 YGI041 + $9 Rev/ml Rev/mg Rev/ml Rev/mg urine creatinine urine creatinine Rev/ml Rev/mg Rev/ml Rev/mg urine creatinine urine creatinine the 1 2 ~ject was ! - I3 d to each 4 tyle. The 5 (the last I6 week in ~- 7 ;Isewhere il . 8 9 10 ,' and the 12 exposure 14 15 ,etabolite ~__i 16 agenicity 17 Urinary ' 19 ,n of the 20 es were 22 analysis. 23 24 26 27 • zed by 28 (HPLC) 29 ometry ~!ili 30 n 1.4 0.7 0.7 0.4 n 1.2 0.5 1.5 0.6 n ND ND 1.3 1.7 n ND ND ND ND n 0.2 0.1 0.8 0.2 s/15 a 5.0 4.2 2.3 1.9 n ND ND 2.2 ! .9 s / 10 1.6 0.5 0.6 0.2 n ND ND ND ND s/15 1.1 0.7 0.1 0.1 s/20 3.7 2.2 2.8 1.7 n ND ND ND ND n 0.3 0.4 0.2 0.3 s/7 ND ND ND ND n 0.3 0.4 ND ND n 0.6 0.2 1.5 0.6 n 3.0 1.6 3.4 1.8 n ND 0.03 0.02 0.01 n 0.04 0.03 0.5 0.5 n 1.6 1.7 0.04 0.05 s/10 ND ND 1.6 0.8 n 1.5 0.8 0.9 0.5 n 2.0 1.1 2.6 1.5 n 2.1 2.0 0.6 0.5 n ND ND 0.8 0.7 s/10 ND ND 0.4 0.6 s/8 0.3 0.4 t.8 2.5 n 0.5 11.6 0.5 0.6 ND ND 5.7 3.0 5.6 2.1 ND ND - ND ND 5.8 7.6 ND ND 3.3 2.5 ND ND ND ND 2.7 2.3 11.3 9.4 ND ND 5.1 4.5 11.9 4.0 7.9 2.6 ND ND 1. I 0.9 ND ND 11.3 7.1 ND ND 19.6 11.8 1.4 1.3 22.0 20.0 53.8 61.1 32.3 36.7 4.9 6.7 2.8 3.9 ND ND 19.6 25.1 2.3 1.0 4.2 1.7 20.5 11.0 2.6 1.4 ND ND 19.8 13.5 10.1 8.8 9.6 8.4 2.1 2.3 33.4 37.3 ND ND 54.3 28.3 0.9 0.5 15.3 8.3 61.0 35.1 67.2 38.7 ND ND 6.5 6.0 ND ND ND ND 1.0 1.6 8.2 13.0 3.8 5.2 19,4 26.5 ND ND ND ND Bold values indicate statistically significant, " n cigarettes/day. B~-- linear slope values ( p < 0.05). ND, no dose-response effect observed.
Page 50: 2063633535 Log in for more options!
102 M. ~ernd et al. / Mutation Research 391 (1997) 99- 110 with 50 U/ml of [3-glucuronidase/arylsulphatase. (Sigma) for 3 h at 37°C. After the incubation, the mutagens were separated and concentrated by pass- ing the urine through 6 ml C18 (octadecyl) resin columns using a vacuum manifold (Baker 12) system [12]. Methanol (8 ml) was used to extract the muta- gens, the volume normalized to 10 ml with methanol and stored frozen at -20°C. 2.4. Bioassay sample preparation For the plate incorporation mutagenicity assay, the extractable mass dissolved in 10 ml of methanol was evaporated under a stream of nitrogen to near dryness and solvent exchanged into dimethylsulph- oxide (DMSO) (Merck) to give 10 IAI DMSO per ml bioassay vial containing 5 I~1 of DMSO each. Methanol was evaporated under nitrogen in a water bath at 35°C to dryness. 2.5. Mutagenicity assays The plate incorporation assay was carried out as described [13] with the Salmonella o'phimurium tester strains TA98, kindly provided by Prof. B.N. Ames (Berkeley, CA, USA) and YGI041, a deriva- tive of the TA98 parent.strain with elevated levels of both nitroreductase and O-acetyltransferase activi- ties, kindly donated by Drs. T. Nohmi and M. Watanabe (National Institute of Hygienic Sciences, Japan) It4]. The microsuspension assay was con- ducted using the strain YG1041 only. Both assays before b mixture The pro TA98, [ 1 ovemigI ampicill added tt the sele In tl were te: control~ crolitre: urine e: of the ~ molten urine. For the microsuspension mutagenicity assay, doses of methanol extract corresponding to 0.25, 0.5, 1.5 and 3 ml of urine volume were pipetted into the Table 2 Standard plating test: individual mutagenicity results in the Prachatice group were performed with and without metabolic activa- plates. tion using a liver $9 fraction for metabolic activation [" I The which was prepared from male rats pretreated 5 days .. YG1041-$9 YG1041÷$9 [il I ~ Rev/ml Rev/mg Rev/ml Rev/mg __ urine creatinine urine creatinine c Summar2. test! TA98 ~ YGIO,! Sample Smoking no. status TA98-$9 TA98 + $9 Rev/ml Rev/mg Rev/ml Rev/mg urine creatinine urine creatinine 31 n 0.1 0.1 0.7 0.4 ND ND ND 32 n 0.3 0.2 3.7 2.5 ND ND ND 34 n ND ND ND ND ND ND ND 35 n 2.9 1.2 0.05 0.02 ND ND 7.6 36 n 0.5 0.7 0.I 0.1 ND ND ND 37 n 1.3 0.7 1~ 0.6 3.0 1.5 0.2 38 n 0.1 0.1 0.1 0.1 ND ND ~.1 39 n 2.6 1.8 1.6 1.0 ND ND ND ~ n 0.1 0.1 1.7 2.4 ND ND ND 41 n ND ND 0.1 0.1 7.5 6.8 43 42 n 0.6 0.4 1.3 0.7 13.0 7.3 1.8 43 n 2.9 3.9 0.9 1.3 0.3 0.3 0.~ 46 n 2.9 3.0 0.1 0.1 &9 9.0 12.4 47 n ND ND 0.2 0.1 3.0 1.5 8.0 48 n 2.9 2.4 0.2 0.2 ND ND ND ~ n 2.2 1.4 0.5 0.3 8.0 4.8 2.4 51 n 0.I 0.5 0.6 2.3 ND ND l.l 52 n 0.5 0.4 03 ~2 48.0 36.6 0.7 53 n ND ND 0.2 0.2 ND ND 6.3 55 n 0.4 0.2 0.3 0.2 ND ND 12.5 56 n 1.9 0.9 ND ND ND ND 0.8 57 n 1.7 1.4 0.7 0.5 I.I 0.9 9.4 58 n 0.3 0.3 0.8 0.7 ND ND 3.9 60 n 1.2 1.0 2.9 2.3 ND ND ND Bold values indicate statistically significant B~ - linear slope values ( p < 0.05). ND. no dose-response effect observed. ND ND ND 3.1 ND 0.1 81.2 ND ND 3.9 1.0 0.04 12.6 4.1 ND 1.5 4.2 0.6 9.9 6.3 0.4 7.5 3.6 ND "-- Micros~ YGI0 a Mean ~ Medi: " I c The r _ t~ :• _a Signi
Page 51: 2063633536 Log in for more options!
in a water || ied out as 'himuriurn~l 'rof. B.N. a deriva- levels°f I i ~e activi- and M. " Sciences, vas con- hassays I I c actiVa- ctivation d5days ! ! nine M. ~ern6 et al. / Mutation Research 391 (1997) 99-110 103 before being killed with 500 mg/kg Delor 103 (PCB mixture comparable to Aroclor 1254) in corn oil. The protein concentration [15] was 22.6 mg/ml. For TA98, ampicillin (25 lxg/ml) was added to the overnight culture in Oxoid II nutrient broth. Both ampicillin and kanamycin (25 ixg/ml of each) were added to the cultivation medium for YGI041 to keep the selective pressure on the YG1041 strain. In the plate incorporation assay, urine extracts were tested in duplicate at 4 doses corresponding to 1, 3, 7 and 10 ml of urine. All positive and negative controls were tested in triplicate. One hundred mi- crolitres of the tester strain, 100 p~l of each dose of urine extract and 500/~1 of $9 mix containing 30 I~1 of the $9 fraction/ml $9 mix were added to 2 ml of molten top agar and overlaid onto minimal agar plates. The microsuspension assay was performed with modification [i6]. The YG1041 cells were concen- trated (5 × ) by centrifugation (10000 × g, 4°C, 10 min) and resuspended in an ice-cold phosphate- buffer. Doses of 0.25, 0.5, 1.5 and 3 ml equivalent of urine were used with duplicate determination for urine extracts and triplicate for controls. To the glass tubes containing 5 p~l of DMSO urine extract, 50 ~1 of concentrated strain, and 50 p,l of $9 mix (or 0.015 M. sodium phosphate buffer) were added. After the suspension was preincubated at 37°C for 90 rain, 2 ml of top agar was added and the content of the tube poured onto minimal medium. The mean values of revertants/plate in the nega- tive control (DMSO) for the plate incorporation as- say were as follows: 15.4 (TA98 - $9), 15.7 (TA98 + $9), 119.9 (ĄG1041 - $9) and 100 (YG1041 + $9). The positive control without metabolic activa- tion (p-nitro-o-phenylenediamine, 10 tzg/plate) Table 3 Summary ~tatistics (means, medians and ranges) for urinary mutagenicity data (rev/mg creatinine) in plate incorporation and microsuspen- sion tests Strains Teplice smokers Teplice non-smokers Prachatice non-smokers (n = 8) (n = 20) (n = 24). Plate incorporation test TA98 - $9 1.0 5:1.47 a 0.52 ± 0.63 0.86 + 1,02 0.475 (0.0-4.2) b 0.315 (0.0-2.0) 0,45 (0.0-3.9) 3/5 ˘ 5/15 4/20 TA98 + $9 0.98 5:0.94 0.59 + 0.63 0.68 5:0.83 0.72 (0.0-2.5) 0.49 (0.0-1.9) 0.275 (0.0-2.5) 1/7 4/16 2/22 YG1041 - $9 2.48 + 2.60 6.16 + 15.24 2.87 + 7.67 1.92 (0.0-6.7) 0.0 (0.0-61.1) 0.0 (0.0-36.6) 3/5 11/9 15/9 YGI041 + $9 12.85 5:9.67 10,78 5:13,37 5,83 5:16,43 a 10.63 (2.6-28.3) 5.23 (0.0-38.7) 0.79 (0.0-81.2) 0/8 3/17 8/16 Microsuspension test YGI041 - $9 192.03 5:134.32 86.15 5:128.32 115.91 + 126.67 238,2 (3.3-338.9) 36.61 (2.4-419.3) 70.66 (0.5-434.3) o/5 o/14 o/18 YGI041 + $9 109.46 5:61.88 70.86 + 120.03 86.21 + 133.99 117.4 (36.3-187.4) 21.28 (0.0-409.0) 41.73 (0.0-502) 0/5 2/12 2/16 Mean + SD, Median (minimum-maximum). The relation between the number of samples without and with mutagenic responses. Significant difference between Prachatice and Teplice (whole group p = 0.010, non-smokers p = 0.086).
Page 52: 2063633537 Log in for more options!
r 104 M. ~ern6 et aL / Mutation Research 391 (1997) 99-/I0 gave 407.4 and 1662 rev/plate, with metabolic acti- vation (2-aminofluorene 5 ~zg/plate) 848.2 and 925.6 rev/plate in TA98 and YG1041, respectively. For the microsuspension assay, the negative con- trol revertants/plate were as follows: YGI041 with- out $9 143.2, YGI04I with $9 143.0. The positive control without metabolic activation (p-nitro-o- phenylenediamine, 1 ~g/plate) were 549 and with metabolic activation (2-aminofluorene, 5 ~g/plate) 535 revertants/plate. The revertafits were counted after 72-h incubation at 37°C using a Biotran II colony counter. 2.6. Statistics The maximum mutagenic potency (rev/ml urine) was determined using the GeneTox manager soft- . ware [17]. To correct for interindividual differences Table 4 Microsuspension in urine volume, the creatinine content of the urine was used to determine the mutagenic activity in revertants per mg creatinine. The linear slope values (Bt) for both rev/ml urine and rev/mg creatinine were calculated from Bernstein model [18]. Statistical analysis was performed on the B1 slope values using the STATGRAPHICS Plus 7.0 package (Magnuistics, Rockville, MD). Non-parametric methods (The Mann-Whitney rank sum U-test and Kruskall-Wallis one-way analysis of variance) were genici chosen for the data that did not follow a normal distribution. Correlations were performed by the Spearman rank correlation test. The statistical significance for differences in num- ber of positive responses (defined as B, GeneTox value with p < 0.05) was assessed by ANOVA Pro- gram. assay: individual mmagenicity results in the Teplice group Sample Smoking YGI041 - $9 YGI041 + $9 Rev/mt urine Rev/mg creatinine Rev/ml urine Rev/mg creatinine I n NT NT NT NT 2 n NT NT NT NT 3 n 51.9 68.3 33.1 43.4 4 n NT NT NT "NT 5 n NT NT biT NT 6 s/15 a NT NT NT NT 7 n 60.3 53.3 44.2 39.2 8 s/10 NT NT NT NT 9 n 21.5 17.9 bit NT 10 s/15 NT NT NT NT I 1 s/20 5.4 3,3 99.2 59.8 12 n 55.0 50.5 22.0 20.0 14 n NT NT NT NT 15 s/7 194.4 270.0 84.5 117.4 16 n 244.6 310.6 NT NT 17 n 30. I 12.4 42.4 17.4 19 n 6.0 3.3 94.9 50,9 20 n 8.7 5.9 10.8 7.3 21 n 479.4 419.3 128.2 ! 12.2 22 n 161.8 179.5 368.6 409.0 23 s/10 650.6 338.9 281.20 146.4 24 n 4.3 24 0.5 0.3 25 n NT NT NT NT 26 n 49. l 45.0 292,0 265,4 27 n I 1.3 9.6 26.5 22.5 28 s/10 150.6 238.2 118.2 187.4 29 s/8 811.4 109.8 26.8 36.3 30 n 27.5 28.3 4.3 4.5 (roum Iand r expre: with iwitho predi,_ consI~ ity e,- preset genic Slight Bold values indicate statistically significant B~ ~ n cigarettes/day. - linear slope values ( p < 0.05). NT. not tested: NDI no dose-response effect observed.
Page 53: 2063633538 Log in for more options!
M. ~ernd et al. / Mutation Research 391 (1997) 99-110 105 : activity in slope values 3.1. Plate incorporation assay ~gcreatinine iI [~ 18]. Tables 1 and 2 show the individual urine muta- the Bt slope genicity results expressed as linear slope values 7.0 package , (round to one decimal point) for revertants per ml 1-parametric 1 ![ and revertants per mg creatinine. The two ways ~ U-test and expressing the urinary mutagenicity correlated well =iance) were with each other (r=0.998- 1.000). The results 'v a normal 1 !1 without any dose response, where the maximum ~ed by the predicted potency was not possible to count, were considered to be negative. ces in hum- The summary data concerning urinary mutagenic- ', GeneTox ! II ity expressed as revertants per mg creatinine are '~'OVA Pro-~ presented in Table 3. Only the .results with muta- genic responses were included in the statistics. ii il Slightly higher mean and median numbers of TA98 Microst 32 i! -[ 136353437 40 41 revertants both with and without metabolic activation observed in the group of Teplice smokers were not statistically significant as compared to the Teplice or Prachatice non-smoker groups. A higher average number of induced revertants obtained with the. YG1041 strain compared to the TA98 results (about one order of magnitude difference) indicates an in- creased capability of the YG1041 strain to detect urine mutagenicity in environmentally exposed groups. This fact was supported by the finding that the mean number of YG1041 + $9 revertants in the PT group was significantly lower in comparison to the whole TP (p=0.0t0) as well as to the TP non-smokers (p =0.086). YGI041- $9 revertants correlated with YG1041 + $9 results for the whole group (r = 0.295, p = 0.0350) as well as for the non-smokers (r=0.330, p =0.0304 in the Spear- man rank correlation test. observed. Microsuspension assay: individual mutagenicity results in the Prachatice group Smoking YG 1041 - $9 Rev/ml urine n 18.5 n 0.7 n 69.1 n 72.1 n 312.7 n NT n 13.4 n NT n 25.7 n NT n 61.3 n 161.9 n NT n 217.6 n NT n 181.6 YGI041 + $9 Rev/mg creatinine Rev/ml urine Rev/mg creatinine ,!~'[14243 46 47 [-ll 48 50 n N'T I1 51 n 80.3 t -, 52 n 137.1 53 n 186.1 55 n NT 56 n 2.3 58 n 234.4. ~L~._ 60 n 94.9 I1 Bold values indicate statistically significant | 9.7 75.1 39.3 0.5 11.9 8.2 68.1 80.2 79.1 29.8 61.2 25.2 434.3 30.6 42.5 NT NT bit 19.1 10.6 15.0 bit NT t'Wl" 35.8 NT NT 34.4 39.5 22.3 217.0 374.5 502.0 NT NT NT 111.3 80.9 41.4 NT NT NT 109.3 306.1 184.2 NT NT NT 316.3 ND ND 104.9 77.8 59.5 290.7 228.5 357.0 NT NT NT 1.1 85.3 42.1 18.1 89.4 71.3 212.8 16.5 15.1 73.2 62.0 47.6 linear slope values (p < 0.05). NT, not tested. ND, no dose-response effect observed.
Page 54: 2063633539 Log in for more options!
106 M. ~ern6 et al. / Mutation Research 391 (1997) 99-110 3.2. Microsuspension assay Due to insufficient volumes of urine specimens, only a limited number of urine samples were tested using the YG1041 tester strain only (Tables 4 and 5). Most of individual mutagenicity results were signifi- cant according to the B1 GeneTox linear slope value, but the values show large interindividual variances. The increase in mutagenicity started at a lower urine volume/plate than in the standard plate test and at higher urine volumes, toxic effect were often ob- served. The mean numbers of induced revertants are about l0 times higher when compared to the plate incorporation test results (Table 3). Neither quantita- tive nor qualitative differences in the microsuspen- sion assay results between the Teplice and Prachatice groups were found. The Spearman rank correlation between the YG1041 - $9 and YG1041 + $9 results revealed a statistical significance for all the overall study (r = 0.377, p -- 0.024) as well as for all non- smokers (r = 0.339, p = 0.059). Besides this, signif- icant correlation was observed between the YGI041 -$9 revertants in plate incorporation and the YG1041 + $9 revertants in Kado assays for both the overall study (r=0.341, p =0.041) and the non- smokers (r = 0.378, p = 0.035). 3.3. PAH / metabolites The data reported here (Table 6) include four parent.PAHs: chrysene, benzo{a]pyrene, dibenz[a, h]anthracene, pyrene and their hydroxylated metabo- lites, and the total of 29 PAH/metabolites. The comparison of the PAH metabolites and parent PAH in urine between the TP and PT overall groups, as well as between TP and PT non-smokers, showed significant differences for total PAH/metabolites and for some parent PAHs (chrysene, benzo[a]pyrene, pyrene) and their metabolites (l-hy- droxypyrene, l-hydroxychrysene). There was no sig- nificant difference between the smokers and non- smokers in Teplice in excretion of PAHs or PAH metabolites. Table 6 Summary of statistics (means, medians and ranges) for urinary PAH/metabolites (ng/mg'creatinine) Teplice smokers Teplice non-smokers Prachatice non-smokers (n = 8) (n = 20) (n = 24) Total PAH/total metabolites d 236.80 + 103.1 a 230.80 + 71.8 126.30 + 39.2 207.40 b (123.3-418) ~ 241.80 (96-357) 131.30 (60-215) Benzo[a]pyrene 7.16 + 4.36 5.37 + 5.76 3.05 + 1.59 5.38 (2.7-15) 5.12 (1.6-21.7) 2.78 e (0.5-7.0) Chrysene 17.51 5:10.89 13.86 5:7.87 6.46 5:3.33 16.23 (5.3-32.7) 14.07 (1.7-35) 6.18 e (1.2-17.5) Dibenz[ a,h]anthracene 3.03 5:2.38 3.07 5:2.64 1.28 5:0.84 2.82 (0.4-7.8) 2.47 (0.6-12.5) 1.15 ~ (0.2-3.5) Pyrene 5.50 + 5.10 14.27 + 10.25 6.72 + 3.11 12.29 (6.28-28.5) 11.98 (4.3-51.2) 6.07 e (2.4-15.1) 3-Hydroxybenzo[a]pyrene 8.48 + 6,87 5.40 5:3.63 4,87 5:1.99 6.22 ( 1.8 - 19.7) 5.32 ( 1.0-15.4) 4.60 ( 1.3 -9.4) l-Hydroxychrysene 16.51 5: I 1.16 13,96 5:9.31 4.29 + 2,13 13.97 (6.33-33.0) I 1.55 (3.8-47.5) 4.11 ~ (1.2-9.7) 7,14-Hydroxydibenz[a.h]anthracene 10.44 5:5.29 10.90 5:5.54 8.68 :t: 3.51 9.21 (2.4-18.8) 9.91 (3.8-28,4) 8.10 (2,5-15.3) l-Hydroxypyrene 5,51 5:5.10 6.54 ~. 3,42 2.06 + 1.53 3.46 ( 1.4-16,6) 5.88 (2.3-14.4) 181 ~ (0.5-7.5) Mean 5: SD; b Median; ~ Range; d Urinary PAH and metabolites are expressed as ng/mg creatinine; ~ p < 0.001. ![ ,il Table 7 Corre!at "-11 Tot~P? Benzol o Chrysen Dibenz[ Pyrene 3-Hydro -Hydro l 7,1.4-Hv l-Hyd~ Statistic: 3.4. C urinar. The gemcit ~dy: '~In: mutag~ with t the no statisti tween of PAl A low~ when Table 8 Correlm Benzo[. PO _~ Chryse! O Dibenz! t~ Pyrene 0"~ 3-Hydt ˘.,O _~ l-Hyd~ ~ 7,14-H 03 I -Hyd~
Page 55: 2063633540 Log in for more options!
and the ~r both the the non- l-! II I! M. ~ernd et aL / Mutation Research 39l (1997) 99-110 Table 7 Correlation between urine mutagenicity results and urine PAH/metabolites (Spearman rank correlation) - overall study Standard plate test (n = 52) Kado test (n ~ 37) 107 I ~ YGI041 + $9 YGI041 - $9 -I Total.PAH/total metabolites 0.371 (0.009) 0.248 (0.142) lude four dibenz[a, ! metabo- ites. The rent PAH Benzo[a]pyrene Chrysene Dibenz[ a.h ]anthracene Pyrene 3-Hydroxybenzo[ a]pyrene l-Hydroxychrysene 7,14-Hydroxydibenz[ a.h ]anthracene 1 -Hydroxypyrene 0.467 (0.001) 0.563 (0.000) 0.270 (0.062) 0.407 (0.005) 0.350 (0.016) 0.273 (0.11 I) 0.352 (0.040) 0.251 (0.144) 0.309 (0.071) 0.373 (0.030) roups, as • showed ztabolites lrysene, es (1-hy- s no sig- md non- or PAH II ii II Statistical significance (p) is given in parentheses. 3.4. Correlations between urinary, m~tagenicit3.' and urinaD" PAH / metabolites The Spearman rank correlation analysis was used to determine the relationship between urinary muta- genicity and PAH/metabolite in urine for the overall study and for all non-smokers. In the plate incorporation assay, the TA98- $9 mutagenicity results appeared to correlate marginally with the urine 3-hydroxybenzo[a]pyrene values for the non-smokers (r=0.377, p--0.016). Overall, a statistically significant correlation was observed be- tween the YG 1041 + $9 revertants and the majority of PAH/metabolites excreted in the urine (Table 7). A lower, but still significant correlation was obtained when the data for smokers were excluded (Table 8). In the microsuspension assay, a significant corre- lation between the YGI041 -$9 induced revertants and chrysene, 3-hydroxybenzo[a]pyrene and 7,14- hydroxydibenz[a,h]anthracene urinary values for the overall study was documented. In non-smokers, a correlation for the same strain was found for 7,14- hydroxydibenz[a,h]anthracene only. No correlation between the PAH/metabolites and YGI041 + $9 mutagenicity was observed. 4. Discussion The study design was based on the assumption that the Teplice population is exposed to higher concentrations of PAH and other mutagenic products Table 8 Correlation between urine mutagenicity results and urine PAH/metabolites (Spearman rank correlation) - overall for non-smokers I-.:1 Standard plate test (n = 44) Kado test (n = 32) YGI041 + $9 YGI041 - $9 Total PAH/total metabolites 0.287 (0.063) Benzo[a]pyrene Chrysene 0.362 (0.020) Dibenz[a.h ]anthracene 0.524 {0.001 ) Pyrene 3-Hydroxybenzo[ a]pyrene l-Hydroxychrysene 0.304 (0.052) 7,14-Hydrox,vdibenz[ a.h ]anthracene 1 -Hydroxypyrene 0.305 (0.051 ) 0.320 (0.086) Statistical significance (p) is given in parentheses.
Page 56: 2063633541 Log in for more options!
M. ~ernd et al. / Mutation Research 39l (1997) 99-ll0 of the incomplete combustion of fossil fuels in the ambient air than the Prachatice population and that this exposure is likely to be manifested in the pres- ence of mutagenic activity in urine. Mutagenicity analysis of urine is generally accepted to be a suit- able method for the demonstration of an occupa- tional exposure to mutagenic chemicals that may be excreted directly into urine or their excreted muta- genic metabolites [19]. The power of this method for determining the extent of human exposure to geno- toxins in the general environment with a markedly lower level of pollutants has not been demonstrated as yet. A significantly higher level of urinary PAH/metabolites detected in the Teplice group clearly showed a higher PAH exposure in this group. The significantly higher number of YG1041 + $9 revertants in the overall TP group and TP non- smokers manifested the marked exposure to genotox- ins compared with the PT group. Likewise, the num- ber of positive and negative individual mutagenic responses for ĄGI041 + $9 was found to be higher in the TP group. The YG104I + $9 results in the plate incorporation test correlated well with the ma- jority of urinary PAH metabolites in the Spearman rank correlation test. Smoking ranks among the factors which can con- tribute to individual urine mutagenicity. In fact, the majority of investigators found smokers to show higher urine mutagenicity [20]. Similarly, slightly, but non-significantly, higher numbers of all induced revertants both with and without metabolic activation were observed in the urine of 8 light smokers in Teplice. However, a significant increase the number of YG1041 + $9 revertants was also observed in Teplice non-smokers. Besides this, no significant difference in the DNA adduct level between non- smokers and smokers suggested that cigarette smok- ing did not substantially confound environmental exposure in this study [21]. To increase the probability of detecting an effect of ambient air exposure, the TA98 strain used as a standard frameshift mutagen indicator for urinary mutagens [22,23] was complemented with YG1041 which is supposed to be more sensitive in detecting urinary mutagens [24]. The higher number of the induced YG1041 revertant and the significant differ- ence between the TP and PT groups compared to the TA98 results supported this suggestion. A correlation between the YG1041 results with and without metabolic activation was observed. However, in a few urinary samples the excess induction of TA98 revertants prevailed. This could be attributable to the fact that several environmental mutagens, including PAH representative, benzo[a]pyrene and 7,12-di- methylbenz[a]anthracene were described to express almost the same or even lower mutagenicity to YG1041 when compared to conventional TA98 strain [14]. -. Provided that PAHs requiring metabolic activa- tion for the expression of mutagenicity are the domi- nant exposure factor, the presence of S9-dependent urine mutagenicity was expected. The dose-depen- dent direct mutagenic effect observed in individual urine specimens indicated that substances other than indirect-acting PAHs were also present. In addition to the presence of PAH in the ambient air, nitrated polycyclic aromatic hydrocarbons (nitroPAHs) are also widely distributed in the environment as a result of incomplete combustion processes. This fact is supported by the finding of the direct-acting muta- genicity of air particle exhaust in TP [25]. It is possible to hssume that the nitroderivatives could also be responsible for increased urinary mutagenic- ity. Nitroarenes are known to be potent bacterial mutagens [26]. They require metabolic activation by both nitroreductase and acetyltransferase present in indicator bacteria as well as in mammalian cells for exerting their mutagenicity. The overproduction of nitroreductases and O-acetyltransferases in the YG strains results in their higher ability to transform nitroderivatives into mutagenic metabolites. Re- cently, it was shown [27] that l-nitropyrene metabo- lites exhibited both direct-acting and S9-dependent mutagenicity which is further enhanced by O-acety- lation, l-Acetamidopyren-6-ol, the major urinary metabolite of l-nitropyrene, required both $9 and O-acetyltransferase activities. Indeed, the increase of indirect-acting YG1041 mutagenic metabolites ob- served in the study may indicate the excretion of nitroPAH metabolites. The two main difficulties observed using urinary mutagenicity tests are due to the small volume of urine and to the tiny amount of (pro)mutagens ex- creted. The micromethod has been shown to be about I0 times more sensitive than the standard plate assay ![ [ [ [ [ [ [81 a, extra. dard stand obtai The 1 muta canc, inter: the ~ resul twee betw ii lyze~ ' meta the I mere preii strai| the ~ indir A ~_~geni, tage expl: facto - , proc the ~ of .u~ tran~ The a si~ sure: be e t'-l! PAl seei in a met [
Page 57: 2063633542 Log in for more options!
and without ~wever, in a ion of TA98 ,utable to the is, including tnd 7,12-di- J to express ~genicity to TA98 strain :olic activa- • e the domi- )-dependent tose-depen- ~ individual . other than In addition dr, nitrated PAHs) are as a result is !25]. It is yes could autagenie- bacterial :vation by ~resent in ~ cells for uction of ~ the YG ~ransform tes. Re- ' metabo- ependent O-acety- urinary $9 and • rease of ites ob- etion of urinary ume of ~ns ex- e about Ill Ill Ill • Ill M. ~ernd et al. / Mutation Research 391 (1997) 99-1 I0 109 [8] and needs substantially lower volumes of urine extracts as well as of $9 mix. Therefore, both stan- dard incorporation and microsuspension bioassays were used in this study. In comparison with the standard plate test results, indeed, the number of obtained revertants was more than 10 times higher. The urine from most individuals was found to be mutagenic in the Kado assay based on the signifi- cance in the Bernstein model. However, substantial interindividual variations with overlapping ranges of the number of induced revertants in both groups resulted in statistically insignificant differences be- tween the TP and PT groups. A positive correlation between some of the urinary PAH/metabolites ana- lyzed and the YGI041 revertants without external metabolic activation may suggest that, in contrast to the plate incorporation test, the differences in treat- ment conditions, such as concentrated bacteria and preincubation with longer direct contact of indicator strains with urine extracts and enzymes could affect the metabolic transformation of excreted direct- and indirect-acting mutagens [28]. A high interindividual variability in urine muta- genicity responses seemed to be the main disadvan- tage of this biomarker. These differences may be explained by genetic, environmental and lifestyle factors. The metabolic activation and detoxification processes are crucial for individual susceptibility to the exposure of genotoxic carcinogens and influence the excretion of mutagens in urine. The dependence of urine mutagenicity for smokers on glutathione-S- transferase genotype has recently been presented [29]. The glutathione S-transferase M1 genotype also had a significant effect on urine mutagenicity and urinary PAH metabolites, but the effect of personal expo- sures to PAHs on the variability of biomarkers might be even higher [30]. The present study has shown that the use of two biomarkers - urinary mutagenicity and urinary PAH/metabolites analysis - may reflect the expo- sure of the population to genotoxic contaminants in ambient air. The sensitivity of the TA98 strain seemed to be insufficient in detecting the differences in ambient air exposure. On the contrary, the use of YG1041 tester strain could facilitate the detection of mutagens excreted in the urine arid it is to be recom- mended to the biological monitoring. The microsus- pension modification did not show any substantial advantage over standard plate incorporation assay in this study and its use in urinary mutagenicity assays needs to be validated in further comparative studies. Acknowledgements This study was supported by a grant from the Czech Ministry of the Environment (Teplice Pro- gram), the US. Environmental Protection Agency/the US Agency for International Development and CEC (PHARE II, EC/HEA/18/CZ). The authors ac- knowledge the support of the Directors of the Dis- trict Institutes of Hygiene in Teplice (Dr. F. Kot~ovec) and Prachatice (Dr. J. No~i~ka) and the technical support of the staff of these institutes. They acknowledge the technical support of A. Truhl~ovfi and H. ~muhat~ov~ of NIPH, Prague, technical ad- vice of J. ~mld and statistical advice of Dr. E. ,~vandovfi. References [1] EHC (Environmental Health Criteria) 155 (1993) Biomarkers and Risk Assessment: Concepts and Principles, WHO, Geneva, 82 pp. [2] B.N. Ames. J. McCann, E. Yamasaki, Methods for detecting carcinogens and mutagens with the Salmonella/ mammalian-microsome mutagenicity test, Mutation Res. 31 (1975) 347-364. [3] E. Yamasaki, B.N. Ames, The concentration of mutagens from urine with the nonpolar resin XAD-2: cigarette smokers have mutagenic urine, Proc. Natl. Acad. Sci. USA 74 (1977) 3555-3559. [4] V. Minnich, M.E. Smith, D. Thompson, S. Komfeld. Detec- tion of mutagenic activity in human urine using mutant strains of Salmonella typhimurium, Cancer 37 (1976) 665- 670. [5] M.S. Legator, E. Bueding, R. Batzinger, T.H. Connor, E. Eisenstadt. M.G. Farrow, G. Fiscor, A. Hsie. J. Seed, R.S. Stafford, An evaluation of the host-mediated assay and body fluid analysis. A report of the U.S. Environmental Protection Agency Gene-Tox Program, Mutafiot~ Res, 98 (1982) 3 t9- 374. [6] R.B. Everson, Detection of occupational and environmental exposures by bacterial mutagenesis assays of human body fluids. J. Occup, Med. 28 (1986) 647-655. [7] R.P. Bos, J.L.G. Theuws, P.T. Henderson, Excretion of mutagens in human urine after passive smoking, Cancer Lett. 19 (1983) 85-90.
Page 58: 2063633543 Log in for more options!
llO [81 M. ~ern6 et al. / Mutation Research N.Y. Kado, D. Langley, E. Eisenstadt, A simple modification of the Salmonella liquid-incubation assay. Increased sensitiv- ity for detecting mutagens in human urine, Mutation Res. 121 (1983) 25-32. [9] M. Watanabe, T. Nohmi, M. lshidate Jr., New tester strains of Salmonella typhimurium highly sensitive to mutagenic nitroarenes, Biochem. Biophys. Res. Commun. 147 (1987) 974-979. [10] RA. ~r'~rn, I. Bene.~, B. BinkovL J. Dejmek, D. Horstman, F. Kot~]ovec, D. Otto, S.D. Perreault, J. Rube], S.G. Selevan, I. Skal~, R.K. Stevens, J. Lewtas, Teplice Program - the impact of air pollution on human health, Environ. Health Perspect. 104 (Suppl. 4) (1996) 699-714. [11] D. Szadkovski, A. J~Srgensen, H.G. Essing, K.H. Schaller, Die kreatinineliminationsrate als Bezugsgr~Sss for Analysen aus Hamproben, Z. Klin. Chem. U. Klin. Biochem. 8 (1970) 529-533. [12] R.W. Williams, T. Pasley, R. Watts, J. Inmon, J. Fitzgerald, L. Claxton, Comparative yields of mutagens from cigarette smokers urine obtained by using solid-phase extraction tech- niques, Environ. Mol. Mutagen. 14 (1989) 20-26. [13] D.M. Maron, B.N. Ames, Revised methods for the Salmonella mutagenicity test, Mutation Res. t 13 (1983) 173-215. [14] Y. Hagiwara, M. Watanabe, Y. Oda, T. Sofuni, T. Nohmi, Specificity and sensitivity of Salmonella typhimurium YGI041 and YG1042 strains possessing elevated levels of both nitroreductase and acetyltransferase activity, Mutation Res. 291 (1993) 171-180. [15] O.H. Lowry, N.J. Rosebrough, A.L. Fan', R.J. Randall, Pro- tein measurement with the Folin phenol reagent, J. Biol. Chem. 193 (1951) 265-275. [16] D. DeMarini, M.M. Dallas, J. Lewtas, Cytotoxicity and effect on mutagenicity of buffers in a microsuspension assay, Teratogen. Carcinogen. Mutagen. 9 (1989) 287-295. [17] L.D. Claxton, J. Creason, J.A. Nader, W. Poteat, J. Orr, GeneTox manager for bacterial mutagenicity assays: a per- sonal computer and minicomputer system, Mutation Res. 342 (1995) 87-94. [18] L. Bernstein, J. Kaldor, J. McCann, M.C. Pike, An empirical approach to the statistical analysis of mutagenesis data from the Salmonella test, Mutation Res. 97 (1982) 267-281. [19] H. Vainio, M. Sorsa, K. Falck, Bacterial urinary assay in monitorir!g exposure to mutagens and carcinogens, in: A. Berlin, M. Draper, K. Hemminki, H. Vainio (Eds.), Monitor- ing Human Exposure to Carcinogenic and Mutagenic Agents, 391 (1997) 99-110 International Agency tbr Research on Cancer, Lyon, 1984, pp. 247-258. [20] R. Pasquini, S. Monarca, G. Scasellati Sforzolini, R. Conti, F. Fagioli, Mutagens in urine of carbon electrode workers, Int. Arch. Occup. Environ. Health 50 (1982) 387-395. [21] B. Binkov/i, J. Lewtas, I. M~kov~, J. Len~ek, R.J. ~r-,im, DNA adducts and personal monitoring of carcinogenic poly- cyclic aromatic hydrocarbons in an environmentally exposed population, Carcinogenesis 16 (1995) 1037-1046. [22] M. ~erml, V. Hfijek, L. Dobifi], R.J. ~rfim, Mutagenic activ- ity of the urine of workers employed in the processing of coal tar, Prac. L6k. 36 (1984) 41-44, in Czech. [23] R. Pasquini, S. Monarca. G. Scasellati Sforzolini, A. Savino, C. Fatigoni, P. Pucetti, Urine mutagenicity and biochemical parameters as markers of exposure to petroleum pitch using a rat model, Environ. Mol. Mutagen. 15 (1990) 56-66. [24] P. Einist~5, T. Nohmi, M. Watanabe. M. Ishidate Jr. Sensitiv- ity of Salmonella typhimurium YGI024 to urine mutagenic- ity caused by cigarette smoking, Mutation Res. 245 (1990) 87-92. [25] R. Watts, J. Lewtas, R. Stevens, T. Hartlage, J. Pinto, R. Williams, K. Hattaway, I. Mi'~kowl, I. BeneL F. Kot~ovec, R.J. ~rfim, Czech-U.S. EPA health study: assessment of personal and ambient air exposures to PAH and organic mutagens in the Teplice district of Northern Bohemia, Int. J. Environ. Anal. Chem. 56 (1994) 271-287. [26] H.S. Rosenkranz, R. Mermelstein, Mutagenicity and geno- toxicity of nitroarenes. All nitro-containing chemicals were not created equal, Mutation Res. 114 (1983) 217-267. [27] P.F. Rosser, P. Ramachandran, R. Sangaiah, R.N. Austin, A. Gold, L.M. Ball, Role of O-acetyltransferase in activation of oxidised metabolites of the genotoxic environmental pollu- tant l-nitropyrene, Mutation Res. 369 (1996) 209-220. [28] T. Watanabe, M.J. Kohan, D. Walsh, L.M. Ball, D.M. DeMarini, J. Lewtas, Mutagenicity of nitrodibenzopyranones in the Salmonella plate-incorporation and microsuspension assays, Mutation Res. 345 (1995) 1-9. [29] A. Hirvonen, L. Nylund, P. Kociba, K. Husgavfel-Pursiainen, H. Vainio, Modulation of urinary mutagenicity by genetically determined carcinogen metabolism in smokers. Carcinogene- sis 15 (1994) 813-815. [30] B. Binkov,5., J. Lewtas, I. M~kovL P. R~ssner, M. ~ern.4, G. Mrfi~kovfi, K. Peterkov~, J. Mumford, S. Myers, R. ~rfim, Biomarker studies in Northern Bohemia, Environ. Health Perspect. 104 (Suppl. 3) (1996) 591-597. ~ Dicisi . /stra fibers. il24-h e (48E). only u~ signifit - --I~ groups silica. -~ under _ I~] treatml Keywo~ 1. Int Sil COrlSt; monL tries.
Page 59: 2063633544 Log in for more options!
2063633544
Page 60: 2063633545 Log in for more options!
~52 MONICA Data ' Centre, Department of Epidemiology and Health Promotion, National PubHc Health Institute, Nlannerheimintle 166, 00300 Helstnki, Finland. A Molarius K Kuulasmaa The Netherlands Institute for Health Sciences, Erasmus University Medical School, Rotterdam, The Netherlands. A Moladus Department of Chronic Disease and Environmental Epidemialogy, National Institute of Public Health and the Environment, Bilthoven, The Netherlands. J C Seidell Department of Statistics, University of Newcastle, New South Wales, Australia. A J Dobson Department of Health and Social Security, Institute of Health Studies~ Barcelona, Spain. S Sans WHO MONICA Proiect* A list of participants is published as appendix I Correspondence to: /vls A Molarius. Accepted for publication November 1996 Journal of Epidemiolo~y and Coramuni~y Health 1997;51:252-200 Smoking and relative body weight: an international perspective from the WHO MONICA Project WHO MONICA Project* prepared by A Molarius, J C Seidell, K Kuulasmaa, A ~[ Dobson, S Sans Abstract Study objective--To investigate the mag- nitude and consistency of the associations between smoking and body mass index (BMI) in different populations. Design~A cross sectlonal study. Setting and participants--About 69000 men and women aged 35-64 years from 42 populations participating in the first WHO MONICA survey in the early and mid 1980s. Main results--Compared to never smokers, regular smokers had sig- nificantly (p<0.05) lower median BMI in 20 (men) and 30 (women) out of 42 popu- lations (range --2.9 to 0.Skglm~). There was no population in which smokers had a significantly higher BMI than never smokers. Among men, the association be- tween leanness and smoking was less ap- parent in populations with relatively low proportions of regular smokers and high proportions of ex-smokers. Ex-smokers had significantly higher BMI than never smokers in I0 of the male populations but in women no consistent pattern was ob- served. Adjusu,nent for socioeconomic sta- tus did not affect these results. Conclusions~Although in most popu- lations the association between smoking and BMI is slmHar, the magnitude of this association may be affected by the pro- portions of smokers and ex-smokers in these populations. (J Epidemiol Gommunicy Health 1997;51:252-260) Ntmierous epidemiological studies have shown a consistent inverse relationship between smoking and body weight---smokers weigh relatlvely less than non-smokers,~-n and stopping smoking often leads to weight gain.I-3 ~ 7 ~0 t2-~4 It has been shown that this is mainly because smoking increases energy expenditure)~ Moreover, the inverse re- lationship between smoking and relative body weight becomes stronger with age,4 which ~ be explained by longer duration of smoking)16 Among smokers a U-:shaped relationship be- tween the number of cigarettes smoked and relative body weight has been found in several studies--those smoking 10-20 cigarettes per day being the leanest.~-~7°~71s Although this seems paradoxical given the metabolic effects of smoking, it has been suggested that heavy smokers may weigh more because of clustering of other unhealthy habits such as high intake of saturated fat, heavy use of alcohol, and little exercise. Indeed, a study in Finland found that a change in the association between smoking and body weight had occurred in the 1980s~ smoking was no longer associated with leanness in this population but rather it was positively related to BMI, especially among younger middle aged men.l~ Most studies of the relationship between smoking and relative body weight have looked at single populations or cohorts. Therefore we considered it important to examine whether associations are similar in populations with different histories of smoking habits and changes in body weight. We investigated this among men and women in 42 populations participating the WHO MONICA Project. Given the findings of the Finnish study on changes in the relationship between smoking and relative body weight, it could be hy- pothesised that the "classical" inverse as- sociation between smoking and relative body weight might hold in populations with a high prevalence of smoldng and comparatively few anti-smoking activities, while a "new" positive association between smoking and relative body weight may be more typical in populations with a previously high but currently falling prevalence of smoking due to and-smoking programmes. While our data do not allow us to test this hypothesis directly, we will mainly focus on determining whether there are popu- lations with the "new" association to warrant pursuing such a hypothesis. Methods The WHO MONICA Proiect was designed to measure trends in the incidence in and mor- tality from cardiovascular disease, and to assess the extent to which these trends are related to changes in known risk factors in 49 study populations in 26 countries. Risk factors in the WHO MONICA Project are monitored through up to three independent cross sectional population surveys,m° The surveys included random samples of at least 200 people in each gender and 10 year age group, for the age range 35-64 years, and optionally 25-34 years. This study presents data from the baseline surveys. The survey periods range from May 1979 to ~.~ February 1989 and are mosdy concentrated in the early and mid 1980s. In this study, only the age range from 35-64 years is considered. The overall participation rates for the surveys ~.~..~
Page 61: 2063633546 Log in for more options!
Smoking and body weight in MONIGA participation rates, and survey periods have been described in more detail elsewhere.21 Height and body weight were measured with participants standing without shoes and heavy outer garments. Body mass index (BMI) was calculated as weight divided by height squared (kg/m2) as a measure for relative weight. BMI categories were formed according to the WHO guidelines,22 except for using 21 kg/m2 instead of the WHO recommendation of 18 kg/m2 as ' a cut off point for the leanest category. This cut off point was selected to ensure a sufficient number of subjects in each category and be- cause of its use in some other studies.23 The subjects were classified as follows: • Lean persons--BMI less than 21 kg/m2 • Persons of normal weight--BMI equal to or more than 21 but less than 25 kg/m2 • Overweight persons--BMI equal to or more than 25 but less than 30 kg/m2 • Obese persons--BMI equal to or more than 30 kg/m2. Data on smoking were obtained with a stand- ard questionnaire.24 In the analysis respondents were classified as follows: • Regular cigarette smokers, those reporting smoking cigarettes every day. They were fur- ther classified in concordance with several other studies2~so as (a) light to moderate smokers, those smoking 1-19 cigarettes per day, and 03) heavy smokers, those smoking 20 or more cigarettes per day. • Other current smokers, those reporting smoking cigarettes occasionally, or at least lg of pipe tobacco per week, or at least one cigar per week. • F.x-smokers, those reporting smoking ci- garettes regularly in the past but not cur- rently. • Never smokers, those who were not current smokers and had never smoked cigarettes regularly. The age group of the subject was obtained from the sampling frame at the time of sample selection. Tertiles of years of schooling within each population were used as a measure of socioeconomic status (SES). Years of schooling were obtained by asking--"How many years did you spent at school or in full-time study?". Terdles of years of schooling were calculated for men and women in each 10 year age group separately. KEY POINTS • Cigarette smokers are leaner than never smokers in most of the populations studied - and more so in women than men. • In some populations there was no as- sociation between smoking and body weight. In these populations, among men, there were fewer smokers and more ex-smokers than in populations in which smokers were leaner than never smokers. • Ex-smoking men weighed on average more than never smokers, whereas in women no consistent pattern was found. The quality of data on weight, height, smoking behaviour, and years of schooling has been cent- rally assessed. Any population ~rith an un- satisfactory quality of data or response rate lower than 50% for any of the items has been omitted from this study. This left 42 populations, except for analyses involving years of schooling, where only a subset of 34 populations with full data was included. STATISTICAL METHODS In the first phase of data analysis, population level (ecological) data were analysed to estimate the strength of association between smoking and relative body weight. Pearson correlation coefficients between the proportions of regular cigarette smokers and the means and centiles of BMI were calculated for men and women for each 10 year age group. Correlations of age standardised values are given for the age group 35-64. Age standardised values were calculated using the world standard population,z~ as the reference population with weights 12, I1, and 8 for the 10 year age groups 35-44, 45-54, and 55-64 respectively. In the second phase, individual data were used to examine the consistency and magnitude of the relation between smoking and BMI at the individual level. All analyses were carried out separately for men and women. Two types of analyses were performed--firstly, comparing medians or means of BMI between different categories of smoking, and secondly, comparing proportions of regnalar smokers between differ- ent categories of BMI within populations. Differences were reported to be statistically sig- nificant if the p value was less than 0.05. To compare the levels of BMI between smok- ing categories, medians instead of means of BMI were used because of the distributions of BMI were skewed to the right. Confidence intervals for the differences in median BMIs in categories of smokers, compared with the never smoker category, were calculated using the Normal ap- proximation as described by White et al.~6 Linear regression was used to control for potential confounding by SES. Mean BMIs and differ- ences in mean BMIs in relation to smoking category were calculated u.sing the general linear model (GLM) procedure of SAS statistical soft- ware,zr adjusting for age group and population as categorical covariates. To assess the con- founding effect of SES, regression analyses were performed both with and without adjusting for population specific textiles of years of schooling. Confidence intervals for the estimates were cal- culated from the standard errors of the re- gression coefficients assuming that the sampling distributions of the coefficients were normal. The results of the linear regression were also used to give an overall estimate of the differences in the mean BMIs between smoking categories, summarising the results across all populations. In addition, the same overall estimates were calculated using non-parametric methods to confirm that the estimates based on the re- gression analysis did not differ from the es- timates based on medians.
Page 62: 2063633547 Log in for more options!
254 Molarius, Seidell, Kuulasmaa, et al Table 1 Number of subjects, age standardised proportion CA) of regular cigarette smokers, and age standardised p~vaIence of obesity (BMI> 30 kgl m2) in first MONICA population survey~ Men and women aged 35-64 years Population Country Abbreviation No 3moker~ % Obes~ % No 8moker~ % Obese% Newcasde Australia AUS-NEW 1218 34 15 1241 24 16 Perda Australia AUS-PER 631 33 9 661 22 11 Ghent Belgium BEL-GHE 539 43 11 495 25 15 Luxembourg Province Belgium BEI~LUX 989 43 13 959 18 18 Beijing China CHN-BEI -619 51 3 641 16 9 Czech Republic Czech Rcp. CZE-CZE 948 44 21 990 21 32 Glostmp Denmark DEN-GLO 1456 45 I1 1361 44 10 Kuopio Province Finland FIN-KUO 968 34 18 981 l0 19 North Karelia Finland FTN-NKA 1125 30 17 1212 9 24 Turku/Lulmaa Finland FTN-TUL 1194 30 19 1270 17 17 Lille France FRA-LIL 641 39 14 530 i i 19 Strasbourg France FRA-STR 666 34 22 714 14 23 Toulouse France FRA-TOU 678 36 9 645 17 11 Augsburg rural Germany GER-AUR 846 30 20 857 12 22 Augsburg urban Germany GER-AUU 712 36 18 679 18 15 Bremen Germany GER-BRE 633 45 14 656 29 18 Cottbu~ County Germany GER-COT 460 31 17 543 11 23 Halle County Germany GER-HAC 816 38 18 859 14 27 Karl-Marx-Stadt County Germany GER-KMS 813 37 14 926 15 19 Rest of DDR-MONICA Germany GER-RDM 763 37 17 822 24 21 R_hein-Neckar Region Germany GER-RHN 1170 31 13 1266 23 12 Iceland Iceland ICE-ICE 657 26 11 704 40 11 Area Brianza Italy ITA-BRI 618 44 11 639 18 15 Frinli Italy ITA-FRI 719 35 16 724 26 19 Karmas Lithuania LTU-KAU 728 38 22 735 4 45 Auckland New Zealand NEZ-AUC 1018 29 8 567 25 9 Tarnobrzeg Voivodship Poland POL-TAR 1250 58 13 1472 11 32 Warsaw Poland POD-WAR 1309 59 18 1337 33 26 Bucharest Romania ROM-BUC 524 38 20 632 15 31 Moscow control Russia RUS-MOC 770 48 13 645 12 33 Moscow intervention Russia RUS-MOI 1163 46 12 1~34 9 35 Novosibi~sk control Russia RUS-NOC 1061 59 15 1054 3 44 Novosibksk intetv. Russia RUS-NOI 601 53 13 646 3 43 Catalonia Spain SPA-CAT 993 47 9 994 7 24 Gothenburg Sweden SWE-GOT 517 33 7 557 34 9 Northern Sweden Sweden SWE-NSW 640 24 11 611 26 14 Ticino - Switzerland SWI-TIC 781 38 20 769 24 15 Vaud/Fribourg Switzerland SWI-VAF 627 32 . 13 568 21 13 Belfast UK LrNK-BEL 927 34 11 925 33 14 ~oOW .x ~X-~L~ 502 52 n 480 50 16 rd USA USA-STA 427 40 10 516 36 15 Novi Sad Yugoslavia YUG-NOS 592 49 17 555 27 29 To compare the prevalence of regular cigarette • smoking between BMI categories, age stand- ardised proportions of regular cigarette smokers were calculated for the age group 35-64 using the same method for age standarclisation as described above. The differences in the pro- portions of smokers between BMI categories within populations were tested by fitting a lo- gistic regression model with regular cigarette smoking as the binary dependent variable and Table 2 Pearson correlation coefficients between the Froportion (°,6) of regular cigarette smokers and mean and centiles of body mass index (BMI) for 42 populat~ns in the first MONIGA survey Age ~roup r (95% Gl) r (95% CI) 35-44 --0.07 (-0.36,0.24) --0.45 (--0.66,--0.17) 45-54 --0.37 (--0.61,-0.08) -0.65 (--0.79,- 0.43) 55-64 --0.30 (--0.55, 0.01) --0.63 (--0.79,-0.41) Age standardised 35-64 -0.25 (-0.52, 0.05) -0.59 (-0.76,-0.35) Median 35-44 0.00 (-0.30, 0.30) -0.46 (-0.67,-0.18) 45-54 -0.34 (-0.59,-0.04) -0.62 (-0.78,-0.39) 55-64 -0.30 (-0.55, 0.00) -0.64 (-0.79,-0.41) Age standardised 35-64 --0.22 (--0.49, 0.09) --0.57 (-- 0.75,--0.33) 10th centile 35-44 --0.16 (--0.44, 0.15) -0.47 (--0.68,--0.19) 45-54 --0.54 (--0.73,--0.29) --0.63 (--0.79,-0.41) 55-64 -0.50 (-0.70,--0.23) -0.58 (--0.75,--0.33) Age standardised - 35-64 -0.43 (-0.65, -0.14) -0.56 (-0.74,-0.31) 90th centile 35-44 0.04 (-0.27, 0.34) -0.37 (-0.61,-0.08) 45-54 --0.22 (--0.49, 0.09) -0.58 (- 0.75,--0.33) 55-64 --0.10 (-0.39, 0.21) -0.60 (--0.76,-- 0.36) Age standardised 35-64 -0.08 (-0.37, 0.23) -0.54 (-0.72,- 0.28) age group as the independent variable, with and without adjustment for indicator variables for BMI categories. To estimate the overall difference in the age standardised proportions of regular cigarette smokers between BMI categories, the mean of the dLfferences and a 95% confidence interval for this mean were calculated, summarising the results across all study populations. The normal weight catego~ (BMI=21.0-24.9 kg/m2) was used as the reference category when comparing proportions of regular smokers. The confidence intervals were calculated from standard errors of the means using t distribution with the number of populations minus one for the degrees of freedom. Results Table 1 gives the number ofsubiects, age stand- ardised proportion of regular cigarette smokers and age standardised prevalence of obesity (BMI >_. 30 kg/mz) in each population. The table shows considerable variation both in the pre- valence of regular smoking and obesity across the study populations. The prevalence of reg- ular cigarette smoking ranged from 24%-59% in men and from 3%-50% in women. In gen- eral, among men the prevalence of smoking was highest in some eastern European (Poland, Russia) populations and lowest in some Nordic (Sweden, Iceland) populations. " Among women, however, smoking was relatively more common in some western European popu-
Page 63: 2063633548 Log in for more options!
Smoking and body weight in MONIGA 255 RUS-NOI RUS-NOC POL-TAR RUS-MOC ROM-BUC UNK.-GLA LTU-KAU POL-WAR BEL-GHE FRA-LIL RUS-MOI CZE-CZE FRA-STR YUG-NOS GER-HAC USA-STA ITA-BR! CHN-BEI ,. SWI-VAF .o_ SWI-TIC GEN-KMS --, FIN-TUL GER-RDM UNK-BEL SPA-CAT AUS-.PER ITA-FRI GER--.COT ICE-ICE BEL-LUX GER-AUU AUS--NEW NEZ-AUC F|N-NKA DEN..-GLO SWE-GOT FIN-KUO GER-RHN GER-AUR FRA-TOU SWE-NSW GER-BRE • .-4 -3 -2 -1 1 BMI (kg/m2| Women 35-64 y -2.40 (-3.10, -1.85) POL-WAR [ ~ I -2.87 (-3.56, -2.10) -1.99 (-2.96, -1,36) CZE-CZE ~ } -2.77 (-3.90, -1.81) -1.93 (-2.54, -1.27) GER-AUR ~ -2.55 (-3.62, -0.79) -1.82 (-2.49, -1.28) GER-HAC -2.47 (-3.39, -0.70) -1.78 (-2.61, -0.82) BEL-GHE -2.19 (-3.39, -0.76) -1.76 (-2.59, -0.83) RUS-NOI , -2.13 (-7.55, 5.091 -1.64 (-2.83, -0.81) RUS-NOC 1 -2.09 (-5.88, 1.48) -1.63 (-2.30, -1.22) FRA-STR --F---- -2.06 (-2.85, -0.77) -1.59 (-2.43, -0.02) YUG-NOS ~ -2.00 (-2.94, -0.84) -1.46 (-2.25, -0.63) RUS-MOI ---+---- -1.97 (-3.01, -0.69) -1.42 (-1.92, -0.90) FIN-NKA ~ -1.94 (-3.30, -0.61) -1.29 ( -1.85, -0.33) SPA-CAT ~ -1.88 (-3.63, -0.87) -1.03 (-1.82, ,-0.32) ~ LTU-KA.U I -1.74 (-5.38, 3.51) -0.97 (-1.86, 0.02) '~ ˘ SWE-NSW ~ -1.65 (-2.70,-0.64) -0.92 (1.60, 0.141 ˘ o POL-TAR ~ -1.66 (-3.19, -0.611 -0.92 (-1.65, -0.32) ~. '~ FRA-TOU ~ -1.48 (-2.27, -0.26) -0.67 (-1.20, -0.10) ~ UNK-BEL ---P.-- -1.33 (-1.93, -0.36) -0.59 (-1.75, 0.53) ~ GER-RDM ~ -1.24 (-2.24, -0.63) -0.55 (-1.20, 0.22) ~ USA-STA ~ -1.22 (-2.11, -0.09) (-1.47, 0.62) ~ DEN-GLO -+- -1.12 (-1.66, -0.57) -0.66 -0.52 (-1.33, 0.49) E3 AUS--NEW .----F.-- -1.08 (-2.17, -0.13) -0.45 (-1.21, 0.43) GER-RHN ~ -1.04 (-1.64, -0.47) -0,34 (-1.09, 0.23) FIN-KUO ~ - ' -0.95 (-2.71, 0.37) -0.33 (-0.94, 0.35) NF..Z-AUC --+-- -0.94 (-1.60, .-0.06) -0.30 (-0.88, 0.48) ITA-FRI ~ -0.92 (-2.25, 0 22) --0.29 (-0.87, 0.38) UNK-GLA ~ - ~--0.88 (-2.25, 0.2 I) -0.27 (-0.68, 0.26) GER-BRE ~ -0.86 (-1.93,-0.16) -0.16 (-1.33, 0.52) SWE-GOT ~ -0.74 (-1.76, -0.09) --.0.11 (-0.83, 0.45) FRA-LIL -----+- -0.72 (-2.33, 0.24) 0.01 (-0.50, 0.73) ITA.-BRI ~ - -0.65 (-1.62, 0.47) 0.04 (-0.92, 0.60) RUS-MOC ------.t- -- -0.58 (-2.49, 1.29) 0.28 (-0.16, 0.81) GER-AUU ~ -- -0.57 (-1.44, 0.65) 0.45 (-0.61, 1.52) AUS-PER -- -- -0.07 (-0.91, 1.11) 0.47 (--0.76, 1.23) GER-COT ..... -0.06 (-1.63, 1.93) BMI (kg/m2) Figure 1 Difference in median BMI between regular cigarette smokers and never smokers in the first MONICA survey. Left, men aged 35-64; right, women aged 35-64. lations and less common in eastern Europe. There were more female than male smokers only in Iceland (where 22% of men smoked pipes or cigars) and in Sweden. The prevalence of obesity ranged from 3%-22% in men and from 9%-45% in women and was relatively more common in populations with a low pre- valence of smoking, especially among women. Table 2 presents Pearson correlation co- efficients between the proportion of regular cigarette smokers and BMI. These are eco- logical correlations where each population rep- resents one observation. For women, smoking was significantly inversely related to BMI for all four measures~10th centile (leanness), mean and median Bh4I (average weight) or 90th centile (obesity). For men, the age standardised prevalence of smoking was significantly in- versely related to the 10th centile only. For both men and women the weakest correlations were observed in the age group 35-44 years. Figure 1 shows differences in median BMI between never smokers and regular cigarette smokers. In almost all populations smokers were leaner than never smokers--the difference was statistically significant in 20 out of 42 populations for men and in 30 out of 42 popu- lations for women. The differences ranged from -2.4 to 0.5 kg/mz in men and from -2.9 to --0.1 kg/mz in women. When translated into kg for average heights of 1.72 m and 1.60 m for men and women respectively, they cor- respond to the range from -7.1 to 1.5 kg for men and from -7.4 to -0.3 kg for women. The largest differences were observed in popu- lations with relatively high smoking rates (eg in some eastern European populations). To elucidate further the difference between the populations where the smokers were con- siderably leaner than never smokers in com- parison to populations where they were not, we compared the proportion of regular smokers in the 14 populations with the largest differ- ences in BMI to the 14 populations with the smallest differences in BMI between smokers and never smokers with a non-parametric (Wil- coxon rank sum) test (table 3). Among men, there were significantly more regular smokers in the populations with the largest differences in BMI than in the populations with the smallest differences. In addition, the proportions of ex- smokers were statistically significantly lower in these populations. For women, however, there were fewer smokers in the group of populations with the largest differences in BMI than in the populations with the smallest differences but the difference in smoking prevalehces was not statistically significant. The prevalence of ex-
Page 64: 2063633549 Log in for more options!
2~6 Molarius, Seidell, Kuulasmaa, et al Table 3 Proportions of regular smokers and ex-smokers in 14 populations with the largest difference in BMI be~oeen. smokers and never smokers compared with 14 populations with the smallest difference. First MONIGA survgy, men and women aged 35-64 Range for difference in BMI between Median % of p value Median % of p ~aoIue No smokem attd never smokers (kg/ra~) regular smokers ex-smok~es Largest difference -2.4, - 1.3 47 23 14 <0.001 0.03 Smallest difference -0.5, 0.5 33 29 14 Women Largest difference - 2.9, - 1.8 14 7 14 0.07 0.02 Smallest difference -- 1.1, -0.1 22 10 14 smokers was significantly lower in the popu- lations with large differences in BMI. Figure 2 shows the difference in median BMI between never smokers and ex-smokers. smokers had higher BMI than never smokers in 37 (and significantly so in 10) out of 42 populations among men, whereas for women there were differences in both directions but few were statistically significant. No systematic differences in BMI were observed between heavy and light smokers in most populations (data not shown). Regression analysis was used to examine the potential confounding effects of SES using population specific tertiles of years of schooling as an indicator. The unadjusted (for SES) ana- Men 35-64 ITA-BRI -.--H- RUS-NOI .--H- FRA-STR "-~ SWI-VAF BEL-GHE --P- LTU-KAU -- NEZ-AUC POL-WAR -- ITA-FRI -- SWE--GOT -- GER-HAC -- USA-STA ------ ROM-BUC RUS-MOI .H- AUS-NEW +- FRA-LIL -H,-- ICE-ICE ++~ BEL-LUX e- SWI-TIC .o_ SPA-CAT ~-~ ~ RUS-MOC -~-- ~ . SWE-NSW -++- RUS.-NOC -H--- o. POL-TAR ' -',-- YUG-NOS UNK-BEL GER-AUU -~- GER-AUR GER-RDM GER-KMS UNK-.GLA FRA-TOU .+- CZE-CZE GER-COT i DEN-GLO ' -+- FIN-TUL GER-BRE CHN-BEI AUS-PER --+- FIN-KUO GER-RHN -4- FIN-NKA -4- I,l,l,l,l,l,l,l, -4-3-2-1 0 1 2 BMI (kg/m q then for a subset of 34 populations, for which data on years of schooling were available, and then the SES adjusted analysis was performed for the 34 populations (table 4). The results were very similar whether adjusted for tertiles of years of schooling or not, indicating that SES had hardly any confounding effect on this association. The mean BMI in the never smoking cat- egory was 26.6 g/m2 for men and 26.8 kg/m2 population. In men, regular cigarette smokers were on average 0.9 kg/m~ leaner than never smokers, which implies that a male smoker of average height of 1.72 m weighed 2.7 kg less Women 35-64 y -0.35 (-1.39, 0.26) SPA-CAT i -3.28 (-4.81, -0.49) -0.34 (-1.50, 0.47) ITA-BRI -1.93 (-3.01, 0.77) -0.23 (-0.65, 0.56) FIN-KUO -1.42 ( -2.46, -0,34) -0.12 (-1.07, 0.69) GER-AUR -1.30 (-2.44, 0,33) -0.05 (-0.99, 0.99) SWI-TIC -1.25 (-2,30, 0.07) 0.02 (-0.72, 0.86) FRA-STR -1.21 (-3,39, 0.61) 0.04 (-0.58, 0.58) FIN-NKA -1.09 (-2.20, 0.41) 0.06 (-0,81, 0.61) RUS-MOC -0.98 (-2.64, 2.88) 0.09 (-0.76, 0.89) ITA-FRI -0.93 (-2,77, 0.88) 0.10 (-0.85, 0.81) GER--HAC -0.89 (-2,18, 2.32) 0.16 (-0.72, 0.87) GER-RHN -0.82 (-1,93, 0.10) 0.18 (-0.77, 1.59) BEL-GHE -0,79 (-1.93, 2.05) 0.25 (-1.51, 1.55) SWI-VAF -0.74 (-2,25, 1.59) 0.40 (-0.15, 1.08) A RUS--MOI !-0.65 (-2,95, 2.58) 0.49 (-0.05, 1.14) ~ FRA-TOU -0.64 (1.47, 0.68) 0.50 (-0.36, 1.33) ~ GER-AUU -0.58 (-1.98, 0.26) 0.51 (-0.26, 1.77) Lo POL-TAR -0.50 (-3,24, 1.38) 0.51 (-0.37, 1.45) ~'~ POL-WAR -0.44 (-1,44, 0.78) 0.51 (-0.33, 1.56) ~ ,'-" 8EL-LUX -0.42 (-1,44, 0.53) 0.56 (-0.19, 1.44) ._m ._o CZE-CZE -0.42 {-2,84, 1.65) 0.56 (-0.04, 1.33) '~ _,~ AUS-NEW -0.28 (-1.28, 1.06) 0.58 (-0.53, 1.45) F: ~.. AUS-PER -0.23 (-1.31, 1.10) 0.60 (-0.67, 1.42) "- 0 UNK-BEL -.0.20 (-1.25, 0.90) 0.62 (-0.08, 1.38) ~ SWE-GOT -0.16 (-1.19, 0.96) 0.68 (--0.35, 1.92) c: FIN-TUL -0.13 (-1.34, 0.77) 0.76 (-0.20, 1.56) P GER-KMS --0.05 (-2,16, 1.91) 0.78 (--0.04, 1.43) ~ SWE-NSW 0.01 (-2.02, 1.13) 0.78 (0.07, 1.28) Pi RUS-NOI 0.03 (-3.12, 5.53) 0.78 (-0.35, 1.71) ICE-ICE 0.14 (-0.95, 1.57) 0.80 (0.06, 1.50) DEN-GLO 0.25 (-0.61, 1.48) 0.80 (-0.86, 1.64) GER-RDM 0.26 (-0.89, 1.68) 0.81 (0.38, 1.48) GER-BRE ---- -- 0.29 (-1.65, 1.34) 0.87 (0.19, 1.75) NEZ-AUC .~ 0.46 (-0.66, 1.61) 0.92 (-0.07, 2.16) YUG-NOS ~ 0.63 (-2.18, 3.36) 0.93 (0.31, 1.66) LTU-KAU I 0.64 (-4.24, 5.87) 1.06 (0.31, 1.83) UNK--GLA -- ~ 0.67 (-1.29, 2.17) 1.12 (-0.05, 2.03) USA-STA ~ ~ 0.70 (-0.89, 2.75) 1.26 (-1.86, 3.35) GER-COT - ----t----- 1.82 (-0.48, 4.23) 1.27 (0.31, 1.85) ROM-BUC [ 1.99 (-5.62, 4.16) 1.32 (0.57, 2.02) FRA-LIL I 2.25 (-0.85, 4.64) 1.46 10.96, 2.05) RUS-NOC I 2.77 (-1.70, 4.64) 1.47 (0.81, 2.10} CHN-BEI I 3.17 (-6.16, 17.98) -4-3-2-10 1 2 3 4 5 BMI (kg/m~) Fig~tre 2 Difference in median 83 fI between ex-smokers and never smokers in the first MONICA sumey. Lej~, men aged 35-64; Hglzt, women aged 35-64.
Page 65: 2063633550 Log in for more options!
Smoking and body weight in MONIC~d 257 Table 4 Summary measures of BMI in relation ~ smoking category. Results fiom regress.ion analysis. First MONIC~t survey, men and women aged 35-64 Mean BMI (95% Cl) adjusted for age group and population Unadjusted for SES* Unadjusted for SESt Adjusted for SESt Men Never smokers - 26.6 (26.5,26.6) Difference between never smoker~ and Regular cigarette smokers --0.9 (-- 1.0,--0.8) Light smokers --0.9 (-- 1.0,--0.7) Heavy smokers -0.9 (- 1.0,-0.7) Ex-~moker~ 0.5 (0.4,0.6) Women Never smokers 26.8 (26.7,26.9) Difference between never smokers and Regular cigarette smokers -- 1.1 (- 1.3,-- 1.0) Light smokers -- 1.3 (-- 1.4,-- 1.1) Heavy smokers --0.8 (-- 1.0,-0.6) Ex-smokers -0.03 (--0.2,0.2) 26.6(26.5,26.7) 26.6(26.5,26.7) -0.9 (-1.0,-0.8) -1.0 (- 1.1,-0.9) -0.9 (-1.0,-0.8) -0.9 (- 1.1,-0.8) -0.9 (- 1.1,-o.s) -1.0 (-1.1,-0.9) 0.5 (0.4,0.6) 0.5 (0.4,0.6) 26.9 (26.9,27.0) 26.9 (26.8,26.9) -1.2 (-1.4,- 1.I) -1.2 (- 1.3,-1.0) --1.4 (-1.5,- 1.2) -1.3 (-1.5,-I.1) --0.9 (--1.1,-0.7) -0.9 (-1.1,-0.7) -0.05 (-0.3,0.2) 0.1 (-0.1,0.3) Socioeconomic status (SES) measured with population, gender, and age group specific tettiles of years of schooling * Based on data from 42 populations "i" Based on data from 34 populations than a never smoker of the same height. Male ex-smokers had 0.Skg/m2 higher BM.I than never smokers indicating that an ex-smoker of average height weighed 1.5 kg more than never smoker. In women, regular cigarette smokers were on average 1.i kg/m2 leaner than never smokers which implies a difference of 2.8 kg for a woman of average height of 1.60 m, but there was no significant difference between never and ex-smokers. For women, but not for men, light smokers had significantly lower Bi.Is than heavy smokers thus showing a U- shaped relationship between smoking and BML The overall estimates of the differences in BMI between smoking categories were also calculated using non-parametric methods. The estimates based on medians were very similar to those produced by the regression analysis. Only the median BMIs for never smokers (26.3 and 26.1 kg/m2 for men and women re- spectively) were somewhat lower than the means, especially for women, due to the skew- ness of the distributions. The age standardized proportion of regular smokers decreased consistendy with increasing BMI category (table 5). The difference between BMI categories was significant in 35 out of 42 populations among men and in 26 among women. In men the differences were larger than in women. Some exceptions to the general pattern were observed, for example among men in Auckland, Gothenburg, Toulouse, and northern Sweden there were more smokers in the obese than in the normal weight category, Table 5 Age standardised prevalence of regular cigarette smoking in relation to BMI category based on data from 42 populations. First MONIGA suwey, men and women aged 35-64 B2~fl category Proportion (°.,6) of smokers Men Lean (BMI<21.0) 61.8 (5624, 67.2) Normal weight (BMI=21.0-24.9) 45.6 (41.8, 49.3) Overweight (BM[= 25.0-29.9) 35.2 (32.8, 37.6) Obese (BMI>=30.0) 31.8 (29.5, 34.1) Women Lean (BMI<21.0) 30.0 (26.0, 34.0) Normal weight (BMI=21.0-24.9) 22.8 (19.3, 26.4) Overweight (BMI =25.0=29.9) 18.0 (14.8, 21.2) Obese (BMI> = 30.0) 13.9 (11.3, 16.5) but the exceptions were usually not statistically significant. On the basis of these results one could group the populations into two categories. In most populations for men and almost all for women the "classic" inverse association between smok- ing and BM_I was observed. In some popu- lations, there was no clear association. These include at least Auckland, Gothenburg, Tou- louse, and northern Sweden for men and per- haps Cottbus County and Perth for women. Discussion The association between smoking and relative body weight is an important health issue be- cause both smoking and increased body weight are independent risk factors for cardiovascular disease and quitting smoking is known to lead to weight gain. In addition, smoking is a po- tential confounder in the relationship between relative body weight and mortality.823 There- fore the recent suggestion that the relationship might be changing from a negative association to a positive one,16 especially among men, prompted us to explore this association in a wide range of populations. The data collected through the WHO MONICA project popu- lation surveys provided a unique opportunity to look at this relationship in a large number of populations from different parts of the world, based on common standardised survey methods for data collection and quality as- surance, and centralised data analysis. Our results show that the generally accepted funding that smokers weigh less than never smokers,t" still prevails in most populations. This was especially true for women. Also, a U- shaped relationship between BMI and number of cigarettes smoked was found among women but not among men, whereas earlier in- vestigations have generally found a stronger relationship in men.4916 ts "l~liS could be partly explained by the fact that we only used two categories for numbers of cigarettes smoked. Among men, in some of the. study popu- lations there was no association between smok- ing and BMI and in these populations there 0 03 o
Page 66: 2063633551 Log in for more options!
258 were in general fewer smokers and more ex- smokers than in populations where smokers were considerably leaner than never smokers. This finding suggests that the magnitude of the inverse association between smoking and body weight may be related to the prevalence of smoking in the population. It also partly sup- ports the original hypothesis that the "classical" inverse association might no longer be found in populations with extensive anti-smoking ac- tivities and reduced prevalence of smoking, eg in Australia, Finland, Sweden, the USA. However, no statistically significant positive association was found in any of these popu- lations. Therefore it would be premature to draw any definitive conclusions about a change in the direction of the relationship, especially because this study was based on cross sectional data and reflects the situation in the early and mid 1980s. More recent data, covering a longer time period, will allow this hypothesis to be tested directly. One mechanism by which the change from inverse to positive correlation between smoking "and BMI observed in the Finnish study,t6 might act is through selection among smokers. As an increasing proportion of light smokers tend to quit smoking when smoking becomes regarded as socially undesirable behaviour, the group of smokers consists increasingly of heavy smokers, who on one hand have more difficulties in quitting,~7 and who on the other hand have higher BMIs than light smokers.1~9~7 The change in the association from inverse to posi- tive would therefore be only an ecological change at the population level since the relative body weight of the heavy smokers at individual level need not have cbanged. The lack of an inverse association between smoking and BMI is more often seen among younger men than among older men or women. This might be partly explained because the decline in body weight is a long term affect of smoking, whereas the slightly higher BMI observed in heavy smokers may be unrelated to the duration of smoking. This is, in fact, in agreement with the findings of the Finnish study where, in spite of the overall positive association, years of smoking was confirmed as a significant inverse predictor of BMI.~ The effect of duration of smoking on body weight can however be an indirect one; it is better recognised in older people whose weights have a bigger range than in the young. The reasons for higher BMI of heavy smokers remain unclear. Clustering of unhealthy habits,~ and use of smoking as a way to control body weight among obese people,4 have been suggested as potential explanations, but no studies have been conducted specifically to explore this phenomenon. When looking at the prevalence of smoking between different BMI categories, the most consistent inverse association was found in re- lation to leanness, especially among men. This is supported by earlier research,s and suggests that even if, in some populations, average body weight might be positively associated ~vith smoking, leanness remains inversely associated with cigarette smoking. Our data did not allow us to investigate the association between and duration of smoking. This might have further elucidated the differences between populations, because mean age of starting to smoke may differ among populations and this, too, could affect the distribution of BMI. Some studies have found ex-smokers to be heavier than never smokers,4 ~o whereas others have not. 3~ Our findings suggest that, among men, ex-smokers tend to have higher BMI than never smokers, but not among women and this finding is supported by one earlier study.~1 Also Flegal eta/,~4 found that male ex-smokers were heavier than never smokers, but among women only those ex-smokers who had stopped smok- ing less than 10 years ago were heavier. The category of occasional cigarette smokers, pipe, and cigar smokers was not compared with never smokers in this study because of the small number of observations. Socioeconomic status (SES) is a potential confounder in the relationship between smok- ing and body weight. Persons with lower SES tend to smoke more,9~s and to have higher BMIs,9~ ~s than those with higher SES, the latter especially among women. The as- sociations found in this study were not ex- plained by the effects of SES measured in textiles of years of schooling. This is consistent with the results of several other studies.3~9~ We did not measure such potential confounders as physical activity~ caloric intake, and alcohol use, but in several studies they have not been found to be actual confounders,~s for the BMI-smoking relationship. This work is one example how large inter- national multi-centre studies can be used to obtain an overview strengthened by stand- ardised methods of data collection and quality assurance. One should, however, be cautious in applying quantitative measures obtained by combining data from heterogenous popu- lations. Nevetxheless, the consistency of as- sociations observed among a large number of different populations gives considerably more weight to the findings than results based only on one cohort or study population which cannot be directly generalised to other populations. In summary, in populations of the WHO MONICA project covering a wide range of smoking habits and prevalence of overweight, men and women who smoked generally had lower BMIs than never smokers. Among men, the difference was more pronounced in popu- lations where smoking was relatively more com- mon. Heavy smokers did not generally have lower BMIs than light smokers. Among men, but not among women, those who had stopped smoking had higher BMIs than those who never smoked. These results confirm that smoking is associated with relative body weight in in- dividuals as well as in populations but that differences in smoking habits in a population can influence the magnitude of this association. Funding: MONICA Centres are funded predominantly by regional and national governments, research councils, and re- search charities. Coordination is the responsibility of the World Health Organization (WHO), assisted by local fund raising for congresses and workshops. WHO also supports the MONICA Data Centre (MDC) in Helsinki. Not covered by this general description is the ongoing generous support of the MDC by the National Public Health Institute of Finland, and a con- lribution to WHO from the National Heart, Lung, and Blood
Page 67: 2063633552 Log in for more options!
Smoking and body weight in MONIGA Institute, National Institutes of Health, Bethesda, Maryland, USA for support of the MDC. Conflicts of interest: none. 1 K_hosla T, Lowe CR. Obesity and smoking habit*. BMJ 1971;4:10-13. 2 Gordon T, Katmel WB, Dawbcr TR, McGee D. Changes associated with quitting cigarette smoking: the Fram- ingham study. Am Heart y 1975;90:322-28. 3 Noppa H, Bengt*son C. Obesity in relation to smoking: a population study of women in G6tcborg, Sweden. Prey Med 1980;9:534-43. 4 ]'acobs DR Jr, Gottenborg S. Smoking and weight: the Minnesota Lipid Research Clinic. Am J Public Health 1981;71:391-96. 5 Albanes DJones DY, Micozzi MS, Mattson M. Associations between smoking and body weight in the U.S. popu- lation-analysis ofNHANES II..4mJPublic Health 1987; 77:439-44. 6 Kxomhout D, Saris W'H, Horst CH. Energy intake, energy ~xpenditure and smoking in relation to body lamest: the Zutphen study. Am y Clin Nutr 1988;47:668-74. 7 Shimokata H, Muller DC, Andres R. Studies in the dis* tribution of body fat: effect~ of cigarette smoking. JAMA 1989;261:1169-73. 8 Wannamethee G, Shaper AG. Body weight and mortality in middle aged British men: impact of smoking. BMJ 1989;299:1497-502. 9 IstvanJA, CunninghamTW, Garfmkel L Cigarette smoklng and body weight in the Cancer Prevention Study L IntJ Epidemiol 1992;21: 849-53. 10 Chen Y, Home SL, Dosman JA. The influence of smoking cessation on body weight may be temporary. Am ~ Public Health 1993;83:1330-32. 11 Boyle CA, Dobson A]') Egger G, Magnus P. Can the in- creasing weight of Australians be explained by the de- creasing prevalence of cigarette smoking? Int~ Obes 1994; 18:55-60. 12 Grnnbcrg NE. Smoking cessation and weight gain..N" Eng/ ~ Med 1991 ;324:768-69. 13 ~'dliamson DF, Madam J, Anda RF, Kleinman JC, Giovlno CA, Bycrs T. Smoking cessation and severity of weight gain in a national cohort. NEngl~Med 1991;324: 739-45. 14 Flegal KM, Troiano RP, Pamuk ER, Kuczmarski CampbeLl SM. The influence of smoking cessation on the prevalence of overweight in the United States. N Eng/ Med 1995;333:116.5-70. 15 Hofstetter A, Schultz Y~ Jequier E, Wahren J. Increased 24- hour energy expenditure in cigarette smoke~. N Eng/ • ~/fed 1986;314:79-82. 16 Marti B, Tuomilehto ]', Korhonen HI', Kattovaara I.~ Var- tiainen E, Pictinen P et al. Smoking and leanness: evidence for change in Finland. BMJ 1989;298:1287-90. 17 Killen JD, Fottmann SP, Telch MJ, Newman B. Axe heavy smokers different from light smokers? A comparison after 48 hours without cigarettes, ffAd~4~l 1988;260:1581-85. 18 Istvan ]'A, Nides MA, Buist AS, Greene P, Voelker H. Salivary cotininc, frequency of cigarette smoking, and body mass index: findings at baseline in the Lung Health Study. Am J Ep~emiol 1994;139:628-36. 19 WHO MONICA Project Principal Investigators. The World Health Organization MONICA Project (monitor~ag t~nds and determinant~ in cardiovascular disease): A maior international collaboration. J Clin Epidemiol 1988; 41:105-14. 20 World Health Organization. MONICA manual. Version 1.I. December 1986, CVD/MNC. Geneva, Worid Health Or1 ganization, 1986. 21 WHO MONICA Proiect prepared by Kcil U, Kuulasmaa K. WHO MONICA proiect: risk factors. Int .~ Epidemiol 1989;18 (Suppl 1):$46-$55. Erratum, [nt ~ Epidemiol 1990;19:776. 22 WHO Expert Committee. Physical stares: th˘ use and in- terpretation of anthmpometry. Technical Report Series no 854. Geneva:WHO, 1995. 23 Manson JE, Colditz CA, Stampfcr MJ, Willct~ WC, Rosncr B, Monson RR et al. A prospective study of obesity and risk of coronary heart disease i~ women. N ~ngl ~ Med 1990;322:882-89. 24 Rose CA, Blackburn H, Gillum RF, Prineas RJ. Cardio- vascular survey methods. Geneva:World Health ganization, 1982. 25 Waterhousc J, Muir CS, Correa P, Powell J', eds. Cancer incidence in five continents. Lyon:IARC, 1976; 456. 26 White IR, Chaturvcdi N, McKciguc PM. Median analysis of blood pressure for a sample including treated hyper- tensives. Star Med 1994;13:1635-41. 27 SAS Institute Inc. SASISTAT user~ guide. Version 6, 4th edition, Gary, NC:SAS Institute Inc, 1989. 28 Wager~necht LE, Perkins LL, Cutter GR,et al. Cigarette smoking behavior is strongly related to educational status: The CARDIA Study. Pr~v Med 1990;19:158-69 Appendix 1 Sites and key personnel of contributing MON= ICA centres. I MONICA COLLABORATING CENTRES Australia University of \Vestem Australia, Nedlands 259 Principal Investigator---M.S.T. Hobbs Key persormel--K Jamrozik, P L Thompson, BK Armstrong University of Newcastle, Newcastle Principal Investigator---A Dobson Key personnel--H Alexander, R Heller Belgium Ghent State University, Ghent Principal Investlgator--G de Backer Key persormel--I De Cmene, P Van Onsem, L Van Parys Interuniversity Association for the Prevention of Cardiovascular Diseases, Brussels Principal Investigator--M Jeanjean Key personnel--C Brohet, H Kulberms, S Degre China Beijing Heart, Lung and Blood Vessel Research Institute, Beijing Principal Investigator--Wu Zhaosu Former Principal Invesdgator--Wu Ying-Kal Key personnel for risk factor surveys--Yao Chonghua, Zhang Ruisong Czech Republic Institute for Clinical and Experimental Medicine, Prague Principal Investlgamr--Z Skodovfi Key persormel--Z Pisa, L Berka, Z Cicha, R Emrovfi, J Pikhartovfi, P Voitisek, Wiesner Denmark Copenhagen University Hospital, Glostrup Principal Investigator--M Schroll Key personnel--M Kirchhoff, A Si~l, T genscn Finland National Public Health Institute, Helsinld Principal Investigator--~ Tuomflehto Former Principal Investigator--P Puska Key personnel for risk factor surveys--C-G Gref, H Korhonen, M ]'auhiainen France Coun~-y Coordinator--~ Richard National Institute of Health and Medical Re- search (U258), Paris Key personnel--A Bingham National Institute of Health and Medical Re- search (I'NSERM 326)~ Toulouse Principal Investigators--JP Cambou, J Ferrieres Key personnel--1-B Ruidavets Institute ofHygienc~Faculty ofMedicine~ Stras- bourg Principal Investigators--D Arveiler, P Schaffer Key personnel--I Escudero, V Baas Pasteur Institute and Study and Research Group on Myocardial Infarction, Lille Principal Investigators--P Amouyel, M Mon- taye-Faivre Former Principal Investigators--j'-L Salomez, M-C Nuttens Key personnel--N Marecaux, C Steclebout Germany GSF-Institute of Epidemiology, Neuherberg/ Munich Principal Investlgator--U Keil Key personnel--J Stieber, A DSring, B Filipiak, U H~rtel, HW Hense Centre for Epidemiology & Health Research, Berlin (from October 1990 Previously German Democratic Republic) Principal Investigators---W Barth, 1". Heinemann Key personnel--A Assmann, S B6thig, G Voigt, S Brasche, D Quietsch, E Classen
Page 68: 2063633553 Log in for more options!
260 Bremer Institute for Prevention Research and Social Medicine, Bremen Principal Investigator--E Greiser Co-Principal Investigator~B Herman Key personnel--G Studemann Department of Clinical and Social Medicine of the University Medical Clinic, Heidelberg Principal Investigator--E Nussel Former Co-Principal Invesfigator--E Ostor- Key persormel--R Scheidt, W Morgenstem, M Stadler Iceland Heart Preventive Clinic, Reykjavik Principal Investigator--N Sigffsson Key persormel--II Gudmundsd6ttir, I Ste- f~nsd6ttir, Th Thorsteinsson, H Sigvaldason Italy Institute of Cardiology, Regional Hospital, Udine Principal Investigator---GA Ferugiio Key personnel--D Vanuzzo, L Pilotto, G Cig- nacco, M Scarpa, M Palmieri, M Spanghero, R Marini, G Zilio University of Milan, Institute of Occupational Health, Milan Principal Invesfigators--43C Cesana, M Ferratio Key personnel--R Sega, P Mocarelli, G DeVito Lthuania Kaunas Medical Academy Institute of Car- diology, Kaunas Principal Invesfigator--J Bluzhas Key personnel for risk factor survey---S Do- markiene, A Tamosiunas, R Reklaitiene New Zealand University of Auckland, Auckland Principal Invesfigator--R Beaglehole Key personnel--R Jackson, R Bonita, A Stewart, • D Mahon, W Bingiey Poland Unit of Clinical Epidemiology and Population Studies, School of Public Health, Jagiellonian University, Krakow Principal Investigator--A Pajak Former Principal InvesfigatornJ Sznaid Key personnel--E Kawalec, T Pazucha, M Nial- czewska, R Momwski, A Celinskl, U Zeman National Institute of Cardiology, Warsaw, De- partment of Cardiovascular Epidemiology and Prevention Principal Invesfigator--SL Rywik Key personnel~ Broda (coordinator), M Po- lakowska, P Kurjata, H Wagrowska Romania Medical Institute, Fundeni Hospital, Bucharest Principal Investigators--C Carp, I Orha Key personnel--E Apetrei, I Coman, M Tarlea Russian Federation State Research Centre for Preventive Medicine, MOSCOW Principal Investigator--TA Varlamova Key personnel--A Britov~ V Konstantinov~ L Pavlova, A AIex~indri, O Konstantinova Institute of Internal Medicine, Novosibirsk Principal Investigator--YuP Nikitin Key personnel--S Malyutina, I Shalaurova Spain Institute of Health Studies, Department of Health and Social Security, Barcelona Molarius, Seidell~ Kuulasmaa, et al Principal Investigators--S Sans, I Balaguer-Vin- tr6 Key personnel--LI Balanfi, G Paluzie, T Puig Sweden Department of Medicine, Ostra Hospital, teborg Principal Investigator--L Wilhelmsen Key personnel--S Johansson, S Piros, G Lappas, Ume~ University Hospital, Lule~-Boden Hos- pital and Kalix Hospital, Departments of Medi- cine Principal Investigator--K Asplund, F Hulatasaari Key personnel--B Stegmayr, V Lundberg Switzerland University Institute of Social and Preventive Medicine, Lausanne Principal Investigator--F Gutzwiller (ZC~ich) Key personnel--M Rickenbach, V Wietlisbach, F Barazzoni, D Hausser United Kingdom The Queen's University of Belfast, Belfast, Northern Ireland Principal Investigator--A Evans Key personnel--E McCrum, T Falconer, S Cash- man University of Dundee, Dundee, Scotland Principal Investigator--H Tunstall-Pedoe Former Co-Principal Investigator (Population Surveys)--WCS Smith Key personnel--R Tavendale, K Barrett, C Brown Former key personnel--I Crombie, M Kenicer USA Stanford Center for Research in Disease Pre- vention, Stanford, California Principal Investigator--SP Fortmann Key personnel--A Varady, M Hull, JW Farquhar Yugoslavia Health Centre "Novi Sad", Novi Sad Principal Investigator--M Piano/eric Former Principal Investigator--D Jakovljevic Key personnel--A Svircevic, M MJrilov, T Strasser II MONICA MANAGEMENT CENTRE--GENEVA World Health Organization, Geneva Responsible Officer--I Gyarfas Former Responsible Officers--Z Pisa, SRA Dod~, S B6thig Key personnel--I Martin, MJ Watson, M Hill Ill MONICA DATA CENTRE--HELSINKI National Public Health Institute, Helsinki, Fin- land Responsible Officer---K Kuulasmaa Former Responsible Officer--J Tuomilehto Key personnel--A-M Koivisto, A Molarius, V Moltchanov, E Ruokokoskl IV MONICA STEERING COMMITTEE A Evans (Chair), M Hobbs (Chair Publications SubCommittee), M Ferrario, H Tunstall-Pedoe CRapporteur), I Gyarfas, K Kuulasmaa, A Shatchkute (WHO, Copenhagen), Consultants--A Dobson, Z Pisa, and OD Wil- liams IV PREVIOUS STEERING COMMITTEE MEMBERS S Sans, F Gutzwiller, SP Fort_mann, A Menotti, P Puska, SL Rywik, U Keil, R Beaglehole, former chiefs of CVD/HOo Geneva, V Zaitsev, J Tuo- milehto Former Consultants--MJ Karvonen, R~ Prineas, M Feinleib, FH Epstein
Page 69: 2063633554 Log in for more options!
2083633554
Page 70: 2063633555 Log in for more options!
~ . - " ~9:~5 XE489 177 ~l HUTAT RES-FUND HOL 11 97 [C]ELSEVZER SOIENCE BV POIR NE Fundamental and Molecular Mechanisms of Mutagenesls ! ELSEVIER Mutation Research 376 (1997) 177-184 Aromatic amine DNA adduct formation in chronically-exposed mice: considerations, for human comparison , Miriam C. Poirier a, , Frederick A. Beland b National Cancer Institute, Bldg. 37 Rm. 3B25, MSC-4255, 37 Convent Drive, NIH, Bethesda, MD 20892-4255, USA b National Center for Toxicological Research, Jefferson, AR 72079, USA Abstract Lifetime chronic exposure of mice to the aromatic amines 4-aminobiphenyl (ABP) and 2-acetylaminofluorene (AAF) produces liver and urinary bladder tumors. In parallel experiments, DNA adduct levels in target tissues reach a steady-state (a balance between adduct formation and removal) after about four weeks of either AAF or ABP ingestion. For these and other carcinogens, steady-state DNA adduct levels most frequently increase linearly with dose, but the formation of tumors also depends upon a variety of factors, including the proliferative capacity of the target tissue, the sex of the animal, genotoxic properties of the specific adducts formed, and other unknown events. Chronic dosing experiments in animal models are of interest for human risk assessment because human exposure is typically intermittent, involving repeated However, it is to be that in genetically-diverse human population, where the lifetime > 70 expected exposures. a averages years, the relationship between tumorigenesis and DNA adduct formation will be relatively more complex than that observed in mice. From our studies of chronic ABP exposure in male mice, we have obtained the daily dose of ABP and the steady-state level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) adduct associated with a 50% mouse bladder tumor incidence. Our attempt at a human extrapolation for adducts and urinary bladder cancer in smoking males (20-40 cigarettes/day) is based on the ABP dose per cigarette, values for the dG-C8-ABP adduct in bladder biopsies of lifetime heavy smokers at age ~ 70, and the smoking-related bladder tumor incidence (absolute lifetime risk) for Caucasian males in the United States aged 65-84 years. The extrapolation has produced two major predictions, one related to adduct formation and the other related to tumorigenesis. First, the observed level of smoking-related dG-C8-ABP in DNA of human bladder epithelium, expressed as a function of daily ABP intake, is about 3500-times higher than similar data for mice, which suggests that humans may perform the biotransformation of ABP more efficiently than mice. Second, at a similar bladder tumor incidence, mouse bladder contained adduct concentrations that were much higher than those observed in human bladder; for example, at a 2.6% tumor incidence, mouse bladder contained an average of 55.5 fmol dG-CS-ABP/Ixg DNA (1850 adducts/10s nucleotides), while bladders from Caucasian male smokers contained an average of 0.036 fmol dG-C8-ABP/I~g DNA (1.2 adducts/10s nucleotides). This suggests that factors other than ABP-DNA adducts, such as adducts of other carcinogens, the influence of promoters, and synergistic effects of all of these factors contribute substantially to smoking-related bladder cancer in humans. Ke~.ords: 4-Aminobiphenyl; Cancer; Lifetime exposure; Bladder; Mouse 1 i " Correspqnding author. Tel.: + 1 (301) 402-1835; Fax: + 1 (301) 496-8709; e-mail: poirierm@dc37a.nci.nih.gov 0027-5107/97/$17.00Copyright © 1997 Elsevier Science B.V. All dghtsrese~ed. PH S0027-510~(97)00041-9 THIS ARTIOLE 15 FOR INDIVIDUAL USE ONLY AND HAY HOT BE FURTHER REPRODUOED OR STORED ELECTRONICALLY NZTHOUT NRITTEN PERHISSZON FROH THE COPYRIGHT HOLDER. UNAUTHORIZED REPRODUCTION HAY RESULT IN FIHANCIAL AND OTHER PEHALTZE$.
Page 71: 2063633556 Log in for more options!
178 M. C. Poirier, F.A. Beland / Mutation Research 376 (1997) 177-184 1. Introduction If DNA adduct levels in humans are to be applied for the prediction of human cancer risk, it may be useful first to explore the relationship between adduct levels and tumorigenesis in animal models before making human comparisons. This study is an attempt to bring together current knowledge concerning the dose of a chemical carcinogen, tumor incidence, and DNA adduct formation in the same target tissue. The chemical carcinogen in question is 4-aminobiphenyl (ABP) and the comparison will be made for urinary bladder cancers in mice given ABP chronically in the drinking water (Poirier et al., 1995) and humans inhaling ABP in cigarette smoke (Patrianakos and Hoffman, 1979; Poirier and Beland, 1992). The anal- ysis is based on certain assumptions, with particular caveats that will be discussed in detail, since the conclusions are only as sound as the underlying data. However, more than providing a definitive statement on mouse-human extrapolation, hopefully this exer- cise will constitute a framework for further thought and discussion. 4-Aminobiphenyl is a potent urinary bladder car- cinogen for both humans (Clayson, 1981) and mice (Schieferstein et al., 1985). Widespread chronic hu- man exposure occurs through cigarette smoking (Patrianakos and Hoffman, 1979), and studies in mice have demonstrated tumorigenesis resulting from continuous lifetime administration in the drinking water (Schieferstein et al., 1985). In this report, data for tumorigenesis and DNA adduct formation in mice chronically-exposed to 2-acetylaminofluorene (AAF) and ABP will be reviewed. In addition, smok- ing-related ABP doses, human bladder DNA adduct levels, and incidence of smoking-related bladder tu- morigenesis in 65-84-year-old Caucasian males in the United States have been obtained from the litera- ture. Finally, the three parameters (chronic dose, DNA adduct level, and tumor incidence) have been compared and extrapolated to elucidate species- specific mechanisms of ABP genotoxicity. Admit- tedly, the extrapolation presented must contain omis- sions; nonetheless, it constitutes an attempt in an iterative process designed to evaluate interspecies comparisons of DNA adduct determinations and. their use in human cancer risk estimation. This prototype analysis has novel conclusions and demonstrates an approach that may eventually be informative for other classes of chemical carcinogens, such as the aflatoxins, heterocyclic amines, and polycyclic aro- matic hydrocarbons. 2. Chronic dosing of aromatic amine carcinogens in mice 2.1. Kinetics of DNA adduct formation and retnoval during chronic carcinogen administration In studies of chemical carcinogens in which a single concentration of compound is given chroni- cally, the DNA adduct levels increase rapidly at first, but a plateau is obtained when the processes govern- ing DNA adduct formation and those responsible for adduct removal reach equilibrium (Poirier and Be- land, 1992; Poirier and Beland, 1994). The magni- tude of the plateau reflects the concentration of chronically-administered carcinogen. For example, in livers of mice given AAF for 56 days at a concentra- tion of 30 mg AAF/kg diet, the adduct plateau was at 32 fmol adduct/l~g DNA, while at 150 mg AAF/kg diet, the plateau was at 105 fmol/~zg DNA (Poirier and Beland, I994). At doses between 30 and 150 mg/kg, the adduct levels at equilibrium are predicted to vary between 32 and 105 fmol/p.g DNA and be proportional to dose. A dose-response profile for multiple doses can be generated by plot- ting DNA adduct levels at a single time point as a function of the carcinogen' concentration for each dose administered (Poirier and Beland, 1992). Six DNA adduct dose-response profiles have been obtained with aromatic amines; these include livers and bladders of male and female mice given ABP chronically in the drinking water (Poirier et al., 1995) and livers and bladders of female mice given AAF in the diet (Poirier et al., 1991). For both compounds DNA adducts were determined in livers and bladders after 28 days of exposure to several doses. In the livers and bladders of female mice exposed to AAF, adduct levels increased linearly with dose through the entire dose range. A similar trend was observed in livers of male mice given ABP. In the bladders of male mice and the livers of female mice given ABP, there was also a linear increase in adduct formation at the four lowest ABP | i | ! ! I I li II
Page 72: 2063633557 Log in for more options!
i i i i i i i ! M. C. Poirier, F.A. Beland / Mutation Research 376 (1997) 177-184 179 doses. In the bladders of female mice, the dG-C8- ABP adduct levels reached a plateau at low doses. Thus, linearity for DNA adduct formation, particu- larly in the lower dose range, was observed in five of the six different dose-response profiles (Poirier and Beland, 1994). 2.2. Mouse tumorigenicity studies The DNA adduct studies described above were modeled on tumorigenicity experiments in which mice were given either AAF in the diet (Staffa and Mehlman, 1979) or ABP in the drinking water (Schieferstein et al., 1985) chronically at several doses for a lifetime. Tumors were observed in livers and bladders. Profiles for tumorigenicity as a func- tion of increasing carcinogen concentration were lin- ear only in livers of female mice exposed to AAF. Low tumor incidences (< 15%) were observed in bladders of female mice given ABP and in livers of male mice given ABP. In bladders of male mice exposed to ABP and female mice exposed to AAF, tumorigenesis was negligible at the lowest doses but increased rapidly at the highest doses; in the case of AAF, this has been attributed to the induction of cell Table 1 Correlation between dose, dG-C8-ABP (mean + SEM) and tumor incidence in bladders of male mice given ABP in the drinking water ABP in ABP dose a Bladder Bladder drinking water dG-CS-ABP tumors (ppm) (wg/kg b.wt./day) (fmol/Ixg DNA) (%) 28 5600 37.7 + 27.9 0% 6300 b 55.5 2.6% 55 11000' 114.64-8.6 17.6% 1 I0 22000 138.8 4- 7.7 48.4% 22400 140 50% a Assuming a 25 g male mouse consuming 5 ml of water per day; b.wt, body weight. b Values in bold were obtained directly from curves of dose vs. adducts and dose vs. tumor incidence (not shown)~ CA value of 2.56% was used for the smoking-related human bladder tumor incidence, but it was not possible to read so accurately from the mouse curves; therefore the incidence used for the mice was 2.6%. 2.3. DNA adducts and tumorigenesis in bladders of male mice given ABP The mouse-human comparison to be generated in this paper will focus on tumorigenesis and DNA adduct formation in bladders of male mice given proliferation at higher doses of carcinogen (Cohen ABP in the drinking water. Bladder tumors were and Ellwein, 1990). Taken together, the data suggest observed by Schieferstein et al. (1985) in male that DNA adducts may constitute a necessary pre-re- BALB/c mice given ABP at six dose levels in the quisite for tumorigenesis, but that other contributing drinking water for 24 months. DNA adducts were I 1 I 1 1 1 1 factors include cell proliferation, sex of the animal, tissue specificity, and additional unknown events. =~ 80 ' "~ 60 20 50 100 150 200 fmol dG-CS-ABP//ag DNA Fig. 1. Relationship between the levels of dG-C8-ABP in bladder DNA of male BALB/c mice administered ABP for 28 days in the drinking water (Poirier 6t al., 1995) and the reported tumor incidence in male BALB/c mice administered the same doses of ABP for 14 to 24 months (Schieferstein et al., 1985). examined in bladders of similarly-treated mice of the same strain given ABP for 28 days. Fig. 1 shows the relationship between bladder tumor incidence and dG-C8-ABP adduct formation at doses of 0, 7, 14, 28, 55, Ii0 and 220 ppm (Schieferstein et al., 1985; Poirier et al., 1'995). Adduct and dose values at tumor incidences of 2.6% and 50% were obtained from the curves of dose vs. tumors and dose vs. adducts, as published previously (Poirier and Beland, 1994; Poirier et al., 1995; Schieferstein et al., 1985); the values are shown in Table 1. 3. Chronic dosing of ABP in humans through smoking 3.]. Overall strategy The strategy employed for the human analysis was to ascertain the smoking-related lifetime abso- i
Page 73: 2063633558 Log in for more options!
180 M. C. Poirier, F.A. Beland / Mutation Research 376 (1997) 177-184 lute bladder cancer risk (bladder tumor incidence) for Caucasian males in the United States, aged 65-84 years, who smoked I-2 packs of cigarettes per day (Hartge et al., 1987 and P. Hartge, personal commu- nication). The daily dose of ABP was estimated based on a published value of 2.4 ng ABP per American cigarette (Patrianakos and Hoffman, 1979; Vineis, 1992). The smoking-related DNA adduct levels are from three different studies in which adducts have been measured in human bladder by different methods (Cuzick et al., 1990; Talaska et al., 1991; Lin et al., 1994). 3.2. Epidemiological studies of smoking-related bladder cancer As an initial approach, expected yearly increases in bladder tumor incidence for Caucasian males in the United States (from Table 2 in Silverman et al., 1992) were summed between ages 20 and 70 and corrected so that individuals with cancer did not remain in the cohort. Thus calculated, the cumulative bladder tumor incidence at age 70 was estimated to be 4.4%. A more accurate, but similar value of 4.82% was calculated (P. Hartge, personal communi- cation) from the most recent SEER cancer statistics (Kosary et al., 1995). Among Caucasian men aged 65-84 in the United States the relative risk of blad- der cancer upon smoking 1-2 packs of cigarettes per day was determined to be 2.13 (95%CI 1.74-2.62) and the population attributable risk for all smoking was 40% (P. Hartge, personal communication). Cal- culated from the population attributable risk (Kosary et al., 1995; P. Hartge, personal communication), the lifetime absolute risk (bladder tumor incidence) asso- ciated with this level of smoking was 2.56%, ob- tained by subtracting a background of 2.26% for non-smokers from the 4.82% value for 1-2 packs/ day smokers. 3.3. DNA adduct quantities in human bladder The measurement of human DNA adducts has often been compromised by a lack of specificity in the methods employed; however, this analysis has been made credible partly because consistent--quanti- tative data a~e available for the dG-C8-ABP in hu- man bladder biopsies in two studies. The adduct levels used in this analysis are from two studies that will be described below (Talaska et al., 1991; Lin et al., 1994). Values from the Talaska and Lin studies are almost identical, and are similar to those reported by Cuzick et al. (1990) for human bladder DNA adducts determined only by 32 P-postlabeling. In the Cuzick study, eight smokers, average age 69 years, had a mean adduct level of 0.103 fmol//~g DNA and 11 non- and ex-smokers, average age 72 years. had a mean adduct level of 0.058 fmol/l~g DNA. By subtraction, the smoking-related adducts were 0.045 fmol/l~g DNA. A more-specific approach was reported by Talaska et al. (1991), who analyzed DNA from human bladder biopsies of 13 smokers (average age 68 years) and 29 non-smokers (average age 69 years) by 32 P-postlabeling. The advantage of this study was that a value was obtained for one adduct spot, found by co-chromatography on HPLC to co-elute with an authentic dG-C8-ABP standard; this adduct appeared to constitute about 20% of the total smoking-related adducts. The average smoking-related butanol-extractable dG-C8-ABP, with values for non-smokers subtracted, was 0.036 fmol/~g DNA. Finally in a third study, (Lin et al., 1994), negative ion gas chromatography/mass spec- trometry was used to measure the dG-C8-ABP adduct in eight urinary bladder mucosa specimens from individuals with unknown smoking habits; the mean for these samples was 0.037 fmol/~g DNA. Be- the Talaska study provided the most extensive cause subject information coupled with good adduct identi- fication, the value of 0.036 fmol/izg DNA was used for the subsequent analysis. 3.4. Extrapolation for correlation between dose, DNA adducts and tumor incidence in bladders of male Caucasian smokers In constructing this analysis, linearity with dose was assumed for tumorigenicity and DNA adduct levels. This approach was considered reasonable r~ since the relative risk of urinary bladder cancer is o linearly related to the extent of cigarette consump- ~r~ tion (Mommsen and Aagaard, 1983). In addition, r.o proliferative histologic changes in the human bladder co are proportional to the extent of cigarette consump- on tion (Auerbach and Garfinkel, 1989). There is no real knowledge of the low end of the human dose-
Page 74: 2063633559 Log in for more options!
iM.C. Poirier, F.A. Beland/Mutation Research 376 (1997) 177-184 181 Table 2 Extrapolation for correlation between dose. dG-C8-ABP, and tumor incidence in bladders of mate human smokers ~ABP dose Smoking-related dG-C8-ABP Smoking-related bladder tumors _| (l~g/kg b.wt./day) (fmol/~g DNA) (%) ~bserved 0.0013 a 0.036 b 2.56% ]~ Extrapolated e 0.0254 . 0.703 50% .~ a 75 kg male smoking 2 packs/day with 2.4 ng of ABP/cigarette. b From Talaska et al. (1991). • / c Smoking-related bladder tumor incidence for Caucasian males in the United States aged 65-84 years who smoked 1-5 packs of cigarettes | per day (P. Hartge, personal communication and Kosary et al., 1995). • ,t Based on linearity for all parameters. / response curv~ for DNA adduct formation in urinary linear extrapolation, the adducts/dose averaged 27.7. bladder; however, at very low dose levels in the Therefore, under steady-state dosing conditions, the • 1 mouse (7-14 ppm of ABP in drinking water) adduct observed level of smoking-related dG-C8-ABP in .~ levels appear to be linear with dose. Table 2 presents human bladder epithelium, expressed as a function of the results of proportional extrapolation to 50% tu- daily ABP intake, is about 3500-fold higher than .~ . mor incidence, based on the previously-discussed similar data for mice. | human values for dose and adducts at the observed The analysis in Table 3 makes no attempt to ~ smoking-related bladder tumor incidence of 2.56%. correct for inter-species dosage comparisons. Using the method of Freireich et al. (1966) to correct for l~ surface area differences between men and mice, • 4. Mouse-human comparison for DNA adduct whatever dose is given to a mouse is divided by 12 • formation as a function of chronic ABP intake to estimate the human equivalent. Therefore, at 2.6% d tumors, the mouse dose of 6,300 ~g/kg b.wt./day, | 4.1. The comparison which was associated with 55.5 fmol adducts/~g -- DNA, would be equivalent to a human dose of 525 • Further analysis of the data in Tables 1 and 2 is Izg/kg b.wt./day. If humans formed adducts at the i shown in Table 3. For the mouse, the data for 2.6% same efficiency as mice, the adducts associated with tumors and 50% tumors were obtained from the a dose of 525 I~g/kg b.wt./day would be 4.0 curves of dose vs. tumors and dose vs. adducts fmol//~g DNA. However, given the ratio of ~ published previously (Poirier and Beland, 1994). In adducts/dose observed in humans, a dose of 525 i the mouse, the ratio of adducts/dose, which suggests /~g/kg b.wt./day would be expected to produce efficiency of adduct formation, was similar at both adduct levels of 14,542 fmol/l~g DNA. Therefore, ~I tumor incidences, and averaged 0.0075. For the hu- even with an inter-species correction for surface I man, where the data at 50% tumors were obtained by area, the ratio of ABP-induced DNA adduct levels to I~ Table 3 i~ Mouse-human comparison at 2.6% and 50% bladder tumor incidence, using data from Table I and Table 2 Species Tumor incidence ABP dose dG-C8-ABP in bladder Adducts/dose l~ (~g/kg b.wt./day) (fmol/p.g DNA) ~ Mouse 2.6% 6300 55.5 0.0088 "~ 50% 22400 140 0.0062 ~ Human 2.56% 0.0013 0.036 27.7 I 0.0254 0.703 27.
Page 75: 2063633560 Log in for more options!
182 M. C. Poirier, F.A. Beland / Mutation Research 376 (1997) 177-184 ABP intake in the human bladder appears to be approximately 3500-fold higher than similar data for the mouse. This comparison further demonstrates that at ei- ther tumor incidence (2.6% or 50%) the dG-C8-ABP levels in mouse bladder were at least 100-fold higher than those observed in human bladder. This suggests that factors other than dG-C8-ABP formation con- tribute significantly to the smoking-related bladder tumor burden. Such factors undoubtedly include DNA adducts of other carcinogens, the influence of promoting agents, and synergistic effects produced by combinations of chemicals. 4.2. The caveats and considerations In this comparison we have analyzed data from mice given ABP in the drinking water and humans receiving ABP by inhalation. Both situations have in common that the target tissue is the same, and is distal from the intake site. In addition, there is no compelling evidence that different metabolic mecha- nisms come into play when aromatic amines enter circulation by these different routes (Kadlubar and Guengerich, 1992; Bois et al., 1995). However, the comparative efficiencies of dose absorption in lung and gastrointestinal tract have not been accounted for, and therefore constitute a possible source of difference. In addition, it has been estimated that the concentration of ABP in sidestream smoke is 10-fold higher than in mainstream smoke (Patrianakos and Hoffman, 1979), suggesting that the actual dose to a smoker might be higher than the 2.4 ng per cigarette contained in mainstream smoke. The quantitative uncertainties in the 32 P-postlabel- ing assay are a possible source of error. However, by choosing a study in which the dG-C8-ABP adduct spot was identified by HPLC, at least the identity of adduct is clear. Also, the quantity reported by Ta- laska et al. (1991) appears to be sound by compari- son with the very similar numbers obtained using GC-MS (Lin et al., 1994). It is possible that these values are not completely representative, since the number of individuals was small, and further adduct studies of human bladder biopsies using different techniques are clearly warranted. In mouse liver (Poirier et al., 1995), adduct values determined by radioimmunoassay and 32p-postlabeling were very comparable, indicating that values for bladder deter- mined only by 32p-postlabeling, and used in this analysis, should also be valid. Another possible source of error is the assumption of linearity between dose and tumors, and dose and adducts for the human smokers. However, there is strong evidence in a study by Mommsen and Aa- gaard (1983) that the relative risk of developing bladder cancer for men increases linearly with the lifetime consumption of cigarettes. Also, a study by Auerbach and Garfinkel (1989) has shown that pre- neoplastic morphoiogic changes in human bladder epithelium, including atypical nuclei and hyperpla- sia, increase as a function of daily cigarette con- sumption. In addition, the weight of evidence from studies of AAF and ABP in mice suggests that the assumption of linearity at very low doses is reason- able. One important consequence of this analysis is the suggestion that human bladder cancer is higher than would be expected by just comparing ABP adducts in both species. Clearly there are other smoking-re- lated DNA adducts that have been observed bv 32P-postlabeling. Talaska et al. (1991) found that levels of total smoking-related butanol-extractable adducts were about 5-fold higher than the observed dG-C8-ABP levels; absolute quantitation cannot be determined given the unknown efficiency of uniden- tified adduct phosphorylation in 3ZP-postlabeling. However, the mutagenic efficiencies of some of these unknown adducts may vary and the bladder epithelial replication rate may not be the same for the two species. In addition, large interindividual differences in metabolism are known to exist (Kadlubar and Guengerich, 1992) and an attempt to model this using parameters from the dog predicted at least a 1000-fold interindividual variability in humans. Synergistic effects of carcinogens and pro- moting agents may enhance the tumor incidence more than would be otherwise observed if exposure were only to one carcinogen or one promoter. Future analyses may be able to incorporate some of these presently-unknown variables. 5. Conclusions Bound by the conditions and caveats stated here. the analysis has produced two major predictions. | |. |_ | |
Page 76: 2063633561 Log in for more options!
i i M. C. Poirier, F.A. Beland / Mutation Research 376 (19971 177-184 First, that as a function of daily ABP intake, humans chronically exposed to ABP through cigarette smoke have about 3500-fold more dG-C8-ABP adducts in bladder epithelium than mice given ABP daily in the drinking water. The implication is that human may perform the biotransformation of ABP more effi- ciently than mice. Second, at any bladder tumor incidence between 2.6% and 50%, mouse bladder DNA contained much higher adduct levels than hu- bladder DNA. At 2.6% there was a 1400-fold man difference and at 50% there was a 170-fold differ- ence. This suggests that factors other than ABP-DNA adducts, contribute substantially to smoking-related bladder cancerin humans. The overall implication is that the dG-CS-ABP adduct alone contributes less to tumor formation in the human, under conditions of chronic smoking exposure, than it does in the mouse, given chronic dosing on a controlled experimental protocol. A number of factors may produce these inter- species differences. Mice have a 2-year lifespan and a very rapid metabolic rate. Humans live for more than 70 years and have a slower overall metabolism. It is possible that this allows time for mutations to accumulate in many different critical genes. In addi- tion, the longer life span allows time for exposure to other chemical carcinogens, as well as inflammatory and promoting agents that may act in concert to accelerate tumorigenesis. Again, the potential influ- ence of other smoking-related toxicities to exert syn- ergistic tumorigenic effects should not be underesti- mated. As more extensive chronic dosing studies are performed in rodents, and human epidemiologic and DNA adduct data become available, this type of analysis may be possible for other classes of chemi- carcinogens, as aflatoxins, heterocyclic cal such amines and polycyclic aromatic hydrocarbons, and may be useful for the application of human DNA adduct information within the framework of human cancer risk assessment. Acknowledgements 183 The authors wish to extend thanks to Drs. Patricia i Hartge, Fred Kadlubar, Nathaniel Rothman and Stu- art Yuspa critical reading of the manuscript and discussions of the analysis. In addition, we are greatly indebted to Dr. Hartge for calculating the lifetime human bladder cancer incidence from her own data and recent SEER statistics. The editorial assistance of Margaret Taylor is much appreciated. References Auerbach, O. and L. Garfinkel (1989) Histologic changes in the urinary bladder in relation to cigarette smoking and use of artificial sweeteners, Cancer, 64, 983-987. Bois, F.E., Krowech, G. and L. Zeise (1995) Modeling human interindividual variability in metabolism and risk: the example of 4-aminobiphenyl, Risk Anal,, 15, 205-213. Clayson, D.B. (1981) Specific aromatic amines as occupational bladder carcinogens, Natl. Cancer Inst. Monogr., 58, 15-19. Cohen, S.M. and L.B. Ellwein (1990) Proliferative and genotoxic cellular effects in 2-acetylaminofluorene bladder and liver carcinogenesis: biological modeling of the ED01 study, Toxi- col. Appl. Pharmacol,, 104, 79-93. Cuzick, J., M.N. Routledge, D. Jenkins and R.C. Garner (1990) DNA adducts in different tissuesof smokers and non-smokers, Int. J. Cancer, 45, 673-678. Freireich, E.J., Gehan, E.A., Rail, D.P., Schmidt, L.H. and H.E. Skipper (1966) Quantitative comparison of toxicity of anti- cancer agents in mouse, rat, dog, monkey and man, Cancer Chemothe. Rep., 50, 219-244. Hartge, P., D. Silverman, R. Hoover, C. Schairer. R. Altman, D. Austin, K. Cantor, M. Child, C. Key, L.D. Marrett, T.J. Mason, J.W. Meigs, M.H. Myers, A. Narayana, J.W. Sullivan, G.M. Swanson, D. Thomas and D. West (1987) Changing cigarette habits and bladder cancer risk: a case-control study, J. Natl. Cancer Inst., 78, 1119-1125. Kadlubar, F.E and F.P. Guengerich (1992) Inducibility of human cytochromes P-450 primarily involved in the activation of chemical carcinogens, Chemosphere, 25, 201-204. Kosary, C.L., L.A.G. Ries, B.A. Miller, B.F. Hankey, A. Harras and B.K. Edwards (Eds.) (1995) SEER Cancer Statistics Re- view, 1973-1992: Tables and Graphs, National Cancer Insti- tute, NIH Pub. No. 96-2789, Bethesda, MD. Lin, D, J.O. Lay, M.S. Bryant, C. Malaveille. M. FrieSen, H. Bartsch, N.P. Lang and F.F. Kadlubar (1994) Analysis of 4-aminobiphenyl-DNA in human urinary bladder and lung by alkaline hydrolysis and negative ion gas chromatography/mass spectrometry, Environ. Health Perspect., 102 (Suppl. 6), 11- 16. Mommsen, S. and J. Aagaard (1983) Tobacco as a risk factor in bladder cancer, Carcinogenesis, 4, 335-338. Patrianakos, C. and D. Hoffman (1979) Chemical studies of tobacco smoke, J. Anal. Toxicol., 3, 150-154. Poirier, M.C., N.F. Fullerton, T. Kinouchi, B.A. Smith and F.A. Beland ~t991) Comparison between DNA adduct formation and tumorigenesis in livers and bladders of mice chronically fed 2-acetylaminofluorene, Carcinogenesis, 12. 895-900.
Page 77: 2063633562 Log in for more options!
184 M.C. Poirier, F.A. Beland / Mutation Research 376 (1997) 177-184 Poider, M.C., N.F. Fullerton, B.A. Smith and F.A. Beland (1995) DNA adduct formation and tumorigenesis in mice during the chronic administration of 4-aminobiphenyl at multiple dose levels, Carcinogenesis, 16, 2917-2921. Polder, M.C. and F.A. Beland (1992) DNA adduct measurenients and tumor incidence during chronic carcinogen exposure in animal models: implications for DNA adduct-based human cancer risk assessment, Chem. Res. Toxicol., 5, 749-755. P0irier, M.C. and F.A. Beland (1994) DNA adduct measurements and tumor incidence during chronic carcinogen exposure in rodents, Environ. Health Perspect., 102 (Suppl 6), 161-165. Sehiefersteia, G.L, N.A. Littlefield, D.W. Gaylor, W.G. Sheldon and G.T. Burger (1985) Carcinogenesis of 4-aminobiphenyl in BALB/cStCrlfC3Hf/Nctr mice, Eur. J. Cancer Clin. Oncol., 21, 865-873. $ilverman, D.T., P. Hartge, A.S. Morrison and S.S. Devesa (1992) Epidemiology of bladder cancer, Hematol. Oncol. Clin. North. Am., 6, 1-30. Staffa, J.A. and M.A. Mehlman (1979) Innovations in cancer risk assessment (ED0f) study, J: Environ. Pathol. Toxicol., 3. 1-246. Talaska, G., A.Z. A1-Juburi and F.F. Kadlubar (1991) Smoking related carcinogen-DNA adducts in biopsy samples of human urinary bladder: identification of N-(deoxyguanosin-8-yl)-4- aminobiphenyl as a major adduct, Proc. Natl. Acad. Sci. USA. 88, 5350-5354-. Vineis, P. (1992) Epidemiological models of carcinogenesis: the example of bladder cancer, Cancer Epidemiol. Biol. Prey.. 1. 149-153. I I
Page 78: 2063633563 Log in for more options!
2063633563
Page 79: 2063633564 Log in for more options!
Life-Style Factors and Female Infertility ~ermaine M. Buck,z Lowell E. Sever,2 Ronald F_.. Batt,3,4 and Pauline Mendola1 We summarize the epidemiologic literature on the effect of life-style factors such as cigarette smoking, alcohol and caffeine consumption, physical exercise, body mass index, and drag use on female infertility. We identified relevant papers through MEDLINE, Index Medicus, and a manual review of reference lists. Risk factors that affect the risk of primary tubal infertility and that were corroborated in two or more studies include use of intrauterine devices (especially the Dalkon Shield) and cigarette smoking. We identified extremes in body size as a risk factor for primary ovulatory infertility. Cocaine, marijuana and alcohol use, exercise, caffeine consumption, and ever.u.se of thyroid medications were possible risk factors for various sub- types of primary infertility. Few risk factors have been assessed or identified for secondary infertility or other less common subtypes, such as cervical or endometriosis-related infertility. (Epidemiology 1997;8:435-441) Keywords: infertility, smoking, alcohol, drugs, exercise, contraception. Infertility affects approximately 2-3 million married couples in the United States3 Prevalence varies by the criteria used for operational definitionsz and choice of denominator. Although infertility is characterized by the absence of pregnancy (or a livebirth), its impact on women's health status, such as increased cancer risk,3-5 is much broader in scope, raising a number of public health concerns. Here, we review life-style factors for female infertility and identify avenues for further study. We excluded occupational factors, sexually transmitted diseases (STDs), and pelvic inflammatory disease (PID), because they were the subject of earlier reviews.6-8 We organized this paper by clinical subtype of infertility, rather than by exposure, to demonstrate the paucity of research on select subtypes and in recognition of their distinct eti- ologies. We searched the MEDLINE database, using infertility and the exposure variables as keywords, and reviewed Index Medicus and published reference lists. We selected only peer-reviewed papers published in English. We prepared this review according to the published guide- lines for epidemiologic review papers.9-12 From the Departments of ~Social and Preventive Medicine and 3Gynecology- Obstetrics, State University of New York at Buffalo, Buffalo, NY; ZBattelle/ Centers for Public Health Research and Evaluation, Seattle, WA; and 4Millard Fillmore Suburban Hospital, Buffalo, NY. Address correspondence to: Germaine M. Buck, Department of Social and Preventive Medicine, State University of New York at Buffalo, 270 Farber Hall, Buffalo, NY 14214. Submitted January 12, 1996; final version accepted December 29, 1996. © 1997 by Epidemiology Resources Inc. THZ$ ARTZCLE ZS FOR ZNDZVZDUAL USE ONLY AND NAY NOT BE FURTHER REPRODUCED OR ˘ STORED ELECTRONZCALLY ~ITHOUT NRZTTEN' PERNISSZON FRON THE COPYRZGHT , UNAUTNORZZED RE HOLDER 7 ZN FZNANOZAL u~R~OUOTZOH MAY RESULT A,,u uTHER PF-NALTZE~. ~ Terminology Infertility is typically defined as the absence of preg- nancy after 12 or more months of regular unprotected intercourse.13 This definition originally was intended to identify when couples should seek medical care,~4 but it has been varied to include a longer time period or restricted to denote the absence of tivebirths.15 Demography has distinct conceptual and method- ologic definitions for fecundity and fertility that contrast with the inconsistent use of these terms by epidemiolo- gists. Fecundity refers to the biological capacity to con- ceive, whereas fertility refers to the ability to reproduce or bear a liveborn offspring.16'z; As such, the absence of conception (infecundity) is only one of many dimen- sions of infertility. Types and Subtypes of Infertility Epidemiologic studies of infertility have addressed pri- mary infertility, or the inability to become pregnant among women who have never been pregnant, and secondary infertility, or the inability to become pregnant or carry a pregnancy to term among women who have previously been pregnant regardless of outcome.~S,~9 Both types of female infertility can be further classified by diagnostic subtype: tubal, ovulatory, uterine/peritoneal, cervical, other factor, and unexplained. The first three subtypes account for half of couple-based infertility.~s Male factor infertility is diagnosed in 40-50% of infer- tile couples; male factor alone accounts for 20-30% of couple-based infertility,z°,n Detection bias is a notewor- thy consideration for epidemiologic studies focusing on infertility, given that a large percentage of couples may have multiple ca.uses identified. The availability of di- agnostic technology can affect the identification and classification of infertile women.= 435
Page 80: 2063633565 Log in for more options!
:7 436 BUCK ET AL Epidemiology July 1997, Volume 8 Number 4 Seeking Medical Care Selection bias is reported to threaten the validity of epidemiologic studies that rely exclusively on couples who seek medical services,z3-z5 Reasons commonly cited for women seeking medical care include more abundant reproductive services, greater public awareness and ac- ceptance, and fewer adoptable infants.26,z7 Educational attainment of >9 years, nulliparity, and younger age were associated with seeking medical care in two foreign studies.Z3.2s According to data from the National Survey of Family Growth (NSFG), 52% of women with primary infertility and 22% with secondary infertility reported seeking medical services,z4 These figures include women who were unable to become pregnant or carry a pregnancy to term. Women who sought care for primary infertility were more likely to have used contraception than women who did not seek care. Nonusers of care were older, married longer, and older at first intercourse than users of medical care. Women with secondary infertility who sought care were more likely than women who did not seek care to be white, to have higher incomes and educations, and to have used contraception,z4 The prevalence of medical care-seeking behavior ranged from 32% to 95% for women with primary in- fertility, and from 22% to 79% for women with second- ary infertility in three cross-sectional studies,z9 These ranges indicate that not all infertile couples seek care. The extent to which women who seek care differ from those who do not in relation to life-style factors is unknown, however. Prevalence The incidence of infertility is unknown; prevalence var- ies worldwide.3° The prevalence of "current" infertility ranges from 3.6% to 14.3% and "lifetime" infertility from 12.5% to 33.6%.29 In the United States, the per- centage of infertile women ages 15-44 years was re- ported to have decreased from 11.2% in 1965 to 7.9% in 1988.1 When surgically sterile women were removed from denominators, prevalence rates were 13.3% and 13.9%, respectively.13 Both race and age are associated with infertility; increasing prevalence rates for black and young (20-24 years) women have been reported.13a4'19 The percentage of infertile women ages 20-24 years increased from 4% in 1965 to 10% in 1982. Black women were 1.5 times more likely to report infertility than white women. Most prevalence data for the United States are derived from the National Fertility Study31 or Cycles II-IV of the National Survey of Family Growth.1,32 These cross-sectional surveys estimdte the prevalence of self-reported infertility among married" women and assume that current users of contraception are fecund. Age is an important factor for female infertility and is inversely related to fecundity)>3e Consideration of the underlying female age distribution is essential for com- paring rates.3°'37 Life-style factors that may account for variations in infertility rates include earlier age at first intercourse, delayed age at marriage or first birth, con- traceptive practices, and exposure to sexually transmit- ted diseases.3s-42 Several factors can increase prevalence estimates: in- clusion of all infertile women regardless of marital status, lifetime rather than current infertility, and exclusion of sexually inactive or sterile women from denominators.29 Factors that can decrease prevalence estimates entail: including women not at risk for pregnancy in denomi- nators, or restricting numerators to women who seek care, or restricting numerators to women who attempt pregnancy for more than 12 months. Life-Style Factors We listed studies that met our inclusion criteria in Table 1. Many of these studies stem from the two landmark case-control studies that assessed contraceptive practices and risk of female (tubal) infertility.43,44 These two early studies are similar with regard to their heterogeneous groups of infertile women who sought medical care and participated in personal interviews, but they differ by source of controls (birth certificates and hospitals, re- spectively). TUBAL INFERTILITY Daling et a143 conducted detailed in-home interviews with 159 women with primary tubal infertility and I59 parous control women. Cases were women residents of King County, WA, ages 20-39 years, who visited phy- sicians for infertility services between 1979 and 1981. Controls were women who had their first livebirth dur- ing the calendar year after the year in which cases reported attempting pregnancy. Controls were matched individually to cases on race, census tract of residence, and age (---5 years). They reported an increased risk of primary tubal infertility for women with a history of intrauterine device use [odds ratio (OR) = 2.6; 95% confidence interval (CI) = L3-5.2], especially if associ- ated with pelvic inflammatory disease (OR = 3.0; 95% CI = 1.2-7.3). Use of the Dalkon Shield conferred the highest risk [relative risk (RR) = 6.8; 95% CI = 1.8- 25.21. Cramer et a144 conducted a large mukicenter case- control study to assess past contraceptive use and subse- quent risk of tubal infertility. They identified cases from seven clinical centers in the United States and Canada between January 1981 and June 1983. A heterogeneous group of infertile women (N = 1,880) was identified, of which 283 women had primary and 69 had secondary tubal infertility. Women who had given birth at partic- ipating hospitals served as controls and were matched to cases on age, race, and payment status. The investigators used a life events calendar approach to collect contra- deprive information. Past intrauterine device use was associated with an increased risk of tubal infertility. The adjusted risk of tubal infertility associated with intrauter- ine device use before a livebirth was twofold (RR = 2.0; 95% CI = 1.5-2.6). Risk was greatest for users of the Dalkon Shield (RR = 3.3; 95% CI = 1.7-6.1) and
Page 81: 2063633566 Log in for more options!
Epidemiology July 1997, Volume 8 Number 4 LIFE-STYLE AND FEMALE INFERTILITY 437 TABLE 1. Chronologic Summary of Epidemiologic Studies* Focusing on Life-Style Factors and Female Infertilityt Author, Type/Subtype of Life-Style Factor Year Design Infertility (Statistical Analysis) Life-Style Findings Daling et al,4~ 1985 • Population.based case-control I° tubal Prior use of IUD • 159 nulligravid cases with (conditional logistic tubal infertility regression) • 159 matched parous controls Cramer et al,~4 1985 Daling eta/,49 1985 Green et a/,54 1986 • Multicenter case-control 1° and 2° tubal Prior use of IUD • 283 cases with primary tubal (multivariate logistic infertility regression) • 69 cases with secondary tubal infertility • 3,833 parous controls • Population-based case-control (subset Daling et a143) • 127 women 2° tubal infertility and 395 parous controls • Population-based case-control (subset Daling et a143) • 187 1° ovulatory and 159 2° ovulatory infertility cases including those with other possible reasons for infertility • 187 controls for 1° infertility cases and 419 parous controls for 2° infertile cases Crameret a/,4s 1987 • Multicenter case-control 1° tubal • 283 nulliparous cases of tubal (primary) infertility • 3,833 parous controls (subset Cromer et 0./44) 2° tubal Induced abortion (logistic regression) 1° and 2° ovulatory Regular vigorous exercise and weight-for-height (1° conditional logistic regression, 2° unconditional logistic regression) Barrier methods and oral contraceptives (multivariate logistic regression) I. Ever- vs never-use of IUD (RR = 2.6; 95% CI = 1.3-5.2) 2. Ever-use of Dalkon Shield (RR = 6.8; 95% CI = 1.8-25.2) 1. Any IUD use relative to nonuse and 1° infertility (RR = 2.0; 95% CI = 1.5-2.6) 2. Use of Dalkon Shield and 1° infertility (RR = 3.3; 95% CI = 1.7- 6.1) Legal abortion did not increase risk of 2° tubal infertility (RR = 1.15; 95% CI = 0.70-1.89), even after :'2 abortions (RR = 1.29; 95% CI = 0.39-4.20) I. Exercise lasting ->60 minutes/day increased risk of i° ovulatory infertility (RR = 1.9; 90% CI = 0.6-5.1). Excluding women with tubal dysfunction (RR = 6.2; 90% CI = 1.00-39.8) 2. Little effect on risk of 2° ovulatory infertility (OR = 0.9; 90% CI = 0.2- 3.6) I. Ever-use of barrier methods decreased risk (RR = 0.6; 95% CI = 0.5-0.8) 2. Little effect for ever- use of oral contraceptives (RR = 1.2; 95% CI = 0.8-1.6) Phipps et al,46 1987 • Multicenter case-control 1° tubal, cervical, Cigarette smoking 1. • 901 infertile women ovulatory, endometriosis (multivariate logistic • 1,264 parous controls (subset regression) Cramer et a144) Current smoking increased risk of tubal (RR = 1.6; 95% CI = 1.1-2.2) and cervical infertility (RR = 1.7; 95% CI = 1.0- 2.7), respectively Table continues * Restricted to studies that classified infertility by type and diagnostic subtype. ~" OR = odds ratio; RR = relative risk; CI = confidence interval; IUD = intrauterine device; 1° = primary infertility; 2° = secondary infertility; BMI = body mass index.
Page 82: 2063633567 Log in for more options!
438 BUCK ETAL Epidemiology July 1997, Volume 8 Number 4 TABLE 1. Continued Author, Type/Subtype of Life-Style Factor Year Design Infertility (Statistical Analysis) Life-Style Findings Green et al,5s 1988 Mueller et al,5° 1990 Orodstein et al,s~ 1993 Orodstein et al,ss 1993 • Population-based case-control (subset Daling et al4~) • 204 cases 1" ovulatory infertility and 172 2° ovulatory infertility • 204 parous controls for 1° and 461 parous controls for 2° infertile cases • Population-based case-control • (su~bset Daling et a143) • 150 nulligravid cases of ovulatory dysfunction and 84 nulligravid cases of tubal infertility • 150 parous controls for cases of ovulatory infertility and 84 parous controls for cases of tubal infertility • Multicenter case.control (subset Cramer er al~) • 1,050 white, primary infertile • 3,833 pamus white controls • Multicenter case-control (subset Cramer et a144) • 597 cases with I° ovulatory infertility • 3,833 parous white controls 1° and 2° ovulatory 1" tubal, ovulatory 1° tubal, ovulatory, cervical, endometriosis 1° ovulatory Body weight-for-height ( conditional logistic regression, 2° unconditional logistic regression) Recreational drag use (conditional logistic regression) Self-reported caffeine consumption (multivariate logistic regression) Self-reported prescription and nonprescription drag use (crude odds ratios, some logistic regression) 1. Body weight-for- height <-85% than ideal increased risk of 1° ovulatory infertility (RR = 4.7; 95% CI = 1.5- 14.7), also >120% of ideal weight (RR = 2.1; 95% CI = 1.0-4.3) 2. Slight effect of body weight <-85% on 2° ovulatory infertility (OR = 1.6; 95% C[ = O.7-3.4) 1. Marijuana use increased risk of ovulatory infertility (RR = 1.7; 95% CI = 1.0-3.0), especially use within year preceding attempted pregnancy (RR = 2.1; 95% CI = 1.1-4.0) 2. Cocaine use increased risk of tubal infertility (RR = 11.1; 95% CI = 1.7-70.8) 1. >7 gm of caffeine per month increased risk of tubal infertility (RR = 1.5; 95% CI = 1.1- 2.0), endometriosis- related infertility (RR = 1.6; 95% CI = 1.1-2.4), and cervical infertility (RR = 1.4; 95% CI = 0.9-2.3) I. Ever-use of thyroid replacement hormones (RR = 2.3; 95% CI = 1.5- 3.5), antidepressants (RR = 2.9; 95% CI = 0.9-8.3), asthma medication (RR = 1.7; 95% CI = 0.7- 3.5), and tranquilizers (RR =' 1.6; 95% CI = 0.7- 3.1) increased risk of ovulatory infertility Table continues 0 O~ O~ ~;
Page 83: 2063633568 Log in for more options!
Epidemiology July 1997, Volume 8 Number 4 LIFE-STYLE AND FEMALE INFERTILITY 439 TABLE 1. Continued Author, Type/Subtype of Life-Style Factor Year Design Infertility (Statistical Analysis) Life-Style Findings i;7 Grodstein eta/,57 1994 • Multicenter case.control 1° ovulatory Self-reported BMI (crude !" "-, (subset Cramer et a/44) odds ratios and some • 597 cases with I° ovulatory multivariate logistic ., '~ infertility regression) f. • 1,695 l~rimiparous white controls Orodstein et al,s3 1994 • Multicenter case-control (subset Cromer et a/44) • 1,050 white cases with 1° infertility and 3,833 parous white controls 1° ovulatory, cervical, endometriosis, idiopathic Self-reported alcohol consumption (multivariate logistic regression) 1. BMI ---27 (obese) (RR = 3.1; 95% CI = 2.4-4.4) or BMI <17 (RR = 1.6; 95% CI = 0.7-3.9) increased risk of ovulatory infertility 2. High BMI greatest risk factor for women with ' polycystic ovary disease (RR = 6.0; 95% CI = 3.5-10.0) 1. Moderate alcohol use (-<100 gmper week) increased risk of endometriosis- related infertility (OR = 1.6; 95% CI == 1.1-2.3) 2. Heavy alcohol use (>100 gm per week) " increased risk of ovulatory infertility (OR = 1.6; 95% CI = 1.1-2.3) lowest for users of copper devices (RR = 1.6; 95% CI = 1.1-2.4). Intrauterine device use accompanied by a his- tory of infection conferred a threefold increase in risk (RR = 3~3; 95% CI = 1.8-6.1). Cramer et a/45 also evaluated the risk of tubal infertil- ity associated with past use of barrier methods or oral contraceptives. Users of barrier methods were at reduced risk of tubal infertility (RR = 0.6; 95% CI = 0.5-0.8). Past oral contraceptive use had no overall effect on tubal infertility, albeit a weak suggestion that risk increased directly with estrogen content. Phipps et a146 assessed the relative risk of primary infertility for current cigarette smokers according to four subtypes of infertility. Subjects included 901 women with primary infertility and 1,264 parous controls. Cur- rent cigarette smoking increased the risk of tubal (RR = 1.6; 95% CI = 1.1 = 2.1) and cervical infertility (RR = 1.5; 95% CI = 1.0-2.1). Comparable relative risks were observed when the analysis was restricted to women with a primary diagnosis of tubal (RR = 1.6; 95% CI = 1.1-2.2) or cervical (RR = 1.7; 95% CI = 1.0-2.7) infertility. Daling47 reported a similar increased risk for primary tubal infertility (RR = 2.7; 95% CI = 1.4-5.3) among smokers in comparison with nonsmokers. Olsen et al4s also reported that smoking increased the risk of primary (OR = 1.6; 95% CI = 1.1-2.2) and secondary (OR = 2.1; 95% CI = 1.3-3.6) subfecundity (defined as infer- tility of at least 1 year's duration). Daling et a149 evaluated the risk of secondary tubal infertility in relation to past history of an induced abor- tion. They observed only a slight elevation in risk (RR = 1.15; 95% CI = 0.70-1.89) among the 127 cases and 395 control women. Two other life-style factors have been linked to tubal. infertility. Mueller et al5° reported that recreational co- caine use increased the risk of primary tubal infertility (RR = 11.1; 95% CI = 1.7-70.8). Grodstein et alsl reported that caffeine consumption of >7 gm per month increased the risk of primary tubal infertility (RR = 1.5; 95% CI = 1.1-2.0). OVULATORY INFERTILITY Joesoef ct a~5z assessed the relation between self-reported caffeinated beverage consumption and primary infertil- ity in a study comprising 1,765 primiparous control women and 1,818 women with primary infertility. Total caffeine consumption of >7 gm per month.reflected little increase in the fecundability ratio (OR = 1.03; 95% CI = 0.92-1.16) after controlling for confounders, suggesting little effect on primary infertility. Similarly, Orodstein et al~1 observed that caffeine consumption of >7 gm per month had little effect on ovulatory infertil- ity in their case-control study (RR = 1.1; 95% CI = 0.9-1.4). Grodstein et al~3 analyzed heavy alcohol consumption and risk of ovulatory infertility. Cases were 1,050 women who sought care and were compared with 3,833 parous controls. Using average weekly intakes, they categorized women as moderate (>100 gm per week) or heavy (> 100 gm per week) drinkers. Heavy alcohol consump- tion increased the risk of ovulatory infertility (RR = 1.6; 95% CI = 1.1-2.3). Green et 0./54 assessed the role of physical exercise and risk of ovulatory infertility. They defined self-reported vigorous exercise as aerobic activity in excess of a spe- cific number of kilocalories per minute. Vigorous exer-
Page 84: 2063633569 Log in for more options!
440 ~ BUCK ET AL cise for >--60 minutes per day was associated with an increased risk of primary ovulatory infertility (RR = 1.9; 90% CI = 0.6-5.1), but not secondary ovulatory infer- tility (RR = 0.9; 90% CI = 0.2-3.6). The effect of exercise did not appear to be confounded by body weight. Green et a155 analyzed extremes in body size in relation to ovulatory infecundity. They found a 4.7-fold (95% CI = 1.5-14.7) increase in risk of primary ovulatory infertility for women whose body weight-for-height was 85% or less than "ideal," using the Metropolitan Life Insurance tables26 They observed a smaller effect for women 120% or more over ideal weight (RR = 2.1; 95% CI = 1.0-4.3). Among women with secondary infertil- ity, body weight <-85% of ideal increased risk moder- ately (OR = 1.6; 95% CI = 0.7-3.4), and body weight >-120% of ideal (OR = 1.1; 95% CI = 0.7-1.8) slightly increased risk. Grodstein et a/57 reported that body mass indices of >-27 or <17 were associated with an increased risk of primary ovulatory infertility (RR = 3.1; 95% CI = 2.4-4.4 and RR = 1.6; 95% CI = 0.7-3.9, respectively). Mueller et also studied 150 women with primary ovu- latory dysfunction and 150 parous controls to assess the relation between recreational drug use and ovulatory infertility. History of marijuana use increased the risk of ovulatory infertility (RR = 1.7; 95% CI = 1.0-3.0); risk was greatest among women reporting recent marijuana use (RR = 2.1; 95% CI = 1.1-4.0). Grodstein et a158 assessed prescription and nonpre- scription drug use and primary ovulatory infertility. Among 597 women with primary ovulatory infertility and 3,833 parous controls, they found elevated relative risks for self-reported ever-use of thyroid hormones for >6 months (RR = 2.3; 95% CI = 1.5-3.5) or antide- pressants for >6 months (OR = 2.9; 95% CI = 0.9- 8.3 ).58 They found elevated risks for use of pain relievers (RR = 1.4), tranquilizers (RR = 1.6), and asthma drugs (RR = :.7). CERVICAL AND ENDOMETRIOSIS-RELATED INFERTILITY Few epidemiologic studies have attempted to assess risk factors specifically for cervical or endometriosis-related infertility. Phipps et a/46 reported that cigarette smoking increased the risk of cervical infertility (RR = 1.5; 95% CI = 1.0-2.1). Subsequently, Grodstein et al5~ reported that caffeine consumption of >7 gm per month slightly increased the risk of primary cervical infertility (RR = 1.4; 95% CI = 0.9-2.3). Grodstein et al~3 analyzed the relation between moderate alcohol use and cervical, endometriosis-related, and idiopathic infertility. Moder- ate alcohol (<-100 gm) use increased the risk of endo- metriosis-related infertility (OR = 1.6; 95% CI = 1.1- 2.3), even after adjusting for potential confounders. They observed a slight increase in risk for cervical in- fertility (OR = 1.3; 95% CI = 0.8-2.1) and a reduced risk for idiopathic infertility (OR = 0.9; 95% CI = 0.5-1.4). In a recent case-control study of endometriosis with two sets of controls (friend and medical), Darrow et a159 Epidemiology July 1997, Volume 8 Number 4 reported that cases were more likely than friend controls to report problems becoming pregnant (78% and 15%, respectively), despite similar intercourse and contracep- tive histories. The authors did not provide more specific information on infertility. Grodstein et al5~ identified caffeine consumption of >7 gm per month as a risk factor for endometriosis-related infertility (RR = 1.6; 9596 CI = 1.1-2.4). Conclusions The studies evaluated in this review provide evidence that life-style factors may increase the risk of various diagnostic subtypes of infertility. Much of the evidence stems from two population-based case-control studies of infertile women who sought medical services and were (presumably) accurately diagnosed and classified by type and subtype of infertility. Some risk factors were ob- served consistently across studies, despite differences in populations, control groups, and data collection proce- dures. Most published results address either tubal or ovula- tory infertility. Noticeably absent are studies of infertil- ity stemming from cervical problems, endometriosis, im- munologic causes, or other factors. The absence of such study may be one reason why life-style risk factors have been more clearly linked to tubal and ovulatory infertil- ity. Available data support cigarette smoking and past intrauterine device use as risk factors for tubal infertility and extremes in body size for ovulatory infertility. Unanswered questions pertaining to the role of life- style factors and female infertility include the timing and duration of exposures (lifetime or in the 12 months before attempting pregnancy) and the consistency of risk factors across subtypes of infertility. New epidemiologic studies of sufficient size and scope, encompassing all types and subtypes of infertility, would be instrumental in identifying' risk factors for specific diagnostic subtypes of infertility. Such research may help individuals alter or engage in behaviors that minimize the risk of infertility. We believe that additional descriptive work is needed, especially with respect to understudied aspects of infer- tility, such as whether or not the infertility is resolved, and previously unstudied groups of women (for example, unmarried women, Hispanic women). Motivational and behavioral factors that prompt women to seek care need to be examined to address concerns pertaining to selec- tion bias. Studies involving women diagnosed and treated more recently are also needed, given advances in reproductive endocrinology that may have implications for classifying women by type and subtype. Infertility is accompanied by numerous economic, psychological, and ethical considerations, all of which raise challenging public health concerns. References I. Mosher WD, Pratt WF. Fecundity and Infertility in the United States, 1965-88. Advance Data from Vital and Health Statistics. No. 192. Hyatts- ville, MD: National Center for Health Statistics, 1990. 2. Marchbanks PA, Peterson HB, Rubin GL, Wingo PA, the Cancer and o
Page 85: 2063633570 Log in for more options!
. .4 Epidemiology July 1997, Volume 8 Number 4 Steroid Hormone Study Group. P~-.search on infertility: definition makes a difference. Am J Epidemiol 1989;130:259-267. 3. Ron E, Lunenfeld B, Menczer J, Blumsrein T, Katz L, Oelsner G, Serf D. Cancer incidence in a cohort of infertile women. Am J Epidemiol 1987;125: 780-790. 4. Brinton LA, Melton LJ 3rd, Malkasian GD Jr, Bund A, Hoover R. Cancer risk after evaluation for infertility. Am J Epidemiol 1989;129:712-722. 5. Risch HA, Marrett LD, Howe GR. Parity, contraception, infertility, and the risk of epithelial ovarian cancer. Am J Epidemiol 1994;140:585-597. 6. Rachootin P, Olsen J. The risk of infertility and delayed conception asso- ciated with exposures in the Danish workplace. J Occup Med 1983;25:394- 402. 7. Rosenberg MJ, Feldblum PJ, Marshall EG. Occupational influences on reproduction: a review of recent literature. J Occup Med 1987;29:584-59I. 8. Cates W Jr, Rolls RT Jr, Aral SO. Sexually transmitted diseases, pelvic inflammatory disease, and infertility: an epidemiologic update. Epidemiol Rev 1990;12:199-220. 9. Milne R, Chambers L. Assessing the scientific quality of review articles. J Epidemiol Community Health 1993;47:169-170. 10. Woolf SH. Review articles and disclosure of methods (Editorial). AmJ Prey Med 1991;7:53-54. 1 I. Hurchison BG. Critical appraisal of review articles. Can Fam Physician 1993;39:1097-1102. 12. Weed DL Methodologic guidelines for review papers. J Natl Cancer lnst 1997;89:6-7. 13. WesthoffCL The epidemiology of infertility, ha: Kiely M, ed. Reproductive and Perinatal Epidemiology. Boca Raton, FL: CRC Press, 1991;43-61. 14. K/lll~n B. Epidemiology of Human Reproduction. Boca Raton, FL: CRC Press, 1988;9-10. 15. Healy DL, Trounson AO, Andersen N. Female infertility: causes and treat- ment. Lancet 1994;343:1539-1544. 16. Wood JW. Dynamics of Human Reproduction: Biology,.Binmetry, Demog- raphy. New York: Aldine de Gruyter, 1994;3-22. 17. Gray R, Leridon H, Spira A. Biomedical and Demograhic Determinants of Reproduction. New York: Clarendon Press, 1993. 18. American Fertility Society. Infertility: an Overview. Consumer Protection Issues Involving h Vitro Fertilization Clinics. Hearing before the Subcom- mirtee on Regulation, Business Opportunities, and Energy of the Committee on Small Business, House of Representatives. lOlst Congress, F~t Session, Washington DC, March 9, 1989. Washington DC: U.S. Government Print- ing Office, 1989;74-81. 19. National Center for Health Statistics. Fecundity, Infertility, and Reproduc- tive Health in the United States, 1982. Vital and Health Statistics, Series 23: Data from the National Survey of Family Growth, No. 14. DHHS Pub. No. (PHS)87-1990. Washington DC: National Center for Health Statistics, 1987. 20. Zinaman MJ, Uhler ML. Clinical and laboratory assessment of male infer- tility. Female Patient 1996;21:35-47. 21. Howards SS. Treatment of male infertility. N EnglJ Med 1995;332:312-317. 22. Belsey MA. Infertility: prevalence, etiology, and natural history. In: Bracken MB, ed. Perinatal Epidemiology. New York: Oxford University Press, 1984; 255-282. 23. Rachootin P, Olsen J. Social selection in seeking medical care for reduced fecundity among women in Denmark. J Epidemiol Community Health 1981 ;35:262-264. 24. High MB, Mosher WD. Characteristics of infertile women in the United States and their use of infertility services. Fertil Steril 1987;47:618-625. 25. Schmidt L, Miinster K, Helm P. Infertility and the seeking of infertility treatment in a representative population. BMJ 1995;102:978-984. 26. Aml SO, Cates W Jr. The increasing concern with infertility: why now? JAMA 1983;250:2327-2331. 27. Daniluk JC. Infertility: intrapersonal and interpersonal impact. Ferdl Steril 1988;49:982-990. 28. Templeton A, Fraser C, Thompson B. Infertiliry--epidemiology and referral practice. Hum Reprod 1991;6:1391-1394. 29. Schmidt L, MOnster IC Infertility, involuntary infecundity, and the seeking of medical advice in industrialized countries 1970-t992: a review of con- cepts, measurements and results. Hum Reprod 1995;10:1407-1418. 30. Belsey MA. Infertility: prevalence, etiology, and natural history, ha: Bracken MB, ed. Perinatal Epidemiology. New York: Oxford University Press, 1984; 255-282. 31. Ryder NB, WestoffCF. Reproduction in the United States: 1965. Princeton, NJ: Princeton University Press, 1971. LIFE-STYLE AND FEMALE INFERTILITY 441 32. Mosher WD. Reproductive Impairments among Currently Married Couples: • United States, 1976. Advance Data from Vital and Health Statistics. Hyatts- ville, MD: National Centers for Health Statistics, 1980;55. 33. Gray RH, Doyle PE. The epidemiology of conception and fertility. In: Barron SL, Thomson AM, eds. Obstetrical Epidemiology. New York: Aca- demic Press, 1983;25-60. 34. Menken J, Tmssell J, Larsen U. Age and infertility. Science 1986;233:1389- 1394. 35. Schwartz D, Mayaux MJ. Female fecundity as a function of age. N Engl J Med 1982;306:404-406. 36. American Society for Reproductive Medicine. Age Related Infertility: Guideline for Practice. Birmingham, AL: American Society for Reproduc- tive Medicine, 1995. 37. Coale AJ, Trussell TJ. International differences in fertility. Popul Index 1974;40:185-258. 38. Battaglia AR, Graziano MR, Scafidi Fonti MG. Experimental research into the changes in the way sexuality is experienced by infertile women. Acra Eur Fertil 1983;14:67-73. 39. Khatamee MA. Infertility: a preventable epidemic, hat J Fertil 1988;33:246- 251. 40. Musher WD, Aral SO. Factors related to infertility in the United States, 1965-76. Sex Tmnsm Dis 1985;12:117-123. 41. Aral SO, Musher WD, Cares WJ Jr. Self-reported pelvic inflammatory disease in the U.S.: a common occurrence. Am J Public Health 1985;75: 1216-1218. 42. Baldwin WH, Nord CW. Delayed Childbearing in the U.S.: Facts and Fictions. Popul Bull 39(4). Washington DC: Population Reference Bureau, 1984. 43. Daling JR, Weiss NS, Metch BJ, Soderstmm RM, Moore DE, Spadoni LR, Stadel BV. Primary tubal infertility in relation to the use of an intrauterine device. N Engl J Med 1985;312:937-947. 44. Cramer DW, Schiff I, Schoenbaum SC, Gibson M, Belisle S, Albrecht B, Stillman RJ, Berger MJ. Tubal infertility and the intrauterine device. N Engl J Med 1985;312:941-947. 45. Cramer DW, Goldman MB, Schiff I, Belisle S. Albrecht B, Stadel B, Gibson M, Wilson E, Stillman R, Thompson I. The relationship of tubal infertility to barrier method and oral contraceptive use. JAMA 1987;257:2446-2450. 46. Phipps WR, Cramer DW, Schiff I, Belisle S, Stillman R, Albrecht B, Gibson M, Berger MJ, Wilson E. The association between smoking and female infertility as influenced by cause of the infertility. Fertil Steril 1987;48:377- 382. 47. Daling JR. Cigarette smoking and primary tubal infertility. In: Rosenberg MJ, ed. Smoking and Reproductive Health. Litrleton, MA: PSG Publishing, 1987. 48. Olsen J, Rachootin P, Schiodt AV, Damsbo N. Tobacco use, alcohol consumption and infertility. Int J Epidemiol 1983;12:179-184. 49. Daling JR, Weiss NS, Voigt L, Spadoni LR, Sodetstrnm R, Moore DE, Stadel BV. Tubal infertility in relation to prior induced abortion. Ferril Steril 1985;43".389-394. 50. Mueller BA, Daling JR, Weiss NS, Moore DE. Recreational drug use and the risk of primary infertility. Epidemiology 1990;1:195-200. 51. Grodstein F, Goldman MB, Ryan L, Cramer DW. Relation of female infertility to consumption of caffeinated beverages. Am J Epidemiol 1993; 137:1353-1360. 52. Joesoef MR, Beral V, Rolfs RT, Aral SO, Cramer DW. Are caffeinated beverages risk factors for delayed conception! Lancet 1990;335:136-137. 53. Grodstein F, Goldman MB, Cramer DW. Infertility in women and moderate alcohol use. Am J Public Health 1994;84:1429-1432. 54. Green BB, Daling JR, Weiss NS, Lift JM, Koepsell T. Exercise as a risk factor for infertility with ovulatory dysfunction. Am J Public Health 1986;76:14: 32-36. 55. Green BB, Weiss NS, Daling JR. Risk of ovulatory infertility in relation to body weight. Fertil Steril 1988;50:721-726". 56. Weights of Insured Persons in the United States with Lowest Mortality. Metrop Life CO Insur Star Bull 1959;40:3. 57. Grodstein F, Goldman MB, Cramer DW. Body mass index and'ovulatory infertility. Epidemiology 1994;5:247-250. 58. Grodsrein F, Goldman MB, Ryan L, Cramer DW. Self-reported use of pharmaceuticals and primary ovulatory infertility. Epidemiology 1993;4: 151-156. 59. Darrow SL, Selman S, Batt RE, Zielezny MA, Vena JE. Sexual activity, conrmception, and reproductive factors in predicting endometriosis. Am J Epidemiol 1994;140:500-509. 0
Page 86: 2063633571 Log in for more options!
BRIEF REPORTS Sensitivity of the Relation between Cumulative Magnetic Field Exposure and Brain Cancer Mortality to Choice of Monitoring Data Grouping Scheme Hans Kromhout,t Dana P. Loomis,ta Robert C. Kleckner,2 and David A. Savitz2 We examined the effectiveness of alternative grouping strate- gies with respect to cumulative exposure to magnetic fields and brain cancer mortality among electric utility workers. We applied a statistically optimal job-exposure matrix to calculate cumulative exposure over full work histories. We studied the sensitivity of the exposure-disease relation by assigning an array of different quantitative exposure estimates based on six schemes for grouping exposure measurements. The quantita- tive relation between cumulative magnetic field exposure and brain cancer mortality appeared to be sensitive to the choice of grouping scheme, with the optimized grouping scheme indicating stronger relations than standard schemes. (Epidemiology 1997;8:442-445) Keywords: EMF, sensitivity, exposure-response relation, exposure assessment, brain cancer, workers. Currently, two approaches are available to develop esti- mates of individual workers" quantitative exposure.1-4 The first is comparable with approaches generally em- ployed in nutritional epidemiology and utilizes personal estimates of historical exposure. The best example of this approach in occupational epidemiology is in studies of ionizing radiation exposure, in which each worker's ex- posure is monitored continuously during the entire pe- riod of employment. In most occupational studies, how- ever, large temporal variation in exposure intensity, lack of historical data, and complicated logistics of data col- lection discourage application of the individual ap- proach. More common is a group-based approach, in which monitoring data are used to assign exposure scores to workers who share the same environment, for exam- ple, department, job, function, or occupation. Until recently, there was no formal method available to determine the optimal scheme for grouping workers when using the latter approach. A default grouping by job title was therefore typically applied. A simple ratio of the between-worker variance component and the sum of the between- and within-worker components has been From the tDepartment of Air Quality, Wageningen Agricultural University, Wageningen, The Netherlands; and ZDepartment of Epidemiology, School of Public Health, University of North Carolina, Chapel Hill, NC. Address reprint requests to: Hans Kromhout, Department of Air Quality, Wageningen Agricultural University, P.O. Box 8129, 6700 EV Wageningen, The Netherlands. Supported by Contract RP-2964-05 from the Electric Power Research Institute, Palo Alto, CA. Submitted July 8, 1996; final version accepted February 3, 1997. 1997 by Epidemiology Resources Inc. proposed as a measure of between-group contrast in average exposure.4 Estimating this ratio for different grouping schemes provides an opportunity to choose objectively the best-performing option for exposure as- sessment, using statistical criteria. The optimal grouping scheme can differ between industries, and even between agents within an industry3 Moreover, analyses to iden- tify the optimal grouping strategy can be done indepen- dently of the assignment of individual exposure scores and analysis of the exposure-response relation. Despite the theoretical advantages of using objective methods to aggregate workers in a group-based exposure, the effects of these procedures have not been empirically evaluated in studies with cumulative exposure data. Here, we examine the sensitivity of a previously ob- served exposure-disease relation to the choice of schemes for grouping exposure measurements• We reas- signed exposure scores using an array of different quan- titative exposure estimates based on different occupa- tional grouping schemes, and we present the effect on the observed cumulative exposure-response relation. Methods In an earlier paper,5 we observed a relative risk for brain cancer of 1.07 [95% confidence interval (CI) = 1.01- 1.14] per/,T-year of exposure to mggnetic fields, using a company-specific job-exposure matrix optimized by methods described above to calculate cumulative mag- netic field exposure over the work histories of 138,905 men employed at five electric power companies in the United States.6 Detailed information on the design of the retrospective cohort mortality study can be found elsewhere.5-s Only the measurement strategy used to estimate exposure to magnetic fields, the different group- 442
Page 87: 2063633572 Log in for more options!
2063633572
Page 88: 2063633573 Log in for more options!
Eur Respir J 1997; 10:1380--1391 Pdnted in UK - all fights reserved REVIEW E9Z7 XE3Ze 1380 SAND EUR RESPIR J 97 (C]ffiJNKSGAARD INT PUBL LTD DE Copyright ©ERS Journals Lid 1997 European Respiratory Journal ISSN 0903 - 1936 Genetic risk factors for chronic obstructive pulmonary disease A.J. Sandford, T.D. Weir, P.D. Pard Genetic risk factors for chronic obstructive pulmonary disease. A.J. Sandford, T.D. Weir, P.D. Par~. ©ERS Journals Ltd 1997. ABSTRACT: Cigarette smoking is the major risk factor for chronic obstructive pulmonary disease (COPD). However, only a minority of cigarette smokers develop symptomatic disease. Studies of families and twins suggest that genetic factors also contribute to the development of COPD. We present a detailed literature review of the genes which have been investigated as potential risk factors for this disease. The only established genetic risk factor for COPD is homozygosity for the Z allele of the ˘z~-antitrypsin gene. Fieterozygotes for the Z allele may also be at in- creased risk. Other mutations affecting the structure of cq-antitrypsin or the regu- lation of gene expression have been identified as risk factors. Genes, including those for cq-antichymotrypsin, c~2-macroglobulin, vitamin D- binding protein and blood group antigens, have also been associated with the deve- lopment of COPD. Variants of the cystic fibrosis transmembrane regulator gene have been identified as risk factors for disseminated branchiectasis. The genetic basis to chronic obstructive pulmonary disease has begun to be elu- cidated and it is likely that several genes will be implicated in the pathogenesis of this disease. The knowledge gained from such studies may also prove relevant to other inflammatory diseases. Eur Respir J 1997; 10: 1380-1391. Respiratory Network of Centres of Ex- cellence, UBC Pulmonary Research Labo- ratory, St. Paul's Hospital, Vancouver, B.C., Canada. Correspondence: P.D. Par~ UBC Pulmonary Research Laboratory St. Paul's Hospital 1081 Burrard Street Vancouver B.C. Canada Keywords: Chronic obstructive pulmonary disease genetics risk factors Received: November 7 1996 Accepted for publication February 28 1997 Chronic obstructive pulmonary disease (COPD) is cha- racterized by decreased expiratory flow rates, increased pulmonary resistance and hyperinflation. The most impor- tant risk factor for the development of COPD is ciga- rette smoking [1]. Cigarette smoke, in combination with other factors, leads to two pathophysiological process- es in the lung. The first is proteolytic destruction of the lung parenchyma, which increases the size of the airspa- ces; these eventually coalesce to form emphysematous spaces. The development of emphysema is associated with a loss of lung elastic recoil. The second process is inflammatory narrowing of peripheral airways, which is characterized by oedema, mucus hypersecretion and fibrosis, scarfing, distortion and obliteration of periphe- ral airways. The loss of lung elastic recoil and the nar- rowing of the peripheral airways combine to decrease maximal expiratory flow from the lung and contribute to hyperinflation. In conjunction with gas exchange ab- normalities, hyperinflation produces the symptoms of COPD. Despite the clear association of smoking and airway obstruction, there remains marked interindividual varia- tion in the response to cigarette smoke. This indicates that there are additional genetic or environmental co- factors, which contribute to the development of COPD. It has been estimated that only 10--20% of chronic heavy smokers will ever develop symptomatic COPD [2, 3]. Co-factors, such as childhood viral respiratory infections and environmental and occupational pollution, undoub- tedly play a role in determining this susceptible subset. Furthermore, there is evidence that genetic susceptibility is of major importance. The epidemiological and clini- cal data that demonstrate a hereditary contribution to the development of COPD are summarized in table 1. Although the results of several of these studies show an aggregation of COPD in families, there is no clear Mendelian pattern of inheritance. Case-control studies have shown an increased prevalence of COPD in the relatives of cases as compared to the relatives of con- trois, which cannot be explained by differences in other known risk factors. There is also a higher prevalence Table 1. - Studies that demonstrate a genetic compo- nent to the development of COPD Study typc [Re~] Study showing clustering of COPD in families Family studies showing increased incidence of COPD or chronic bronchitis in relatives of cases compared to relatives of controls Studies showing significant correlations in lung function between parents and children and between siblings, and higher correlation between parents and children, or between siblings than between spouses Studies showing decreased prevalence of disease or less similarity in lung function with increased genetic distance Family studies showing a major gene effect or a genetic component to pulmonary function Studies of pulmonary function in monozygotic and dizygotic twins [41 [5-12] [4, 7, 13, 14] [5, 15, 16] [17, 181 [15, 19-241 COPD: chronic obstructive pulmonary disease. THIS ARTICLE IS FOR INDIVIDUAL USE ONLY AND MAY NOT BE FURTHER REPRODUCED OR STORED ELECTRONICALLY NZTHOUT NRZTTEN PERMISSIOH FROH THE COPYRIGHT HOLDER. UNAUTHORIZED REPRODUCTION MAY RESULT IN FINANCIAL AND OTHER PENALTIES.
Page 89: 2063633574 Log in for more options!
GENETICS OF COPD 1381 of reduced lung function among the children of patients who have COPD than among their spouses. Cross-sec- tional studies have shown decreasing prevalence of dis- ease and less similarity in lung function with increasing genetic distance. Studies of twins support a large gene- tic contribution to the variability in lung function. Heri- tability estimates for forced expiratory volume in one second (FEV1) range 0.5-0.8. WEaST~R et al. [21] stud- ied the effects of smoking on lung function in mono- zygotic and dizygotic twins. They found that when one monozygotic twin was susceptible to the effects of ci- garette smoke, both twins developed reductions in lung function, whereas other monozygotic twin pairs appea- red to be nonsusceptible and, despite similar smoking intensity, maintained normal lung function. The same concordance of changes in the lung function with sim- ilar smoking intensity was not seen in dizygotic twins. Figure 1 presents the pathogenic mechanisms in COPD schematically. Our purpose in this article is to review the evidence that specific genes may contribute to genetic suscepti- bility to COPD. Identification of susceptibility genes Complex genetic diseases, such as COPD, are caused by the interaction of environmental factors and genetic susceptibility. Positional cloning has been used to iden- tify the genes for many Mendelian disorders, and has also proved successful in localizing multiple regions of interest in complex diseases, such as hypertension [25] and diabetes mellitus [26]. The positional cloning app- roach uses multiply-affected families, and compares the inheritance of the disease to the inheritance of genetic markers of known chromosomal location. If a genetic marker is consistently co-inherited with the disease, then it is inferred that the disease gene lies close to that mar- ker on the same chromosome. Additional markers from the region are used to progressively ref'me the localiza- tion, until the gene can be identified. The power of positional cloning studies is reduced by polygenic inheritance, genetic heterogeneity and inter- actions with environmental factors. Cigarette smoking is such an important risk factor for COPD that it is impossible to use family data in which the prevalence of cigarette smoking varies. Ideally, one would need multi- generation families, in which there were similar levels of exposure to cigarette smoke. However, this is extre- mely unlikely because of age- and gender-related dif- ferences in the prevalence of smoking. In addition, most patients with COPD do not come to medical attention until their fifth or sixth decade, by which time it is usu- ally impossible to obtain phenotypic data and deoxyri- bonucleic acid (DNA) from their parents, and their offspring are generally not old enough to have develop- ed significant symptoms of COPD. An alternative app- roach would be to use an intermediate phenotype: a trait which is known to predispose to the development of COPD in smokers, such as increased bronchial respon- siveness [27]. For these reasons, positional cloning is difficult to apply to genes involved in the pathogenesis of COPD. Therefore, an alternative strategy has been used; asso- ciation studies of candidate genes. The candidate gene approach involves identifying gene products that are clearly involved in the pathogenesis of a condition, and ' looking for genetic polymorphisms in the genes that code for these proteins. To determine if these variants contribute to the disease process, case-control studies are performed to test for the association of the polymor- phisms with the disease phenotype. The risk imparted by a particular phenotype can be calculated using the rela- tive risk (RR) or odds ratio (OR) equations. RR is given by: (a/[a+b])/(c/[c+d]); and the OR is: (a/b)/(c/d), where a and b are the number of patients with and without the risk allele, respectively, and c and d ate the number of controls with and without the risk allele, respectively. The calculation of OR and RR yields very similar val- ues when the prevalence of a condition is low; how- ever, the results diverge as the prevalence increases. This is illustrated in figure 2, in which the RR and OR for a genotype are calculated for different prevalences of the trait in the population. An increased OR or RR for a disease in individuals of a specific genotype may indicate that the genotype causes an abnormal gene prod- uct or gene regulation, which influences the disease pathogenesis. Alternatively, it is possible that the gene tested in the association study does not contribute to the disease process, but is in association with the true Environmental ~ , and occupationall ~ IChildhood respiratoryI pollution t ~ I. ,,, infections ~ Genetic /.~ susceptibility ~ .... " ~ ~Airway inflamm'ation~ I ~ Lung recoil 1]4 Expiratory flowll'_ and remodelling ~ hyperinflation Hg. 1. - Summary of the pathogenic mechanisms in chronic obstmc- five pulmonazy disease (COPD). Exposure to cigmeae smoke is the major factor in the pathogenesis of COPD but interacts with other risk factors, including genetic susceptibility, to produce airway obsm~c- tion by loss of elastic recoil and/or airway inflammation. • ~ 50" 40" 8.30- 20" 10" O0 011 012 013 014 015 '016 017 018 Prevalence of trait Hg. 2. - Dependence of estimates of relative risk (RR) on the pop- ulation prevalence of the trait under study. Values for RR and odds ratio (OR) diverge as the prevalence of the trait increases. ~: RR=5; - - o: RR=20.
Page 90: 2063633575 Log in for more options!
1382 A.J. SANDFORD ET AL. disease-causing mutation. This is because the disease-causing muta- tion may have fast occurred on a chromosome containing the geno- type being tested in the study. If the two alleles are very close to each other, then they will remain in asso- ciation with each other for several generations and are said to be in linkage disequilibrium. The power of association studies has been clearly demonstrated [28]. Even genetic polymorphisms which impart only a slight increase in RR can be detected if sufficient numbers of patients and controls are obtain- ed. The weakness of the candidate gene approach is that only genes known to be involved in the patho- genic process can be examined. The other major difficulty is ensuring that the patient and control groups are adequately matched for every other variable that could influence the distribution of the genotype. Chief among these is ethnic origin. There is potential for false-positive or false-negative results if this factor is not carefully taken into account. Pulmonary ~ and bronchial ,~ capillaries • D-bi.nding pro.tein, / J:,:~., " ease cnemotaxic "~~ " ,. . Alpna2-macrogtooulin withC5a 7"~~''- !~ CFTR" ~:~!i,' iAlp.hal~antichy.mgtry.psin "-"""'~"~"~'-~ ~''~ Cytochrome P450 ~.. Elastase, _. ~;~~ Bronchial otlaerproteases t:~ara y' \ \ hyperresponsiveness andTNF-cz cell [ IntŁr~titial genes ' SOD Fig. 3. - Schematic representation of an airway to illustrate how mutations in various genes may contribute to the development of chronic obstructive pulmonary disease (COPD). Alphal-antiprote- are (txl-antitrypsin), oq-antiehymotrypsin, and a2-macroglobulin are serum proteins that can inhibit inflammatory cell pretenses. Deficiencies in their function or level could enhance the proteolytic digestion of the lung parenehyma that characterizes emphysema. Cytoehrome P450 is an enzyme present in airway epithelial cells (primarily Clara cells) that converts inhaled toxic chemicals to their metabolites. A gene variant, which enhances the enzyme's activity, could increase the prevale; nee of lung cancer as well as accelerate the airway inflammation that characterizes COPD. There is an association between mutations in the CFTR gene and bronchiectasis. Variants of the vitamin D- binding protein may influence the susceptibility to COPD. This protein can be converted to a ma- emphage-aetivating factor and interact with complement factor 5a (C5a) and C5a cles-Arg to enhance ebemotaxis of inflammatory cells. Cb'TR: cystic fibrosis transmembrane regulator; SLPI: secreto- ry leueoeym proteinase inhibitor, TNF-ct: turnout necrosis factor-e; SOD: superoxide dismutase. For instance, an association of type 2 diabetes mellitus and an immunoglobulin G (IgG) haplotype was shown to be due to Caucasian admixture in a Native American population [29]. Caucasians have a lower incidence of diabetes and eoincidentally a higher prevalence of the IgG haplotype. Therefore, the haplotype appeared to be protective against diabetes, but in fact was only a mar- ker for Caucasian ancestry. The association was shown to be spurious because the protective effect was not seen in individuals with no Caucasian ancestry. Genetic factors in the pathogenesis of COPD Table 2 lists genes that have been tested as candidates for involvement in the pathogenesis of COPD. The table Table 2. - Genes implicated in the pathogenesis of COPD Genes for which association studies have shown a signifi- cant relationship between polymorphisms and COPD Alphal-antitrypsin Alphai-antichymotrypsin Cystic fibrosis transmembrane regulator Vitamin D-binding protein Alpha2-macroglobulin Cytochrome P450A1 ABH secretor, Lewis and ABe blood groups HLA Immunoglobulin deficiency Haptoglobin Candidate genes for which there are no significant asso- ciations at present Extracellular superoxide dismutase Secretory leucocyte proteinase inhibitor Cathepsin G COPD: chronic obstructive pulmonary disease; HLA: human leucocyte antigen. indicates those genes for which association studies have shown a significant relationship between specific poly- morphisms and COPD, and candidate genes that have the potential to be involved in the pathogenesis of COPD but for which there are no significant associations at present. Figure 3 is a schematic illustration of an air- way to depict how enhanced or deficient gene products could contribute to COPD. Alpha #-antitrypsin The recognition by LAURELL and ERIKSSON [30] that patients with extremely low levels of ~x-globulin had an increased prevalence of emphysema was the first study to show a genetic risk for COPD. Alphat-antitrypsin (cq- AT) is a powerful antiprotease and is one of the few enzymes that can inhibit leucocyte elastase. Alphal-AT is produced in large amounts by the liver, but is also produced by alveolar macrophages and peripheral blood monocytes [31]. It is a highly polymorphic protein and over 70 variants have so far been identified [32] using crossed electrophoresis [33] and isoelectric focusing [34]. The Z variant of ctt-AT has deficient antiproteolytic func- tion but, more importantly, it is improperly processed in the rough endoplasmic reticulum and aggregates with- in the cell. Large amounts of the Z variant of the AT protein accumulate in hepatocytes, where they can cause liver disease [35]. Individuals with homozygous Z mutations have extremely low levels of circulating at-AT (less than 15% of normal) and have a clearly accelerated rate of decline in lung function even in the absence of smoking [36, 37]. However, it is predomi- nantly among smokers who are homozygous that symp- tomatic airflow obstruction develops at a younger age
Page 91: 2063633576 Log in for more options!
! i .i 1 GENETICS OF COPD 1383 [38, 39]. Although there is a clear association of homo- zygosity for this gene variant and the development of COPD, the homozygous state is rare in the population (1 in 1,670 [40] to 1 in 5,097 [41] live births in Caucasian populations) and, thus, can explain only a small percen- .tage of the genetic susceptibility to cigarette smoke. The discovery that homozygosity for the Z variant leads to increased risk for COPD led to numerous stud- ies in which an association of COPD and heterozygous genotypes was sought. The approximate allele frequen- cies of the most common gene variants M, S and Z are 0.93, 0.05 and 0.02, respectively. Patients with the MM genotype have the highest ~I-AT levels and are defined as normal. Patients who are heterozygous MS have mild reductions in ~I-AT levels to -80% of normal, whereas MZ heterozygotes have lower levels at -60% of normal. SZ compound heterozygotes are rare, but have even lower levels at --40% of normal. Two types of studies have attempted to identify an increased risk for COPD in the relatively common hetero- zygous MS and MZ genotypes. In ease-control studies, the prevalence of cq-AT genotypes in individuals with the clinical features of COPD is compared to control subjects without airflow obstruction, who are matched as closely as possible for other potential predictors of COPD. In general, the results of these case-control stud- ies have shown the OR to be significantly increased. As shown in table 3, the OR for COPD ranges 1.5-5.0. The prevalence of the MZ variant in the ease populations ranges 3.9-14.2%, whilst in the controls it ranges 1.0-- 5.3 . Investigators have also assessed the risk of the MZ genotype by studying lung function in the general popu- lation [49-56]. In these studies, a population sample is phenotyped for ~-AT variants and the prevalence of COPD in those with the MZ phenotype is compared with the prevalence in those with the MM phenotype. Many of these studies were based on small numbers of individuals and had insufficient power to detect an effect of the MZ or MS phenotype. However, even most of the larger studies showed no significant difference in respiratory symptoms or pulmonary function in the MZ individuals compared to MM subjects. In theory, popu- lation-based studies designed to examine the predictive value of a genotype are superior to case-control met- hods because there is less chance of a systematic bias. However, in COPD, where an environmental factor (i.e. cigarette smoking) plays an important role, population studies may have insufficient sensitivity to detect a fac- tor which only increases risk slightly. For example, in a collaborative study to assess risk of lung disease in MZ phenotype subjects, 143 MZ individuals did not have significantly lower lung function than 143 MM indi- viduals drawn from a population study of over 10,000 people [56]. However, only 37% of the subjects were current smokers, 35% had never smoked and 60% were less than 54 yrs of age. In contrast to these reports, the results of several pop- ulation studies have demonstrated differences between MZ and MM individuals. KLAY'ror~ et al. [57] found an increased prevalence of COPD in MZ heterozygotes who had smoked, but found no difference in the incidence of COPD between MM and MZ nonsmokers. CooP~.R et al. [58] found significantly decreased lung function in MZ individuals. However, both of these studies used relatives in the MZ study population and, therefore, the results may not be due to mutations in the Ctl-AT gene. TArr~RSALL et al. [59] found evidence for greater loss of elastic recoil in MZ versus MM smokers, but estima- tes of airway function were similar in both groups. HALL et aL [60] found that MZ heterozygotes had significantly lower expiratory flow rates, even in the absence of smok- ing. MholSO~q et al. [10] found more rapid decline in lung function in MZ individuals in a longitudinal study. Similarly, the results of a 10 ye~ longitudinal study of 28 MZ subjects demonstrated that deterioration in lung function was significantly greater than in a matched MM control group [61]. In addition to mutations that affect the basal serum levels of txt-AT, several mutations have been describ- Table 3. - Case-control studies of ~l-antitrypsin deficiency genotypes and chro- nic obstructive pulmonary disease (COPD) First [Ref.] Subjects Genotypes % OR author ' MZ MS ZZ SS SZ for MZ SmoF.or~ [42] 306 COPD patients 3.9 196 controls 1.0 B,~rMAr~ [43] 526 COPD patients 5.9 6.5 0.9 3.4 642 controls 1.2 6.5 0.3 0.2 Cox [44] 114 emphysema or 4.9 5.7 6.6 bronchitis patients 721 controls 1.9 7.9 0 J,,,r~s [45] 190 emphysema 14.2 5.3 2.6 1.1 patients - 1,303 controls 3.9 7 0.1 0.3 LmBF.gXt~ [46] 965 COPD patients 7.7 10.1 1.9 0.3 0.2 1,380 controls 2.5 8.0 0 0.1 0.4 MrrrMA~ [47] 350 COPD patients 10.0 6.3 3.4 0.9 0.9 2,830 controls 2.9 4.1 0.1 0.1 0.I Ktw~m~s [9] 114 COPD patients 7.9 4.4 2.6 0 114 controls 5.3 7.0 0 0.9 Bhm, ma'r [48] 107 COPD patients 9.3 5.6 1.9 91 controls 2.2 5.5 0 OR: odds ratio. ed that affect function [62], but these are relatively rare and can only explain a small percentage of the susceptible subgroup that develops COPD. Two separate groups have reported an associ- 4.0 ation between a mutation in the 3' region of the txl-AT gene and 5.0 COPD [63, 64]. KALSnF_XER et al. [63] found that this mutation was 2.6 associated with chronic lung dis- ease. Heterozygosity for the mu- tation in a group of patients with 3.9 pulmonary emphysema (I 8%), and in a group of patients with 3.3 bronchiectasis (19%), was signi- ficantly higher than in normal 3.8 controls (5%). However, the rea- son for the association of the 1.5 mutation with COPD was unclear, since it was not associated with 4.6 ~-AT deficiency or any partic- ular ct~-AT protein type. Subse- quently, these authors studied a r~
Page 92: 2063633577 Log in for more options!
1384 A.J. SANDFORD ET AL. larger group of 140 patients with pulmonary emphyse- ma and bronchiectasis and found that 20% were hetero- zygous for the mutation (p=0.0015) [65]. The association has been independently confirmed by POLLER et al. [64] in a group of 137 COPD patients. The mutation was found in 15% of the patients and in only 5% of the healthy controls. In addition, a family was identified in which the mutation segregated with COPD, and, when homozygous, the mutation was associated with the onset of symptoms at a younger age. The 3' mutation could be associated with COPD as a result of linkage disequilibrium with the disease-causing allele. The at-antichymotrypsin gene has been mapped to within 220 kb of the cq-AT locus [66], and the mutant 3' allele could be in disequilibrium with an at-antichy- motrypsin deficiency allele. Alternatively, KALSrm~R and co-workers [65] have suggested that the 3' muta- tion may affect the regulation of at-AT gene expres- sion. Alphat-AT is an acute phase protein and its serum concentration increases two- to threefold during inflam- mation [67]. Presumably, the acute phase response has evolved to attenuate the proteolytic destruction that occurs at sites of acute tissue injury and, thus, prevents excessive tissue destruction. A deficient acute phase in- crease in cq-AT levels following viral or bacterial respi- ratory infections could exaggerate the proteolytie tissue destruction that accompanies the release of neutrophil elastase and other enzymes. It is possible that the 3' mu- tation could affect the acute phase response leading to reduced upregulation of ~zI-AT synthesis when inflam- mation is present. Alveolar and lung tissue macrophages are both capable of producing st-AT [31]. If the tzt-AT gene expression in tissue and alveolar macrophages is also affected by the mutation, then a disturbance of the proteolytic-antiproteolytic balance could develop with- in the microenvironment of the inflamed lung. MORGAN et al. [68] sequenced the 3' region of the tx~-AT gene, and showed that the mutation occurs in a region containing four consensus sequences for DNA- binding proteins, suggesting that it may affect a regu- latory element. Gel shift analysis and deoxyribonuclease (DNase) I footprinting experiments confirmed that all four potential regulatory regions bound nuclear factors [69]. However, the mutant sequence demonstrated poor binding, especially in the region of the mutation. To test for the functional significance of the mutation, both the wild type and mutant 3' regions were cloned into vectors, downstream of a reporter gene. These con- structs were used to transfect three different cell lines. In all of the cell types, the wild type sequence showed a 50--100% increase in gene expression compared to a control plasmid. Furthermore, the mutant sequence sho- wed two- to fourfold less activity than the wild type. The acute phase response is primarily mediated by interleukin 6 [70]. Recently, it has been proposed that transcription factors of the CCAAT box enhancer bind- ing protein (C/EBP) family play an important role in increasing acute-phase gene transcription [71]. The 3' region of the a~-AT gene contains a C/EBP binding site. Interestingly, the mutation in the 3' region appears to influence the binding to neighbouring regions, includ- ing the C/EBP site and, therefore, may influence acute phase gene expression. An additional polymorphism in the 3' region of the ~x~-AT gene has been shown to be associated with COPD [72]. The polymorphism was found in 3 out of 70 COPD patients but in none of 52 controls. The mutant allele showed loss of more than one restriction site, suggest- ing the presence of a deletion. Homozygosity for this mutation was associated with early onset COPD. This polymorphism was also associated with normal at-AT levels. 2063633577 Alpha l-antichymotrypsin Alphat-antichymotrypsin, like a~-antitrypsin, is a ser- ine protease inhibitor and acute phase reactant. Alphat- antichymotrypsin (txt-ACT) is known to inhibit pancreatic chymotrypsin, neutrophil cathepsin G, mast cell chy- mase and the production of neutrophil superoxide [73]. It is synthesized by hepatocytes and alveolar macropha- ges [74]. Alphal-ACT deficiency has a prevalence of approxi- mately 1% in the Swedish population. In cases where hereditary deficiency has been shown, transmission fol- lows an autosomal dominant inheritance pattern [75, 76]. No consistent clinical phenotype is associated with cq-ACT deficiency, although an increased prevalence has been reported in patients with childhood asthma [77] and COPD [78, 79]. In two other studies, deficient pati- ents had increased values of residual volume (RV) and of the RV/total lung capacity (TLC) ratio [75, 76]. Two point mutations in the ˘z~-ACT gene have been associated with decreased eft-ACT serum concentrations and COPD. POLLER and co-workers [78] described an amino acid substitution, Pro227--~Ala, which they found in four of 100 unrelated COPD patients and none of 100 controls in a German population (p=0.04). All four pa- tients with the mutant gene had serum cq-ACT concen- trations approximately 60% of normal and ~xt-AT levels within the normal range. However the prevalence of the pro227-->Ala mutation may vary in different populations, since it was not detected in 102 Russian COPD pati- ents [80]. A second amino acid substitution, Leu55-->Pro, was reported by POI.I.ER and co-workers [79] in three out of 200 unrelated COPD patients and none of 100 con- trols. Mean txt-ACT serum levels in the heterozygotes was 80% of normal, and the mutant protein had an altered pattern on isoelectric focusing and defective func- tion. One of the heterozygotes belonged to a family in which thre~ members were affected with severe early onset COPD. The mutant allele segregated with COPD in this three generation pedigree. Cystic fibrosis transmembrane regulator The cystic fibrosis transmembrane regulator (CFTR) gene product forms a chloride channel at the apical sur- face of airway epithelial cells and is intricately involved in the control of airway secretions. Homozygous defi- ciency or defective function of this protein results in cystic fibrosis (CF), characterized by elevated sweat chloride levels and early onset obstructive lung disease, secondary to chronic bacterial infection and bronchiec- tasis. The prevalence of CF is 1 in 2,000 to 1 in 3,000, with the carrier frequency estimated at 1 in 20 to 1 in
Page 93: 2063633578 Log in for more options!
30 in populations of Northern European descent [81]. ~[i It has been hypothesized that this relatively high pre- valence arose from a selective advantage of carrying a CF allele. Resistance to pulmonary tuberculosis [82], influenza [83], and cholera [84] have each been suggest- |~ ed as a selective advantage. In an animal model, mice _.11 that were heterozygous for a mutant CFTR allele secre- ted 50% less intestinal fluid and chloride ion in response to cholera toxin [85]. CF heterozygotes could have altered airway water and ion regulation, altered mucoeiliary clearance and an in- creased susceptibility to challenges that are attenuated iI by these mechanisms. In the 1960s, several groups inves- _ tigated the hypothesis that CF heterozygotes may be pre- disposed to respiratory disease. Comparisons of parents of CF patients versus controls (mean age 34-36 yrs) did [ not reveal any significant differences in lung function _ or history of asthma or chronic bronchitis [86-89]. How- ever, obligate heterozygotes have been shown to have increased bronchial reactivity to methacholine [90], and I increased incidence of wheeze accompanied by decrea- _ sed FEVI and forced mid-expiratory fiow (FEF25-T5) [91]. More than 580 variants of the CFTR gene have been described; the most common mutation, AF508, is found on approximately 70% of all CF chromosomes [92]. Heterozygosity for the AF508 mutation was identified , in four of eight patients with disseminated bronchiecta- sis [93], and in five of 65 patients with bronchial hyper- - secretion [94]. In both studies, it is unclear whether the AF508 heterozygotes are predisposed to lung disease or whether they have mild, previously undiagnosed CF with unidentified CFTR mutations on their other chro- mosomes. In a study of patients with normal sweat chloride levels, G~.Rw,[s et al. [95] found the prevalence I of AF508 to be increased (four out of 47) in patients with bronchiectasis and not increased (seven out of 161) in patients with chronic bronchitis. The AF508 mutation was not found in any of 21 Japanese patients with diffuse panbronchiolitis, a disease with pathologi- cal~ and'. clinical characteristics similar to mild CF [96]. Recently, investigators have searched for associations between respiratory disease and other CFTR variants, GENETICS OF COPD 1385 sion. This variant was not found to be significantly in- creased in five of 33 COPD patients. Early work by the same authors did not support the involvement of CFTR in COPD.by linkage analysis with a CF locus marker [1011. In summary, heterozygosity for AF508 appears to pre- dispose for disseminated bronchiectasis, but the involve- ment of CFTR in other obstructive pulmonary diseases remains unproven. Studies of CPTR mutations in COPD patients who have documented lifelong airway challen- ges, such as cigarette smoking, have not been perform- ed. Vitamin D-binding protein (group-specific component) Vitamin D-binding protein (VDBP), also known as group-specific component, is a 55 kDa protein secreted by the liver, that is able to bind extracellular actin and endotoxin in addition to vitamin D. VDBP enhances the chemotactic activity of complement factor 5a (C5a) and C5a des-Arg for neutrophils by one to two orders of magnitude [102]. In addition, VDBP can act as a macro- phage-activating factor [103]. Thus, besides its vitamin D-binding function, VDBP can have important influen- ces on the intensity of the inflammatory reaction. Numer.ous isoforms of VDBP have been identified by isoelectrie focusing. Two common substitutions in exon 11 of the gene result in three possible isoforms, termed IF, 1S and 2. Figure 4 shows a partial gene map of VDBP and the substitutions responsible for protein iso- forms. Ku~PPEgS et al. [9] found a decreased frequency of the 2-2 genotype in COPD patients compared to con- trois. Subsequently, HoP~E et al. [ 104] performed a case- control study, in which they found that the prevalence of the 1F homozygote was significantly greater among patients with COPD than among controls, yielding a RR of 4.8. In addition, the genotypes that contained the 2 allele (2-1F, 2-1S and 2-2), had a protective effect. How- ever, this association remains controversial, since it was not replicated by KA~t˘~ et aL [105]. a) I in addition to AF508. A~rtaCH et al. [97] examined 100 Intron 10 Exon 11 Intron 11 patients with chronic bronchitis for the more common CFTR mutations (AF508, R553X, G551D, G542D, G542X, N 1303K and 621+1G--~T). The only mutation, /~~ o~. AF508, was found in one patient who also had bron- chicctasis, suggesting that none of these Cl:rrR muta- lfions predisposes to chronic bronchitis [97, 98]. Pmr~ATT~ and co-workers [99] performed detailed screening for approximately 70 CP-TR mutations. Although variants were found in two of 12 patients with COPD without bronchiectasis, and in two of 36 patients with non- obstructive pulmonary disease, the frequency of the mutations was not significantly different from that expect- eel However, CFTR mutations were found in five of 16 patients with disseminated bronchiectasis and normal sweat chloride levels (one each with mutations AF508, R75Q, Ml137V, 3667ins4, R1066C). In a subsequent study, five of the same 16 patients were also found to have the IVS8-5T variant (three of whom were previ- ously negative for other CPTR mutations) [100]. The IVS8-5T allele results in reduced CFTR gene expres- b) Isoform 1S 1F 2 Amino acid 416 Glu Asp Asp Amino acid 420 mhr Population frequency 0.57 0.18 0.25 Fig. 4. - Polymorphisms in the vitamin D-binding protein gene. a) Two point-mutations in exon 11 of the gene result in amino acid sub- stitutions at positions 416 and 420 of the protein, b) Amino acids pre- sent at position 416 and 420 in the three isoforms of the vitamin D-binding protein, and the frequencies of the isoforms in Caucasian populations. G: guanine; T: thymine; C: cytosine; A: adenine; Glu: glutamie acid; Asp: aspanic acid; Thr: threonine; Lys: lysine.
Page 94: 2063633579 Log in for more options!
1386 Ad. SANDFORD ET AL. No studies have so far examined the influence of these genetic variants on the ability of the protein to act as a chemotactic enhancer of C5a or as a macrophage-activ- ating factor. However, the macrophage-activating factor is formed from VDBP by modification of an oligosac- chadde side chain. Less than 10% of the 2 isoform is glycosylated and able to form macrophage-activating factor [103], which is consistent with a protective effect for the 2 allele. Alpha~-macroglobulin Alpha2-macroglobulin is a broad spectrum scram pro- tease inhibitor. Normal serum levels of ~,2-macroglobulin are higher in females and decrease with age. Synthesized by bepatocytes, alveolar macrophages [106] and human lung flbroblasts [107], ot~-macroglobulin is thought to have a protective role in the lung. The large size of t~z- macroglobulin (725 kDa) prevents significant transport from blood to the lung interstitium or alveolar space, so that serum levels do not necessarily reflect its concen- tration in the lung. However, increased permeability of the vessel wall under inflammatory conditions could allow ~,~-maeroglobulin to enter the interstitial space [108]. An increase in ~.2-macroglobulin levels can be detected in the sputum of patients with acute chest in- fections [109]. Elevated ~-macroglobulin levels, up to two times control, have been reported in the serum of patients with ~t-AT deficiency, irrespective of the pre- sence or absence of COPD [110, 111]. Such an eleva- tion is not seen in patients with emphysema unrelated to ~1-AT deficiency. Alpha2-macroglobulin serum deficiency is rare and the cause is unknown. Two case studies described hereditary ~-macroglobulin deficiency with autosomal dominant transmission [112, 113]. Although symptoms suggestive of respiratory disease were not found in the deficient individuals, it is possible that the subjects were not old enough to develop COPD. Neither study included pul- monary function tests or smoking histories. Comple~ lack of ~-macroglobulin has not been described and may be incompatible with life. The ~,2-macroglobulin gene, located on chromosome 12, has been cloned and sequenced [114]. Whilst rest- rietion fragment length polymorphism (RFLP) vari- ants of the ~-macroglobulin gene have been described, only one variant has been reported to be associated with chronic lung disease in a single patient [115]. The patient had oa-macroglobulin serum levels 50% of normal and chronic pulmonary disease since childhood progressing to very severe COPD at the age of 42 yrs (smoking his- tory not reported). DNA from this patient was digested with 10 restriction enzymes and probed with an-~2- macroglobulin complementary deoxyribonucleic acid (eDNA) probe. All 10 restriction enzymes showed an alteration in the RFLP pattern suggesting a major alter- ation of the ~-macroglobulin gene. RFLP analysis with nine of the 10 restriction enzymes failed to demonstrate polymorphisms in 40 control and 39 COPD patients. The same author sequenced two functional domains of the ~2-macroglobulin gene in 30 COPD patients and 30 control subjects [114]. A common amino acid substitu- tion, Vall°°°--~lle, was detected equally in both groups. One COPD patient had an amino acid substitution, CysgV2---~Tyr, which was predicted to interfere with ot2- macroglobulin function. The serum level of ~t~-macro- globulin in this patient was within the normal range. Cytochrome P4501AI Cytochrome P4501A1 is an enzyme that metabolizes exogenous compounds to enable them to be excreted in the urine or bile. It is found throughout the lung, and may play a role in the activation of procarcinogens to their carcinogenic forms. The enzyme is produced by the CYPIA1 gene and mutations at this locus have been associated with lung cancer [116]. In a recent study, the prevalence of a mutation in exon 7 of CYPIA1 was assessed in lung cancer and COPD patients [117]. This mutation causes a substitution of isoleucine to valine at residue 462, and results in a pro- tein with almost twice the enzymatic activity of the isoleucine protein. The high-activity allele was found to be associated with susceptibility to centriacinar emphy- sema and lung cancer. The polymorphism was not link- ed to lung cancer in the absence of emphysema. Blood group antigens 2083833579 The association of COPD with the ABO, secretor and Lewis genes has been the focus of several studies. The ABO locus on chromosome 9 determines the activity of a glyeosyltransferase, which converts glyeoprotein H into the A or B antigens. An association between the ABO locus and COPD was found by Con~q et al. [118]. The results of this study suggested that impaired lung func- tion was associated with type A blood group. This was confirmed by the same authors in a 5 yr longitudinal study, in which there was a greater decline in lung func- tion in group A individuals compared with non-A sub- jects [119]. In direct contrast to these studies, I~,cz~ows~a et al. [120] found that subjects with blood group A had a smaller decline in lung function than individuals with other blood groups. The results of several other studies have failed to confirm any association of ABO alleles and pulmonary function [23, 121, 122]. ABO antigens are present on virtually all ceils of the body. Approximately 80% of the population secretes ABO antigens into saliva, plasma and respiratory tract secretions. The ability to do this is determined by the secretor locus on chromosome 19q and is a dominant trait. It has been reported that nonsecretors have impair- ed lung function compared to secretors [123, 124]. This suggests that the presence of ABO an[igens in the secre- tions of the respiratory tract may have a protective effect against lung impairment. This result was independent- ly confirmed by Kaor~a~rq et al. [105], who found sig- nificantly more nonsecretors of blood group O in subjects with low FEV1 measurements (OR=15.6). Secretor sta- tus was shown to have a protective effect against de- 'cline in peak expiratory flow rates [123], but, in this study, the effect was only observed in subjects over 40 yrs of age. These associations are controversial because they have not be~n replicated in other populations [121, 122, 125].
Page 95: 2063633580 Log in for more options!
GENETICS OF COPD 1387 The Lewis blood group has also been investigated as a possible risk factor for airflow obstruction [126]. In Caucasian populations, ~90% of individuals have the dominant Le allele and produce Lewis a substance. In individuals who are secretors, this is converted to Lewis b substance, and therefore they have a and b substances in their serum. Lewis-positive nonsecretors only have a substance in their serum. HoP,~ et al. [126] found a significant increase in airflow obstruction in Lewis- negative subjects, with a RR of 7.2. The authors sug- gest that it is the presence of b substance rather than secretor status that protects against airflow obstruction. Since the blood group systems interact at the protein level, a recent study has considered all three gene loci together [127]. Blood group O individuals who were either Lewis-negative or nonsecretors, were found to have impaired lung function and higher prevalence of wheez- ing and asthma. Individuals who were both Lewis- negative and nonsecretors, had very low lung function. Lewis-positive secretors were found to have lower lung function if they had blood group A, compared with group O. The reason for the association of ABO, Lewis and secretor genes with COPD remains unclear, but it may be due to the role of these systems in the adhesion of infectious agents [128]. Recurrent respiratory infections, especially in childhood, are known to be a risk factor for COPD, and particular alleles of these blood groups may increase an individual's susceptibility to infection. Human leucocyte antigen locus Associations between the human leucocyte antigen (HLA) class I genes and COPD have been investigated in a study of heavy smokers with high FEV1 values and lifelong nonsmokers with low FEVI values [105]. The authors observed a significant decrease of the I-ILA- Bwl6 allele in those with low FEVI values (OR=0.2), and a significant increase of the HLA-B7 antigen in the same group (OR=3.8). HLA typing was also performed in a population of Japanese patients with diffuse panbronchiolitis [129]. The results demonstrated an increased prevalence of HLA-Bw54 in the patients compared to the control sub- jects (RR=13.3). This HLA type is only found in Japa- nese, Chinese and Korean individuals, and may explain why diffuse panbronchiolitis has not been reported in Caucasian or African populations. It is not yet clear whether these associations are due to variations in the HLA genes themselves or to suscep- tibility genes in linkage disequilibrium with the HLA alleles. of IgG2 and two had decreased levels of IgG3 [130]. All six of the IgG and IgA deficient subjects were found to have abnormal lung function. In addition, a signifi- cant correlation of IgG2 levels and FEV! values was found by O'K~ et al. [131]. Selective IgA deficiency has been found to segregate with COPD, in a large, three generation pedigree [133]. Haptoglobin The serum protein haptoglobin has several common polymorphisms. The prevalence of these variants was investigated in a population of subjects with low FEVI values [105]. Overall, no significant difference in the fre- quency of haptoglobin variants was observed between in- dividuals with low FEV1 values compared to those with high values. Among those with non-O blood groups, a possible protective affect of the HplS allele was detec- ted. However, a similar association was not found in an earlier study [9]. Other candidate genes for COPD Extracellular superoxide dismutase Extracellular superoxide dismutase (EC-SOD) is a sec- retory glycoprotein found mainly in the interstitial spa- ees, although -1% is found in the plasma, lymph and synovial fluids. It is the main extracellular antioxidant enzyme in the lung. EC-SOD has a high affinity for gly- cosaminoglycans, such as heparan sulphate, and there- fore >98% of the enzyme is found bound to beparan sulphate in the connective tissue matrix. EC-SOD is ideally localized to play an important role in attenuat- ing tissue damage secondary to oxygen radicals inhaled in cigarette smoke and generated by activated inflam- matory cells. A polymorphism in the EC-SOD gene results in the substitution of arginine to glycine at amino acid posi- tion 213 [134, 135]. Approximately 2% of a random population were found to be heterozygous for the sub- stitution [135]. This mutation (R213G) is located in the heparin-binding domain and results in a -30 fold incre- ase in the serum enzyme concentration, presumably due to a failure of EC-SOD to remain bound to interstitial glycosaminoglycans. A 10 fold increase in serum EC- SOD has been reported in a lung transplant patient with end-stage emphysema [136]. However, the R213G allele was not present in this patient, suggesting that further variants of this gene remain to be identified. Immunoglobulin deficiency Secretory leucocyte proteinase inhibitor The role of hereditary immunoglobulin A (IgA) and immunoglobulin G (IgG) deficiency in the aetiology of COPD has been examined in several studies [130, 13 I]. Patients with IgA deficiency, either alone or in combina- tion with IgG deficiency, are known to have recurrent respiratory infections [132]. In a study of IgA deficient individuals, four were found to have decreased levels Secretory leucocyte proteinase inhibitor (SLPI) is a 12 kDa serine antiprotease found in a variety of mucous secretions, including those of the respiratory tract. SLPI is produced loca!ly in the lung by airway epithelial cells and is able to inhibit neutrophil elastase [137]. Therefore, SLPI may play an important role in the prevention of tissue damage by neutrophils during inflammation. ABE
Page 96: 2063633581 Log in for more options!
1388 A.J. SANDFORD ET AL. et al. [138] screened 114 individuals for polymorphisms in exons 2, 3 and 4 of the SLPI gene. The subjects in- eluded individuals with various cq-antitrypsin genotyp- es and 10 early onset COPD patients who did not have ct~-antitrypsin deficiency. However, no mutations were discovered, which suggests that structural alterations in the SLPI protein do not play a major role in the patho- genesis of COPD. Cathepsin G Cathepsin G is a sedne protease, and mutations in the gene for this enzyme may predispose individuals to COPD [139]. Therefore, exons 1-5 of the eathepsin G gene were screened for mutations in 180 individuals. A mutation was found in exon 4, which resulted in an amino acid substitution at position 125, but it was not associated with COPD. Summary In this manuscript, we have reviewed evidence for a genetic component to COPD and have described the genes that could contribute to the genetic risk. The diag- nosis of COPD is based on decreased expiratory air- flow, and it is possible that different pathophysiological processes contribute to this phenotype within and bet- ween patients. For example, bronchial smooth muscle cell hypertrophy, inflammatory narrowing of periphe- ral airways and loss of elastic recoil may contribute to a different extent in certain individuals. Susceptibility to these processes may have differing genetic bases. A search for genes that increase susceptibility to airflow obstruction among smokers may have implications be- yond the development of COPD. In epidemiological studies, a decrease in FEV1 has been shown to be a marker of premature mortality from other causes [140]. It is possible that an excessive pulmonary response to inhaled toxins and pollutants will serve as a marker of polymorphisms that increase susceptibility to other in- flammatory and degenerative diseases. The development of rapid, inexpensive molecular methods to screen for specific polymorphisms will allow an increased capacity to identify risk genotypes. This has profound relevance for the conduct of clinical investigations of environmen- tal risk, therapeutic interventions and clinical screening. References 1. Snider GL. Chronic obstructive pulmonary disease: risk factors, pathophysiology and pathogenesis. Ann Rev Med 1989; 40: 411--429. 2. Fletcher C, Peto R, Tinker C, Speizer bE. The natural history of chronic bronchitis: an eight year follow-up study of working men in London. Oxford, Oxford Uni- versity Press, 1976. 3. Bascom R. Differential susceptibility to tobacco smoke: possible mechanisms. Pharmacogenetics 1991; 1: 102- 106. 4. Tager IB, Rosner B, Tishler PV, Speizer bE, Kass EH. Household aggregation of pulmonary function and chro- nic bronchitis. Am Rev Respir Dis 1976; 114: 485--492. 5. Tager I, Tishler PV, Rosner B, Speizer bE, Litt M. Studies of the familial aggregation of chronic bronchi- tis and obstructive airways disease, lnt J Epidemiol 1978; 7: 55-62. 6. Khoury M J, Beaty TH, Newil CA, Bryant S, Cohen BH. Genetic-environmental interactions in chronic airways obstruction. Int J Epidemiol 1986; 15: 65-72. 7. Higgins M, Keller J. Familial occurrence of chronic respiratory disease and familial resemblance in ventila- tory capacity. J Chron Dis 1975; 28: 239-251. 8. Speizer FE, Rosner B, Tager I. Familial aggregation of chronic respiratory disease: use of national health inter- view survey data for specific hypothesis testing. Int J Epidemiol 1976; 5: 167-172. 9. Kueppers F, Miller R.D, Gordon H, Hepper NG, Offord K. Familial prevalence of chronic obstructive pulmonary disease in a matched pair study. Am J Med 1977; 63: 336-342. 10. Madison R, Zelman R, Mittman C. Inherited risk fac- tors for chronic lung disease. Chest 1980; 77 (2 Suppl.): 255-257. 11. Larson RK, Barman ML, Kueppers F, Fudenberg HH. Genetic and environmental determinants of chronic ob- structive pulmonary disease. Ann Intern Med 1970; 72: 627-632. 12. Cohen BH, Diamond EL, Graves CG, et al. A com- mon familial component in lung cancer and chronic obstructive pulmonary disease. Lancet 1977; ii: 523-526. 13. Kauffmann F, Tager IB, Mufioz A, Speizer FE. Familial factors related to lung function in children aged 6-10 years. Am J Epideraiol 1989; 129: 1289-1299. 14. Devor F_J, Crawford MH. Family resemblance for nor- mai pulmonary function. Ann Hum Biol 1984; 1 I: 439- 448. 15. Redline S, Tishler PV, Rosner B, et aL Genotypic and phenotypic similarities in pulmonary function among family members of adult monozygotic and dizygotic twins. Am J Epidemiol 1989; 129: 827-836. 16. Silverman E, Chapman H, Drazen J, et al. Early-onset chronic obstructive pulmonary disease (COPD): pre- liminary evidence for genetic factors other than Pi type. Am J Respir Crit Care Med 1996; 153: A48. 17. Rybicki BA, Beaty TH, Cohen BH. Major genetic mech- anisms in pulmonary function. J Clin Epidemiol 1990; 43: 667-675. 18. Astemborski JA, Beaty TH, Cohen BH. Variance com- ponents analysis of forced expiration in families. Am J Med Genet 1985; 21: 741-753. 19. Zamel N, Webster P, Lorimer E, Man S, Woolf C. En- vironment versus genetics in determining bronchial sus- " eeptibility to cigarette smoking. Chest 1981; 80: 57S. 20. Redline S, Tishler PV, Lewitter FI, Tager IB, Munoz A, Speizer bE. Assessment of genetic and nongenetic influences on pulmonary function: a twin study. Am Rev Respir Dis 1987; 135: 217-222. 21. Webster PM, Lorimer EG, Man SFP, Woolf CR, Zamel N. Pulmonary function in identical twins: comparison of nonsmokers and smokers. Am Rev Respir Dis 1979; 119: 223-228. 22. Hankins D, Drage C, Zamel N, Kronenberg R. Pulmo- nary function in identical twins raised apart. Am Rev Respir Dis 1982; 125: 119-121. 23. Hubert HB, Fabsitz RR, Feinleib M, Gwinn C. Genetic and environmental influences on pulmonary function in adult twins. Am Rev Respir Dis 1982; 125: 409--415. 24. Man SFP, Zamel N. Genetic influences on normal vari- ability of maximum expiratory flow-volume curves. J Appl Physiol 1976; 41: 874-877. 25. Soubrier F, Lathrop GM. The genetic basis of hyper- tension. Curr Opin Nephrol Hypertens 1995; 4:177-181. 2063633581
Page 97: 2063633582 Log in for more options!
GENETICS OF COPD 1389 26. Davies JL, Kawaguchi Y, Bennett ST, et al. A genome- wide search for human type 1 diabetes susceptibility genes. Nature 1994; 371: 130-136. 27. Vollmer WM, Johnson LR, Buist AS. Relationship of response to a bronchodilator and decline in forced expi- ratory volume in one second in population studies. Am Rev RespirDis 1985; 132: 1186-1193. 28. Lander ES, Schork NJ. Genetic dissection of complex traits. Science 1994; 265: 2037-2048. 29. Knowler WC, Williams RC, Pettitt DL Steinberg AG. Gra3;5,t3,14 and type 2 diabetes mellitus: an associa- tion in American Indians with genetic admixture. Am J Hum Genet 1988; 43: 520-526. 30. Laurell CB, Eriksson S. The electrophoretic alphas- globulin pattern of serum in alpha~-antitrypsin deficiency. Scand J Clin Invest 1963; 15: 132-140. 31. Mornex J-F, Chytil-Weir A, Martinet Y, Courtney M, LeCocq J-P, Crystal RG. Expression of the alphas-anti- trypsin gene in mononuclear phagocytes of normal and alphal-anfitrypsin deficient individuals. J Clin Invest 1986; 77: 1952-1961. 32. Cox DW, Johnson AM, Fagerhol MK. Repor~ of nomen- clature meeting for alpha~-antitrypsin. Hum Genet 1980; 53: 429-433. 33. Fagerhol MK, Lanrell CB. The Pi system: inherited variants of serum ct~- antitrypsin. Prog Med Genet 1970; 7: 96-111. 34. Allen RC, Harley RA, Talamo RC. A new method for determination of alpha|-antitrypsin phenotypes using iso- electric focusing on polyacrylamide gel slabs. Am J Clin Pathol 1974; 62: 732-739. 35. Birrer P, McElvaney NG, Chang-Stroman LM, Crystal RG. Alpha~-antitrypsin deficiency and liver disease. J Inher Metab Dis 1991; 14: 512-525. 36. Black LF, Kueppers F. Alpha|-antitrypsin deficiency in nonsmokers. Am Rev Respir Dis 1978; 117: 421-428. 37. Janus ED, Phillips NT, Carrell RW. Smoking, lung function and alphal-antitrypsin deficiency. Lancet 1985; i: 152-154. 38. Brantley ML, Paul LD, Miller BH, Falk RT, Wu M, Crystal RG. Clinical features and history of the destruc- tive lung disease associated with alpha~-antitrypsin defi- ciency of adults with pulmonary symptoms. Am Rev Respir Dis 1988; 138: 327-336. 39. Tobin M J, Cook PJL, Hutchinson DCS. Alpha|-anti- trypsin deficiency: the clinical and physiological features of pulmonary emphysema in subjects homozygous for Pi type Z: a survey by the British Thoracic Association. Br J Dis Chest 1983; 77: 14-27. 40. Sveger T. Liver disease in alpha|-antitrypsin deficiency detected by screening of 200,000 infants. N Engl J Med 1976; 294: 1316-1321. 41. O'Brien ML, Buist NRM, Murpbey WH. Neonatal screen- ing for alpha~-antitrypsin deficiency. J Pediatr 1978; 92: 1006-1010. 42. Shigeoka JW, Hall WL Hyde RW, et aL The preva- lence of alpha~-antitrypsin heterozygotes (PiMZ) in • patients with obstructive pulmonary disease. Am Rev Respir Dis 1976; 114: 1077-1084. 43. Bartmann K, Fooke-Achterrath M, Koch G, et al. Heterozygosity in the Pi system as a pathogenetic co- factor in chronic obstructive pulmonary disease (COPD). Eur J Respir Dis 1985; 66: 284-296. 44. Cox DW, Hoeppner VH, Levison H. Protease inhibitors in patients with chronic obstructive pulmonary disease: the aipha~-anfitrypsin heterozygote controversy. Am Rev Respir Dis 1976; 113: 601-606. 45. Janus ED. Alpha|-antitrypsin Pi types in COPD patients. Chest 1988; 94: 446-447. 46. Lieberman J, Winter B, Sastre A. Alpha~-antittypsin Pi types in 965 COPD patients. Chest 1986; 89: 370-373. 47. Mittman C, Lieberman J, Rumsfeld J. Prevalence of abnormal protease inhibitor phenotypes in patients with chronic obstructive lung disease. Am Rev Respir Dis 1974; 109: 295-296. 48. Barnett TB, Gottovi D, Johnson AM. Protease inhibitors in chronic obstructive pulmonary disease. Am Rev Respir Dis 1975; 111: 587-593. 49. Webb DR, Hyde RW, Schwartz RH, Hall WJ, Condemi JJ, Townes TL. Serum a~-antitrypsin variants. Am Rev Respir Dis 1973; 108: 918-925. 50. Cole RB, Nevin NC, Blundell G, Merrett JD, McDonald JR, Johnston WP. Relation of alphal-antitrypsin pheno- type to the performance of pulmonary function tests and to the prevalence of respiratory illness in a working pop- ulation. Thorax 1976; 31: 149-157. 51. Morse JO, Lebowitz MD, Knudson ILl, Burrows B. Relation of protease inhibitor phenotypes to obstructive lung diseases in a community. N Engl J Med 1977; 296:1190-1194. 52. Lebowitz MD, Knudson R.l, Morse JO, Armet D. Closing volume and flow volume abnormalities in alphas-anti- trypsin phenotype groups in a community population. Am Rev Respir Dis 1978; 117: 179-181. 53. Chan-Yeung M, Ashley M J, Corey P, Maledy H. Pi phenotypes and the prevalence of chest symptoms and lung function abnormalities in workers employed in dusty industries. Am Rev Respir Dis 1978; 117: 239-245. 54. McDonagh DJ, Nathan SP, Knudson RJ, Lebowitz MD. Assessment of alpha~-antitrypsin deficiency heterozy- go~ity as a risk factor in the etiology of emphysema. J Clin Invest 1979; 63: 299-309. 55. Buist AS, Sexton GJ, Azzarn A-MH, Adams BE. Pulmo- nary function in heterozygotes for alpha~-antitrypsin deficiency: a ease-control study. Am Rev Respir Dis 1979; 120: 759-766. 56. Bruce RM, Cohen BH, Diamond EL, et al. Collaborative study to assess risk of lung disease in Pi MZ phenotype subjects. Am Rev Respir Dis 1984; 130: 386-390. 57. Klayton R, Fallat R, Cohen AB. Determinants of chro- nic obstructive pulmonary disease in patients with inter- mediate levels of alphal-antitrypsin. Am Rev Respir Dis 1975; 112: 71-75. 58. Cooper DM, Hoeppner V, Cox D, Zamel N, Bryan AC, Levison H. Lung function in alpha~-antitrypsin betero- zygotes (Pi type MZ). Am Rev Respir Dis 1974; 110: 708-715. 59. Tattersall SF, Pereira RP, Hunter D, Blundell G, Pride NB. Lung distensibility and airway function in inter- mediate alphal-antitrypsin deficiency. Thorax 1979; 34: "637-646. 60. Hall WJ, Hyde RW, Schwartz RH, et al. Pulmonary abnormalities in intermediate alpha~-antitrypsin defi- ciency. J Clin Invest 1976; 58: 1069-1077. 61. Tfi'jan E, Magyar P, V~iczi Z, Lantos /~, Vaszfir L. Longitudinal lung function study in heterozygous PiMZ phenotype subjects. Eur Respir J 1994; 7: 2199-2204. 62. Owen MC, Brennan SO, Lewis JH, Can'ell RW. Mutation "- of antitrypsin to antithrombin: oq-antitrypsin Pittsburgh (358 met---~arg), a fatal bleeding disorder. N Engl J Med 1983; 309: 694-698. 63. Kalsheker NA, Hodgson IJ, Watkins GL, White JP, Morrison HM, Stockiey RA. Deoxyribonucleic acid (DNA) polymorphism of the a|-antitrypsin gene in chro- nic lung disease. Br Med J 1987; 294: 1511-1514. 64. Poller W, Meison C, Olek K. DNA polymorphisms of the ~|-antitrypsin gene region in patients with chronic obstructive pulmonary disease. Eur J Clin Invest 1990; 20: 1-7. 65. Kalsheker NA, Watkins GL, Hill S, Morgan K, Stockley
Page 98: 2063633583 Log in for more options!
1390 A.J. SANDFORD ET AL. RA, Fick RB. Independent mutations in the flanking sequence of the alphal-antitrypsin gene are associated with chronic obstructive airways disease. Dis Markers 1990; 8: 151-157. 66. Billingsley GD, Walter MA, Hammond GL, Cox DW. Physical mapping of four serpin genes: at-antit~psin, txl-antichymotrypsin, corticosteroid-binding globulin, and protein C inhibitor, within a 280 kb region on chro- mosome 14q32.1. AmJHura Genet 1993; 52: 343-353. 67. Cruickshank AM, Hansell DT, Bums HJG, Shenkin A. Effect of nutritional status on acute phase protein res- ponse to elective surgery. BrJSurg 1989; 76: 165-168. 68. Morgan K, Scobie G, Kalsheker N. The characterization of a mutation of the 3' flanking sequence of the a: antitrypsin gene commonly associated with chronic ob- structive airways disease. Eur J Clin Invest 1992; 22: 134-137. 69. Morgan K, Scobie G, Kalsheker NA. Point mutation in a 3' flanking sequence of the alphat-antitrypsin gene associated with chronic respiratory disease occurs in a regulatory sequence. Hum Mol Genet 1993; 2: 253-257. 70. Perlmutter DH, May LT, Sehgal PB. Intefferon-l~2/inter- leukin-6 modulates synthesis of txvantitrypsin in human mononuclear phagocytes and in human hepatoma cells. J Clin Invest 1989; 84: 139-144. 71. Ramji DP, Vitelli A, Tronche F, Cortese R, Ciliberto G. The two C/EBP isoforms, IL-6 DBP/NF-IL-6 and C/EBP 5 NF-IL-6 [~ are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res 1993; 21: 289--294. 72. Buraczynska M, Sch6tt D, Hanzlik A J, H61tmarm B, Ulmer WT. Alphat-antitrypsin gene polymorphism rela- ted to.respiratory system disease. Klin Woschr 1987; 65: 538--541. 73. Kilpatrick L, Johnson JL, Nickbarg EB, et aL Inhibition of human neutrophil superoxide generation by t~l-anti- chymotrypsin. J Imraunol 1991; 146: 2388-2393. 74. Burnett D, McGillivray DH, Stockley RA. Evidence that alveolar macrophages can synthesize and secrete alphal-antichymotrypsin. Am Rev Respir Dis 1984; 129: 473-476. 75. Eriksson S, Lindmark B, Lilja H. Familial a~-antiehy- motrypsin deficiency. Acta MedScand 1986; 220: 447- 453. 76. Lindmark BE, Arborelius M, Eriksson SG. Pulmonary function in middle-aged women with heterozygous defi- ciency of the serine protease inhibitor alpha~-antichy- motrypsin. Am Rev Respir Dis 1990; 141: 884-888. 77. Lindmark B, Svenonius E, Edksson S. Heterozygous txl-antichymotrypsin and PiZ a~-antitrypsin deficiency: prevalence and clinical spectrum in asthmatic children. Allergy 1990; 45: 197-203. 78. Poller W, Faber J-B, Scholz S, et al. Mis-sense muta- tion of a:antichymotrypsin gene associated with chro- nic lung disease. Lancet 1992; 339: 1538. 79. Poller W, Faber $-P, Weidinger S, et al. A leucine-to- proline substitution causes a defective ctt-antichymotryp- sin allele associated with familial obstructive lung ~.sease. Genomics 1993; 17: 740-743. 80. Samilchuk EI, Chuchalin AG. Mis-sense mutation of a:antichymotrypsin gene and chronic lung disease. Lancet 1993; 342: 624. 81. Welch MJ, Tsui L-T, Boat TF, Beaudet AL. The Metabolic Basis of Inherited Disease. In: Scriver CL, Beaudel AL, Sly WS, Valle D, eds. New York, McGraw- Hill Inc., 1995; pp. 3799-3876. 82. Meindl RS. Hypothesis: a selective advantage for cys- tic fibrosis heterozygotes. Am J Phys Anthropol 1987; 74: 39-45. 83. Shier WT. Increased resistance to influenza as a poss~le source ofheterozygote advantage in cystic fibrosis. Med Hypotheses 1979; 5: 661-667. 84. Quinton PM. Fluid and Electrolyte Abnormalities in Exocrine Glands in Cystic Fibrosis. In: Quinton PM, Martinez R J, Hopfer U, eds. San Francisco, San Francisco Press, 1982; pp. 53-76. 85. Gabriel SE, Brigman KN, Koiler BH, Boucher RC,. Stutts MJ. Cystic fibrosis resistance to cholera toxin in the cystic fibrosis mouse model. Science 1994; 266:1 107-109. 86. Anderson CM, Freeman M, Allan J, Hubbard L. Observa-, tions on: i) sweat sodium levels in relation to chronic respiratory disease in adults; and ii) the incidence of respiratory and other disease in parents and siblings of patients with fibroeystie disease of the pancreas. Med J Aust 1962; 1: 965-969. 87. Orzaleski MM, Kohner D, Cook CD, Shwachman H. Anamnesis: sweat electrolyte and pulmonary function studies in parents of patients with cystic fibrosis of the pancreas. Acta Paediatr 1963; 52: 267-276. 88. Batten J, Muir D, Simon G, Cedric C. The prevalence of respiratory disease in heterozygotes for the gene for fibrocystie disease of the pancreas. Lancet 1963; i: 1348-1350. 89. Hallett W'Y, Knudson AG, Massey FJ. Absence of detri- mental effect of the carrier state for the cystic fibrosis gene. Am Rev Respir Dis 1965; 90: 714-724. 90. Davies PB. Autonomic and airway reactivity in oblig- ate heterozygotes for cystic fibrosis. Am Rev Respir Dis 1984; 129:911-914. 91. Davis PB, Vargo K. Pulmonary abnormalities in oblig- ate heterozygotes for cystic fibrosis. Thorax 1987; 42: 120-125. 92. Kerem B-S, Rommens JM, Buchanan JA, et al. Identifi- cation of the cystic fibrosis gene: genetic analysis. Science 1989; 245: 1073-1080. 93. Poller W, Faber J-P, Scholtz S, Olek K, Mtiller K-M. Sequence analysis of the cystic fibrosis gene in patients with disseminated bronchiectatic lung disease. Klin Wschr 1991; 69: 657-663. 94. Dumur V, Lafitte J-J, Gervais R, et al. Abnormal distri- bution of cystic fibrosis AF508 allele in adults with chro- nic bronchial hypersecretion. Lancet 1990; 335: 1340. 95. Gervals R, Lafitte J-J, Dumur V, et al. Sweat chloride and AF508 mutation in chronic bronchitis or bronchiec- tasis. Lancet 1993; 342: 997. 96. Akai S, Okayama H, Shimura S, Tanno Y, Sasaki H, Takisima T. AF508 mutation of cystic fibrosis gene is not found in chronic bronchitis with severe obstruction in Japan. Am Rev Respir Dis 1992; 146: 781-783. 97. Artlich A, Boysen A, Bunge S, Entzian P, Schlaak M, Schwinger E. Common CFrR mutations are not likely to predispose to chronic bronchitis in Northern Germany. Hum Genet 1995; 95: 226-228. 98. Entzian P, Mtiller E, Boysen A, Artlich A, Schwinger E, Schlaak M. Frequency of common cystic fibrosis gene mutations in chronic bronchitis patients. Scand J Lab Invest 1995; 55: 263-266. 99. Pignatti PF, Bombied C, Marigo C, Benetazzo M, Luisetti M. Increased incidence of cystic fibrosis gene muta- tions in adults with disseminated bronchiectasis. Hum Mol Genet 1995; 4: 635-636. 100. Pignatti PF, Bombieri C, Benetazzo M, et al. CIzTR gene variant IVS8-5T in disseminated bronchiectasis. Am J Hum Genet 1996; 58: 889-892. I01. Gasparini P, Savoia A, Luisetti M, Peona V, Pignatti PF. The cystic fibrosis gene is not likely to be involved in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 1990; 2: 297-299. 102. Kew R.R, Webster RO. Gc-globulin (vitamin D-binding
Page 99: 2063633584 Log in for more options!
GENETICS OF COPD 1391 protein) enhances the neutrophil chemotactic activity of CSa and C5a des Arg../Clin Invest 1988; 82: 36~-369. 103. Yamamoto N, Homma S. Vitamin D-binding protein (group-specific component) is a precursor for the mac- rophage-activating signal factor from lysophosphatidyl- choline-treated lymphocytes. Proc Natl Acad Sci USA 1991; 88: 8539-8543. 104. Horue SL, Cockcroft DW, Dosman JA. Possible pro- tective effect against chronic obstructive airways dis- ease by the GC 2 allele. Hum Hered 1990; 40: 173-176. 105. Kauffmann F, Kleisbauer J-P, Cambon-de-Mouzon A, et al. Genetic markers in chronic airflow limitation: a genetic epidemiologic study. Am Rev Respir Dis 1983; 127: 263-269. I06. White R, Janoff A, Godfrey HP. Secretion of alphaz- macroglobulin by alveolar macrophages. Lung 1980; 158: 9-14. I07. Mosher DF, Wing WA. Synthesis and secretion of c~a- macroglobulin by cultured human fibroblasts. J Exp Med 1976; 143: 462-467. I08. BShm N, Shah I, Totovic" V, Karitzky D. Combined at-antitrypsin and c~2-macroglobulin deficiency syn- drome: fight microscopic evidence of coIlagenolytic, elastolytic and myolytic tissue lesions. Path Res Prac 1980; 168: 17-35. I09. Burnett D, Stockley RA. Serum and sputum a2-macro- globulin in patients with chronic obstructive airways disease. Thorax 1981; 36: 512-516. I I0. Brissenden JE, Cox DW. AIpha2-macroglobufin in pati- ents with obstructive lung disease, with and without a: antitrypsin deficiency. Clin Chim Acta 1983; 128: 241-248. 111. Gain'or PO, Laurell CB, Eriksson S. Obstructive lung disease and trypsin inhibitors in at-antitrypsin deft- cien~y. Scand J Clin Lab Invest 1967; 19: 205-208. 112. Bergqvist D, Nilsson IM. Hereditary ec2-macroglobufin deficiency. Scand ~ Haematol 1979; 23: 433-436. 113. Stenbjerg S. Inherited alpha~-macroglobulin deficiency. Thrombosis Res 1981; 22: 491-495. 114. Poller W, Faber J-P, Klobeck G, Olek K. Cloning of the human ~-macroglobulin gene and detection of muta- tions in two functional domains: the bait region and the thiolester site. Hum Genet 1992; 88: 313-319. 115. Poller W, Barth J, Voss B. Detection of an alteration of the e~-macroglobulin gene in a patient with chronic lung disease and serum (~,z-macroglobufin deficiency. Hura Genet 1989; 83: 93-96. 116. Drakoulis N, Cascorbi I, BrockmSller J, Gross CR, Roots I. Polymorphisms in the human CYPIA1 gene as sus- ceptibility factors for lung cancer: exon-7 mutation (4889 A to G), and a T to C mutation in the Y-flanking region. Clin Invest 1994; 72: 240-248. 117. Cantlay AM, Lamb D, Gillooly M, et al. Association between the CYP1A1 gene polymorphism and suscepti- bility to emphysema and lung cancer. J Clin Pathol: Mol Pathol 1995; 48: M210-214. 118. Cohen BH, Ball WC, Brashears S, et aL Risk factors in chronic obstructive pulmonary disease (COPD). Am J Epidemiol 1977; 105: 223-232. 119. Beatty TH, Menkes HA, Cohen BH, Newill CA. Risk factors associated with longitudinal change in pulmonary function. Am Rev Respir Dis 1984; 129: 660-667. 120. Krzyzanowski M, Jedi3'chowski W, Wysocki M. Factors associated with the change in ventilatory function and the development of chronic obstructive pulmonary dis- ease in a 13 year follow-up of the Cracow study. Am Rev Respir Dis 1986; 134: 1011-1019. 121. Higgins MW, Keller JB, Becker M, et al. An index of risk for obstructive airways disease. Am Rev Respir Dis 1982; 125: 144-151. 122. Vestbo J, Hein HO, Suadicani P, SOrensen H, Gyntelberg F. Genetic markers for chronic bronchitis and peak expiratory expiratory flow in the Copenhagen Male Study. Dan Med Bull 1993; 40: 378-380. 123. Cohen BH, Bias WB, Chase GA, et al. Is ABH non- secretor stares a risk factor for obstructive lung disease? Am J Epidetniol 1980; 111: 285-291. 124. Haines AP, Imeson JD, Meade TW. ABH secretor sta- tus and pulmonary function. Am J Epidemiol 1982; 115: 367-370. 125. Abboud RT, Yu P, Chan-Yeung M, Tan F. Lack of relationship between ABH secretor status and lung func- tion in pulp-mill workers. Am Rev Respir Dis 1982; 126: 1089-1091. 126. Home SL, Cockcroft DW, Lovegrove A, Dosman JA. ABO, Lewis and secretor status and relative incidence of airflow obstruction. Dis Markers 1985; 3: 55--62. 127. Kauffmann F, Frette C, Pham Q-T, Nafissi S, Bertrand J-P, Oriol R. Associations of blood group-related anti- gens to FEVI, wheezing and asthma. Am 3 Respir Crit Care Med 1996; 153: 76-82. 128. Raza MW, Blackwell CC, Molyneaux P, etaL Associa- tion between secretor status and respiratory viral illness. Br Med J 1991; 303: 815-818. 129. Sugiyama Y, Kudoh S, Maeda H, Suzaki H, Takaku F. Analysis of HLA antigens in patients with diffuse pan- bronchiolitis. Am Rev Respir Dis 1990; 14l: 1459-1462. 130. Bj5rkander J, Bake B, Oxelius VA, Hanson 1.~. Impaired lung function in patients with IgA deficiency and low levels of IgG2 or IgG3. N Engl J Med 1985; 313: 720- 724. 131. O'Keefe S, Gzel A, Drury R, Cullina M, Greally J, Finnegan P. Immunoglobulin G subclasses and spirom- etry in patients with chronic obstructive pulmonary dis- ease. Eur Respir J 1991; 4: 932-938. 132. Oxelius VA, Laurell AB, Lindquist B, et al. lgG sub- classes in selective IgA deficiency. N Engl J Med 1981; 304: 1476-1477. 133. Webb DR, Condemi JL Selective immunoglobulin A deficiency and chronic obstructive lung disease. Ann Intern Med 1974; 80: 618-621. Folz ILl, Peno-Green L, Crapo JD. Identification of a homozygous mis-sense mutation (Arg to Gly) in the crit- ical binding region of the human EC-SOD gene (SOD3) and its association with dramatically increased serum enzyme levels. Hum Mol Genet 1994; 3: 2251-2254. 135. SandstrSm J, Nilsson P, Karlsson K, Marklund SL. Tenfold increase in human plasma extracellular super- oxide dismutase content caused by a mutation in heparin- binding domain. JBiol Chem 1994; 268: 19163-19166. 136. Peno-Green L, Crapo JD, Folz RJ. Characterization of human serum extracellular superoxide dismutase vari= ants in normal and lung disease individuals. Am JRespir Crit Care Med 1995; 151: A167. 137. Sallenave J-M, Shulmann J, Crossley J, Jordana M, Gauldie J. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/Elafin) in human airway epithelial airway cells by cytokines .-and neutrophilic enzymes. Am J Respir Cell Mol Biol 1994; 1 I: 733-741. 138. Abe T, Kobayashi N, Yoshimura K, et al. Expression of the secretory leukoprotease inhibitor gene in epithe- lial cells. J Clin Invest 1991; 87: 2207-2215. 139. Liidecke B, Poller W, Olek K, Bartholom~ K. Sequence variant of the human cathepsin G gene. Hum Genet 1993; 91: 83-84. 140. Weiss ST, Segal MR, Sparrow D, Wager C. Relation of FEVI and peripheral blood leukocyte count to total mortality: the normative aging study. Am J Epidemiol 1995; 142: 493-498. 134.
Page 100: 2063633585 Log in for more options!
2063633585
Page 101: 2063633586 Log in for more options!
186 NX813 q.1 PONE ATHEROSCLEROSZS 97 , (OlELSEVZER 501 IRELAHD LTD ZR iil ELSEVIER Atherosclerosis 129 (1997) 41-48 .... ATH EROSCLEROSIS Ig Ig Risk factors associated with the development of peripheral arterial disease in smokers: a case-control study Janet T. PowelP,*, Richard J. Edwards", Phillip C. Worrella, Peter J. Franksa, Roger M. Greenhalgha, Neil R. Poulter~'b aDepartment of Surgery, Charing Cross and Westminster Medical School, Fulham Palace Road, London W6 8RF, UK bDepartment of Epidemiology and Public Health, UCLMS, I-19 Torrington Place, London WCIE 6BT, UK Received 4 June 1996; revised 9 October 1996; accepted 4 November 1996 lt_ l Abstract Purpose and method: A hospital based case-control study was designed to investigate what aspects of smoking and what co-factors of smoking are associated with the development of peripheral arterial disease (PAD). Cases were 291 smokers, newly referred with PAD, and controls were 828 age and sex matched smokers without PAD. Results: Reported recent tobacco usage was similar in cases and controls but total tobacco exposure was associated with the risk of PAD--adjusted odds ratios (ORs) increasing with tertile of pack-years smoked to reach 1.63 (95% CI, 1.11-2.39; P = 0.011), for the highest tertile ( > 48 pack-years) compared with smokers in the lowest tertile (< 31 pack-years). Cases reported smoking significantly lower tar and nicotine yield cigarettes than controls, but tended to inhale more deeply, and had significantly higher plasma concentrations of cotinine. ORs for PAD were significantly and independently increased by systolic blood pressure > 160 mmHg (8.1 (5.2-13.0); P < 0.0001), history of hypertension (2.4 (1.5-3.2); P = 0.0003) and apolipoprotein B > 0.9 g/1(3.8 (2.3-7.6); P - 0.008). Conclusions: Increased total exposure to tobacco and the ability to smoke tobacco in a way which maximises nicotine yield are associated with increased risk of smokers developing PAD. There is no evidence that smoking low tar cigarettes reduces this risk, whereas both hypertension (particularly systolic) and high levels of apolipoprotein B, increase this risk. © 1997 Elsevier Science Ireland Ltd. Keywords: Peripheral atheros~lerosis; Smoking; Low tar cigarettes; Apolipoprotein B; Systolic hypertension 1. Introduction Smoking has been identified consistently as the major risk factor for the development of peripheral arterial disease (PAD), and over 90% of patients with symp- tomatic PAD having a chronic smoking history [1-4]. Nevertheless the importance of other cardiovascular risk factors, genetic background or the particular facets of the smoking habit that differentiate those smokers who do and do not develop PAD is not clearly estab- lished. Reported data concerning systolic and diastolic blood pressure (BP), glucose intolerance and lipids, as *Corresponding author. Tel: +44 181 8467312; fax: +44 181 8467330. risk factors for PAD, are inconsistent, although the data concerning diabetes and plasma fibrinogen are more consistent [4]. However the effect of smoking to increase plasma fibrinogen concentrations varies ac- cording to particular fibrinogen genotypes [5] and it is also possible that the dietary modifications associated with smoking influence the development of cardiovas- cular disease [6]. Although there is consistent evidence that the risk of developing lung cancer is directly re- lated to the tar yield of cigarettes [7,8], the evidence linking tar yields to the development of cardiovascular disease is limited and controversial [9-12]. Since more than 30% of adults over 40 years of age smoke and therefore are potentially at risk of develop- ing PAD [13], it is important to try to identify what 0021-9150,97/517.00 ~ 1997 Elsevier Science Ireland Ltd. All rights reserved. PII S0021-91 50( 96106012-I
Page 102: 2063633587 Log in for more options!
42 J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 co-factors determine the development of symptomatic PAD. Therefore the present case-control study was designed to compare the prevalence of details of smok- ing habit and various cardiovascular risk factors in two populations of smokers, those with symptoms of PAD referred for diagnosis and surgical opinion (cases) and other hospital patients without symptomatic PAD (con- trols). 2. Subjects and methods Cases comprised consecutive new referrals to the Vascular Surgical Service at Chafing Cross Hospital for evaluation of presumed PAD, who reported smoking in :the previous 4 weeks (current smokers). Between 1988 and the end of 1992 there were 654 new referrals of whom 35 (5%) had never smoked, 289 (44%) had stopped smoking more than 4 weeks ago and 330 (50%) were current smokers (potential cases): of these, 319 cases agreed to take part in the study. By means of systematic screening of suitab!e clinics and wards over the same period, 961 potential controls who also re- ported smoking in the previous 4 weeks, were identified, of whom 899 agreed to take part in the study. Of these, 556 (62%) were recruited from outpatient clinics (ortho- paedic, ophthalmology, dermatology and urology) at Charing Cross and St Mary's. Hospitals and 343 (38%) from Chafing Cross inpatient wards (short-stay, urol- ogy, general surgery and orthopaedic). Controls were chosen to ensure that the age-sex distribution broadly matched that among the cases. All data were recorded on a study questionnaire which was partly self-adminis- tered and was not returned by 22 potential cases and 39 controls. Cases and controls reporting a history of emphysema or of cancer of the lung, upper respiratory tract, mouth, lip, stomach, oesophagus or bladder were excluded. Controls who reported positively to a standard claudi- cation questionnaire [14] were excluded. Subjects were not excluded from the study if they refused consent for a blood sample. Following application of these exclu- sion criteria 291 cases (192 males) and 828 controls (536 males) remained eligible for inclusion in the study. Of the 291 cases, 255 (88%) had intermittent claudication and 36 (12%) had critical ischaemia. Intermittent clau- dication was defined from the history and Clinical ex- amination in the presence of an ankle/brachial systolic pressure index of < 0.8. Critical ischaemia is defined as either persistently recurring ischaemic rest pain requir- ing regular adequate analgesia for more than 2 weeks with an ankle pressure of < 50 mmHg, or ulceration of the foot or toes, with an ankle systolic pressure of < 50 mmHg [15]. Of the 828 controls 266were recruited from ortho- paedic outpatients. 116 from urology outpatients, 110 from opthalmology outpatients, 72 from dermatology outpatients, 142 were in-patients for herniorrhaphy, 83 were urology in-patients and 39 orthopaedic in-pa- tients. Past history of diabetes, hypertension and abnormal blood lipids with details of current medication and a history of parents or siblings dying from cardiovascular disease before the age of 60 were recorded in the questionnaire. For each mode of tobacco use (manufac- tured cigarettes, rolls-ups, pipes and cigars) subjects were asked for the age at which they started smoking, whether they had stopped and when, and maximum amounts smoked per day between ages 15-30, 31-50, 51 and above and during the last year. Roll-up cigarette smokers were asked to give amounts smoked per day. as either number of cigarettes smoked per day or ounces of tobacco (1/2 ounce of tobacco =20 cigarettes). Manufactured cigarette smokers were asked for the length of time they had smoked filter tipped cigarettes and roll-up cigarette smokers, whether they inserted filters into their roll-ups. Manufactured cigarette smok- ers were asked for the exact names of the brands they had smoked in the previous 5 years and for how long they had smoked each. Pack years were calculated for manufactured and roll-up cigarette smokers by multi- plying duration of smoking by the number of cigarettes smoked per day divided by 20, for the 3 age bands, and these values were then added together. Average yields of tar, carbon monoxide.and nicotine per cigarette were coded from estimates given by the Laboratory of the Government Chemist for June 1989. Newer brands were coded according to later estimates. Cigarette smokers were asked for usual length of cigarette smoked (greater than half, about half or less than half) and usual depth of inhalation (mouth and nose only, back of throat, lungs moderately or lungs deeply). All subjects were asked how many times they had smoked in the previous week, the previous day and on the day of their interview. Social class was assessed on the basis of current and past employment, the subject's last occupation was used if currently retired or unemployed and spouse's occupa- tion was used for married or widowed female subjects. Average weekly exercise output was evaluated and specific dietary information, including fat and salt in- take were recorded, using a validated questionnaire [16]. For the first 500 subjects, heights and weights were measured but thereafter, only subjects' self-reported height and weight were available for use in analyses. Routine clinic pulse and BP readings were recorded. Non-fasting blood samples were obtained by antecu- bital venepuncture using EDTA anticoagulated tubes from 235 cases and 382 controls. Carboxyhaemoglobin was measured on an IL-282 carboximeter (coefficient of variation: 3.2%), plasma thiocyanate by an automated
Page 103: 2063633588 Log in for more options!
ular the ects ette ices es). the ttes [I ted ok- hey ~or tlff- ttes ere':|- the :tte I ~ 2tte , all) dy. ~cd lay ~ed 2ts. tire J.T. Powell et aL/ Atherosclerosis 129 (1997~ 41-48 43 colourimetric assay (coefficient of.variation: 9.5%) [17] and plasma cotinine by gas liquid chromatography (coefficient of variation: 18%) [18]. Total cholesterol, fibrinogen and apolipoprotein (B) were measured as previously described (coeffic.ients of variation: 2.7, 5.4 and 4.9% respectively) [19]. Apolipoprotein(a) was mea- sured by radioimmunoassay (Pharmacia, UK) accord- ing to the manufacturer's instructions (coefficient of variation: 5.0%). 3. Statistical methods Analyses were carried out using SPSSx computer software [20]. To assess the strength of association between each variable and the disease, odds ratios (ORs) with 95% CI were calculated. Continuous vari- ables were categorised into tertiles. All CI for OR's were calculated using the legit method for large sam- ples. Because smoking habit has previously been identified as the pivotal risk factor for PAD, an initial logistic regression was conducted to compare different mea- sures of smoking to determine which was most closely associated with PAD and hence should be used to adjust other case-control comparisons. A stepwise backwards elimination procedure was used (P= 0.10 for terms to drop out of the model). Variables consid- ered were pack years, age started smoking, inhalation into the lungs, mode of smoking, and years smoking filter-tipped cigarettes as a proportion of total years smoking. Pack years could only be calculated meaning- fully for manufactured and roll-up cigarette smokers and hence this analysis (which requires complete data for each subject) excluded pipe and cigar smokers (n = 24 cases and 105 controls). Pack-years was identified as the most significant smoking related factor differentiat- ing cases from controls. Multiple logistic regression was then used to identify other variables adjusted for age, sex, diabetes and pack-years history of smoking, associ- ated with the disease. To evaluate whether continuous variables were associated in a linear fashion with PAD, they were categorised into quartiles and log-odds were .plotted against the median of each quartile. Since no variables exhibited linear relationships, all continuous variables were treated in the multiple logistic regression as unordered categorical variables distributed in tertiles. 4. Results 4. I. General characteristics of cases and controls The mean ages of cases and controls were 64.8 (interquartile range 58-71) years and 63.7 (interquartile range 56-71) years, respectively. The mean body mass index of cases was 24.4 (interquartile range 22-27) kg/mz compared with 24.0 (interquartile range 22-27) kg/m2 in controls. A history of diabetes was signifi- cantly more common among cases than controls (12 versus 5% respectively, P < 0.001). Cases also reported a history of hypertension and hyperlipidaemia more frequently than did controls, with 99 cases (34%) re- porting hypertension compared with 166 controls (20%), P < 0.001 and 29 cases (10%) reporting hyperlip- idaemia compared with 30 controls (4%), P < 0.001. In keeping with the significantly higher reported rates of hypertension and diabetes, and the presence of PAD among cases, the use of medications for hypertension and diabetes, anticoagulants and aspirin was more fre- quent among cases than controls (data not shown). No other medications were used differentially by cases and controls. There was no difference in socioeconomic class between cases and controls. Almost half (48%) of cases and controls were in socioeconomic class III, with 28% being in higher social classes in "both groups. 4.2. Smoking habits and their validation by smoking markers Levels of risk associated with various aspects of reported smoking habit are shown in Table 1. Similar proportions in each group, (about three-qua.rters), smoked manufactured cigarettes and a further one sixth smoked hand-rolled cigarettes. The reported number of cigarettes smoked in the last year was similar in cases and controls although there was a statistically non-sig- nificant trend for cases to have started smoking at a younger age and to have smoked for longer than con- trols. Hence an increased cumulative pack-year history was more sighificantly associated with the development of PAD (P = 0.011) than pack-year history in earlier years of life (P -- 0.05). The depth of smoke inhalation tended to be greater among cases than controls, (P= 0.16). Only half the women, cases and controls, reported lung inhalation. Among men the depth of smoke inhalation was greater among cases than controls (P = 0.009). There were no significant differences between cases and controls in use of filtered cigarettes (98% of all those smoking manu- factured cigarettes) or the amount of cigarette smoked (more than half the cigarette smoked by 89% of cases and 86% of controls). Nearly all of the manufactured cigarette smokers (96%) could provide the name of the brand used most recently and 88% could remember what they smoked .5 years ago. The tar and nicotine yield of manufactured cigarettes derived from the brands reportedly used by cases were significantly lower than those used by controls .both at the time of the interview and 5 years previously (Table 2). During the 5 years before presentation 28% of cases and 25% of controls had switched cigarette brands. Although a 2063633588
Page 104: 2063633589 Log in for more options!
Table l Tobacco usage J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 Cases (n = 291) Controls (n = .828) ORa (95% CI) Type of tobacco use at interview Manufactured cigarettes.onls~ 218 (75%) 609 (74%) Roll-up cigarettes only 49 (17%) 108 (13%) Pipe only 8 (3%) 48 (6%) Cigars only 11 (4%) 40 (5%) Mixture 5 (2%) 17 (2%) P=0.185 Depth of inhalation Mouth and nose 53 (18%) 182 (22%) 1.0 Back of throat 49 (17%) 143 (17%) 1.15 (0.73-1.82) Lungs moderate 128 (44°'4) 324 (39%) 1.43 (0.98-2.11) Lungs deep 59 (20%) 173 (21%) 1.25 (0.80-1.96) ; 289 822 P = O. 159 bNumber/day (last year) < 15 97 (36%) 268 (37%) " 1.0 15-24 121 (45%) 297 (4t%) 1.36 .(0.98, 1.90) 25+ 49 (18%) 152 (21%) 1.06 (0.70, 1.63) 267 717 P = 0.522 bAge started (years) < 16 92 (35°'4) 221 (31%) 1.0 16-19 93 (35°/'0) 235 (33%) 0.94 (0.66, 1.34) 20+ 80 (30%) 253 (36%) 0.75 (0.52, 1.08) 265 709 P ~ 0.119 Years smoked <40 69 (26%) 224 (34%) 1.0 40-49 101 (38%) 238 (34%) 1.22 (0.79, 1.90) 50+ 95 (36%) 227 (32%) 1.35 (0.77, 2.36) 265 709 P = 0.283 bTotal pack years smoked <31 72 (27%) 253 (35°,4) '1.0 31-48 86 (32°/'0) 237 (33%) 1.23 (0.84, 1.79) 49+ 107 (40%) 220 (31%) 1.63 (t.11, 2.39) 265 709 P = 0.011 ~Pack )'ears smoked before 31 )'ears of age < 11 79 (30%) 258 (36°'4) 1.0 l 1 - 16 101 (38%) 238 (34%) 1.69 (1.09-2.75) 17 + 85 (32%) 213 (30%) 1.25 (0.76- 2.23) 265 709 P = 0.05 Tabh I'~~ Ttlr 9 14 Tar 14 .Vic, .Vic~ OR are adjusted for age and sex, P-values are 2'.2 for trend. For subjects smoking cigarettes (manufactured or roll-up) at interview, 267 cases, 717 controls. greater proportion of cases than controls switched to low tar cigarettes (8% and 3% respectively), this differ- ence was not significant. Biochemical smoking markers varied with age, sex and depth of inhalation. After adjustment for these factors, there was a tendency for the risk of PAD to be associated with increased levels of carboxyhaemoglobin and plasma thiocyanate and a significant association with increasing concentrations of plasma cotinine (P = 0.006) (Table 2). Since recent cigarette consumption was similar among cases and controls, the observation that cases, who reported smoking lower nicotine yield cigarettes, had increased concentrations of plasma co- tinine was parad.oxical. The role of recall bias to ex- plain this paradox was investigated by comparing reported recent smoking habit with objective smoking markers in cases and controls. Of subjects who reported not smoking in the 24 h immediately prior to interview, 9/17 (53%) cases and 5/9 (56%) controls had cotinine concentrations (tl.2 -~ 18 h) in the range indicative of
Page 105: 2063633590 Log in for more options!
J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 Table 2 Level of tobacco smoke component for cigarette brand and objective markers of smoking among users of manufactured cigarettes 45 Cases (n = 218) Controls (n = 609) ORa (95% CI) I. ili !| i| I | I- il Tar level (mg/cigarette) current cigarette <9 78 (38%) 181 (31%) 1.0 9-13 65 (32%) 15I (26%) 1.0I (0.67, 1.52) 14+ 62 (30%) 253 (43%) 0.57 (0.38, 0.86) 205 585 P = 0.005 Tar level (mg/cigarette) cigarette smoked 5 years ago <9 65 (35%) 168 (31%) 1.0 9-13 50 (27%) 126 (23%) 1.00 (0.69, 1.70) 14+ 69 (38%) 246 (46%) 0.76 (0.50, 1.15) 184 540 P = 0.17 Nicotine level (mg/cigarette) current cigarette <0.8 52 (25%) 119 (20%) 1.0 0.8-1.1 77 (38%) 181 (31%) 1.01 (0.65, 1.56) 1.2+ 76 (37%) 285 (49%) 0.63 (0.41, 0.97) 205 585 P = 0.017 Nicotine level (mg/cigarette) cigarette smoked 5 years ago <0.8 65 (35%) 173 (32%) 1.0 0.8-1.1 58 (32%) 135 (25%) 1.08 (0.68, 1.55) 1.2+ 51 (33%) 232 (43%) 0.65 (0.44, 1.06) 184 540 P -- 0.20 bWhole blood carboxyhaemoglobin (%) <2.7 40 (20%) 86 (29%) 1.0 2.7-4.4 77 (39%) 98 (33%) 1.70 (1.03, 2.81) 4.5+ 79 (40%) 110 (37%) 1.62 (0.97, 2.70) 196 294 P ~ 0.08 bPlasma cot#~ine (nmol/l) < 300 300-699 700 + b Plasma ~hiocyanate (.umol/l) < 100 100-150 150+ 40 (21%) 99 (34%) 1.0 80 (41%) 110 (34%) 1.78 (1.09, 2.91) 75 (38%) 85 (29%) 2.05 (1.24, 3.40) 195 294 P = 0.006 49 (25%) 101 (35%) 1.0 80 (41%) 95 (330/0) 1.89 (1.17, 3.05) 67 (340/0) 98 (33%) 1.58 (0.96, 2.62) 196 294 P = 0.08 :ld tag ~ All OR are adjusted for age and sex and additionally for depth of inhalation for the smoking markers, the P-value is obtained from Z'- for trend analysis. ~ Only those with a blood sample taken on the day they attended hospital are used in these analyses, where the OR has been adjusted for age, sex and depth of inhalation. recent smoking, whereas for those who admitted smok- ing in the past 24 h 168/9 (99%) cases and 283/285 (99"/,) controls had continine concentrations in the -smoking range. Even for the shorter half-life marker carboxyhaemoglobin (q ,_ 4-5 h), 5/17 (29%) cases and 3i9 (33%) controls, had levels indicative of very recent smoking. Hence, assuming the accurate discriminant powers of the smoking markers, inaccurate reporting of very recent smoking was similar in cases and controls. 4.3. Cardiovascular risk factors In order to evaluate the risks of developing PAD in association with several standard cardiovascular risk factors, the ORs of developing PAD using separate logistic regression analyses run for each variable, unad- justed and adjusted for age, sex, diabetes and pack years, are presented in Table 3. No increased risk of developing PAD was associated with ethnic origin,
Page 106: 2063633591 Log in for more options!
46 J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 Table 3 Risk factors for peripheral arterial disease in smokers OR (95% CI) P-value ~Adjusted OR (95% CI) bP-value Systolic blood pressure (mmHg) < 140 1.0 1.0 140-159 2.91 (1.81, 4.66) 2~69 (1.66, 4.38) 160+ 8.07 (4.85, 13.49) <0.0001 7.63 (4.45, 13.07) <0.0001 167 cases, 355 dontrols 1.0 1.0 1.10 (0.68, 1.80) 1.08 (0.66, 1.79) 2.08 (1.33, 3.30) 0.001 1.95 (1.22, 3.11) 0.004 Diastolic blood pressure (mmHg) Cholesterol (mmol/l) Apolipoprotein B (g/l) Apolipoprotein(a) (mg/dl) Fibrinogen (g/l) <75 75-84 85+ 167 cases, 355 controls <5.2 5.2-6.4 6.5+ 205 cases, 382 controls <0.70 0.70-0.89 0.9+ <I0 10-39 40+ <5.1 5.1-6.0 6.1+ 1.0 1.0 1.63 (1.03, 2.59) 1.89 (1.16, 3.08) 2.10 (1.33, 3.33) 0.002 2.82 (1.70, 4.67) 1.0 1.0 2.72 (1.65, 4.48) 2.82 (1.68, 4.76) 4.06 (2.50, 6.61) . <0.0001 4.45 (2.65, 7.45) 204 eases, 382 controls 1.0 0.78 (0.50, 1.20) 1.19 (0.74, 1.81) 204 cases, 379 controls 1.0 1.51 (0.96, 2.37) 1.85 (1.21, 2.87) 197 eases, 374 controls <0.0001 <0.0001 1.0 0.71 (0.46, 1.12) 0.396 1.25 (0.81, 1.92) 0.24 1.0 1.32 (0.83, 2.11) 0.005 1.66 (1.05, 2.62) 0.02 l./ll l, [ [ l i Adjusted for age, sex, diabetes and pack years of smoking. Z'z test or chi square for trend (3 categories). social class, age started smoking, type of tobacco product used, or family history of arterial disease. A complete data set was only available for 413 subjects (141 cases and 272 controls) who smoked manufactured cigarettes, largely because blood samples were not obtained from all subjects. However there w, ere no differences between those who gave a blood sample and those who did not with respect to age, sex, pack-year history of smoking, other smoking habits, body mass index and BP. After adjustment for estab- lished risk factors for PAD--age, sex, diabetes and pack-year history of smoking--multiple logistic regres- sion including 21 variables identified the following 3 independent factors as being associated with an in- creased risk of PAD: systolic BP (OR = 8.1 (95% CI, 5.2-13.0), (P < 0.0001)); history of hypertension (OR = 2.4 (95% CI 1.5-3.2), (P = 0.003)) and apolipo- protein B (OR = 3.8 (95% CI 2.3-7.6), (P = 0.008)). 5. Discussion Smoking has been established consistently as the major risk factor for PAD [I-4]. Therefore by recruit- ing only smokers, differences in the details of the smoking habit between cases and controls, and a clearer picture of the other risk factors for the develop- ment of PAD in smokers were established. The smok- ing habits of both cases and controls (number of cigarettes currently smoked) was similar to that re- ported for age-sex matched groups in the general population [13]. The results of this hospital based case- control study indicate that whilst an increased total exposure to tobacco products (pack year history) and nicotine absorption were associated with a significant increase in the risk of developing symptomatic PAD, there was no indication that smoking lower tar yield cigarettes decreased the likelihood of developing symp- tomatic PAD. Although all cases with PAD were newly referred, the developing problem may have been evident for a considerable time prior to consultation with a specialist. Hence the disease could have prompted a recent switch to a lower tar brand cigarette, on the assumption that this was a safer form of smoking. Indeed, inspection of the cigarette brand smoked 5 years previously indicates that there had been slightly more switching to lower tar brand cigarettes among the cases. However, even 5 years prior to presentation when most cases did not suffer PAD symptoms, cases reported smoking cigarette
Page 107: 2063633592 Log in for more options!
i | of ,tal tnd ]I ~] .tnt ed, ]l _--. H I" a iSto tes _il • tte H J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 47 brands which had lower tar and nicotine content than controls (Table 2). It remains possible that cases were more prone to recall bias, since it has long been recog- nised that patients with smoking related disorders may be deceptive about their current smoking habit [19,21]. However, recent recall bias was similar in cases and controls, with objective smoking markers identifying similar proportions of covert smokers in both cases and controls who claimed not to have smoked in the 24 h prior to interview. Therefore the clear trends for cases to have increased levels of all three smoking markers (Table 2) is indicative that cases may have smoked their cigarettes differently, perhaps dragging the cigarette down to the butt to maximise the nicotine yield. The risk of PAD was more strongly associated with plasma cotinine concentration than with carboxyhaemoglobin or thiocyanate concentrations, which reflect the metabolism of two gaseous products of tobacco com- bustion, carbon monoxide and hydrogen cyanide, re- spectively. This may indicate that nicotine, the precursor of cotinine, is associated more closely with vascular injury than carbon monoxide and hydrogen cyanide and that smoking a cigarette to maximise nicotine yield is a particularly dangerous habit. The information collected on cardiovascular risk fac- tors other than smoking was less complete than much of the smoking data (Table 3). Nevertheless there were clear indications that, as for coronary heart disease, hypertension and hyperlipidaemia are important risk factors for the development of PAD in smokers. After adjustment for age, sex, diabetes, and pack years of smoking, the 3 principal co-factors of smoking involved in the development of PAD were increased systolic BP, history of hypertension and increased concentrations of apolipoprotein B. The 7-8 fold increase in odds ratio for those with systolic blood pressures > 160 mmHg is in keeping with prospective studies which indicate that systolic is a better predictor of future cardiovascular events than diastolic pressure [22]. The significance of systolic BP and a history of hypertension as indepen- dent risk factors was re-emphasised in the stepwise logistic regression analysis of the 413 smokers with a completed data set for all variables. The aetiological relationship between lipid profiles and PAD has been likened to that between lipid profiles and coronary heart disease [23], which is consistent with the observa- tion that over one half of PAD patients die from coronary heart disease [24-26]. A significant associa- tion between serum triglycerides and PAD has been observed in many studies, but this association has rarely been found to be independent [27,28]. The results of the logistic regression analysis in this study which identified apolipoprotein B, rather than chol,esterol, as an independent risk factor for the development of PAD are compatible with apolipoprotein B acting as a marker of both cholesterol-rich and triglyceride-rich lipoproteins. The failure of fibrinogen to emerge as an independent risk factor in the logistic regression analy- sis may reflect the fact that smoking is a major determi- nant of plasma fibrinogen concentrations; both cases and controls were smokers and data was adjusted for pack-years. This study, which recruited both cases and controls from hospital patients, cotfld be subject to criticism. The presence of controls in hospital could hage been determined in part by the effects of smoking and hence the controls could have over-represented those with smoking-related illness. The controls' diagnoses were selected to avoid this problem. In addition, since the cases were referred to hospital for evaluation and diag- nosis of their PAD, the results may not be applicable to the general population. However, the major irripact on quality of life and health service resources associated with PAD is confined largely to those cases severe enough to be referred to hospital. 6. Conclusion These data do not support the hypothesis that those smoking low tar cigarettes are less likely to suffer PAD. Rather our evidence indicates that patients with PAD know how to smoke their cigarettes in such a manner as to maximise the nicotine yield. This smoking tech- nique appears to be a major determinant of developing PAD among smokers. However, it also seems likely that control of hypertension and optimal lipid profiles are likely to effect an important reduction in the mor- bidity attributable to PAD in the community. Acknowledgements This work was supported by research grants from the Tobacco Products Research Trust and the British Heart Foundation. We thank past research assistants on this project for their contribution. These include I. Corrie, C. Harris and M. Beksinska. We also thank all those consultants who gave permission for us to study their patients. 2063633592 References [1] Juergens JL, Barker NW, Hines EA. Arteriosclerosis obliterans: review of 520 cases with special reference to pathogenic and prognostic factors. Circulation 1960;21:188-195. [2] Lord JW. Cigarette smoking and atherosclerosis occlusive dis- ease. JAMA 1965;191:249-251. [3] Hughson WG, Mann Jl, Garrod A. Intermittent claudica- tion.:prevalence and risk factors. BMJ 1978;1:1379-1381. [4] Fowkes FGR. Epidemiology of atherosclerotic arterial disease in the lower limbs. Eur J Vasc Surg 1988;2:283-291.
Page 108: 2063633593 Log in for more options!
48 J.T. Powell et al. / Atherosclerosis 129 (1997) 41-48 [5] Behague I, Poirir O, Nicaud Vet al./~ Fibrinogen gene polymor- phisms are associated with plasma fibrinogen and coronary artery disease in patients with myocardial infarction. Circulation 1996:93:440-449. [6] Margetts BM, Jackson AA. Interactions between people's diet and their smoking habits: the dietar~ and nutritional survey of British adults. Br Med J 1993;307:1381-1384. [7] Surgeon General. The health consequences of smoking. The changing cigarette. Rockville, Maryland, USA: US Department of Health and Human Services, 1989. [8] International Agency for Research on Cancer. Tobacco smok- ing. IARC Monograph Evaluating Carcinogen Risk to Humans, 1985 pp. 37-421. [9] Kaufman DW, Helmrich SP, Rosenberg L, Miettenen OS, Shapiro S. Nicotine and carbon monoxide content of cigarette smoke and the risk of myocardial infarction in young men. New Engl J Med 1983;308:409-413. • [10] Pettiti DB, Friedman GD. Cardiovascular and other diseases in smokers of low yield cigarettes. J Chron Dis 1985;48:581-588. [I 1] Palmer JR, Rosenberg L, Shapiro S. Low yield cigarettes and the risk of nonfatal myocardial infarction in women. New Engl J Med 1989;320:1569-1573. [12] Negri E, Franzosi MG, La Vecchia C, Santoro L, Nobili A, Tognoni G. Tar yield of cigarettes and risk of acute myocardial infarction. Br Med J 1993;306:1567-1570. [13] Colhoun H, Prescott-Clarke P, Dong W, Hedges B, Lampe F, Taylor A. In: Colhoun H and Prescott-Clarke P (eds). Health Survey for England 1994. London: HMSO, 1996. [14] Rose GA, Blackburn H. Cardiovascular survey methods. World Health Organization (Geneva) Monograph series No. 56: 1968. [15] European working group on critical leg ischaemia. Second Eu- ropean Consensus document on chronic critical leg ischaemia. Circulation 1991;84(Suppl IV):1-26. [16] Yarnell JWG, Felicity AM, Milbank JE, Swectman PM, Walker CL. A short dietary questionnaire for use in an epidemiologieal survey: comparison with weighed dietary records. Hum Nutr Appl Nutr 1983;37A:103-112. [17] Butts WC, Kuehmenan M, Widdowson GM. Automated method for determining serum thiocyanate to distinguish smok- ers from non-smokers. Clin Chem 1974;20:1344-1348. [18] Feyerabend C, Russell MAH. Rapid gas-liquid chromatographic determination of cotinine in biological fluids. Analyst 1980; 105:998-1001. [19] Wiseman S, Kenchington G, Dain R et al. Influence of smoking and plasma factors on patency of femoropopliteal vein grafts. Br Med J 1989;299:643-646. [20] SPSS Incorporated. SPSS Reference Guide. Chicago: SPSS lnc, 1990. [21] Sillet R, Wilson MB, Malcolm RE, Ball KP. Deception among smokers. Br Med J 1978;65:197-200. [22] Rutan GH, Kuller LH, Neaton JD, Wentworth DH, McDonald RH, McFate Smith W. Mortality associated with diastolic hy- pertension and isolated systolic hypertension among men screened for the Multiple Risk Factor Intervention Trial. Circu- lation t988;77:504-514. [23] Leng GC and Fowkes FGR. Lipids: Epidemiology: In Fowkes FGRE (ed). Epidemiology of Peripheral Vascular Disease. Lon- don: Springe~r-Verlag, 1991. [24] Jelnes R, Gaardsting O, Hougaard Jensen K, Baekgaard N, Tonnesen KH, Schroeder T. Fate in intermittent claudication: outcome and risk factors. BMJ 1986;293:1137-1139. [25] Davey-Smith G, Shipley M, Rose G. Intermittent claudication, heart disease risk factors and mortality: the Whitehall Study. Circulation 1990;82:1925--'1931. [26] Criqui MH, Langer RD, Fronek Aet al. Mortality over a period of 10 years in patients with peripheral arterial disease. New Engl J Med 1992;326:381-386. [27] Fowkes FGR, Housley E, Riemersma RA et al. Smoking, lipids, glucose intolerance and blood pressure as risk factors for periph- eral atherosclerosis compared with isehaemic heart disease in the Edinburgh Artery Study. Am J Epidemiol 1992;135:331-340. [28] Greenhalgh RM, Lewis B, Rosengarten DS, Mevart I, Calnan JS, Martin P. Serum lipids and lipoproteins in peripheral vascu- lar disease. Lancet 1971;ii:947-950. ! ! l [
Page 109: 2063633594 Log in for more options!
---
Page 110: 2063633595 Log in for more options!
DR. C.R.E. COGGINS Pergamon 0191.8869(95)00123-9 Pdnted in Great Bdtain. All fights reserved 0191-8869/95 $9.50 + 0.00 SELF-REGULATION AND MORTALITY FROM CANCER, CORONARY HEART DISEASE, AND OTHER CAUSES: A PROSPECTIVE STUDY R. Grossarth-MaticekI and H. J. Eysenck2 1University for Peace, United Nations and 2Department of Psychology, Institute of Psychiatry, University of London, De Crespigny Park, Denmark Hill, London SE5 8A5, England (Received 3 July 1995) SummaryDThis article introduces a new personality inventory dealing with self-regulation. This is in some ways the opposite of neuroticism, and measures personal autonomy or independence, particularly as far as emotional dependence is concerned. Our concern was the relation between self-regulation and health, and large samples of healthy men and women were tested and followed up to demonstrate high predictability of mortality from cancer, coronary heart disease and other causes of death from scores on the questionnaire. It was also demonstrated that psychological risk factors were largely independent from physical risk factors, and could bc changed by behavioural--cognitive treatment, reducing mortality. INTRODUCTION The ancients had a motto for happiness: Mens sana in corpore sano. They believed, following Hippocrates, that the sound mind was related to the sound body, and that there were cancer-prone personalities predisposed to develop this disease more readily, and die of it more quickly, than others not so prone (Mettler & Mettler, 1947; Kowal, 1955; Greer, 1983; Rosch, 1979, 1980). In recent years, many studies have given support to the idea of a cancer-prone personality (Eysenck, 1991, 1994a; Temoshok & Dreher, 1992), as well as a coronary heart disease-prone personality (Friedman, 1991; .~ohnson, 1990; Turner, Sherwood & Light, 1992). The latter is often referred to as Type A, contrasted with the healthy Type B (Eysenck, 1990); the cancer-prone type is sometimes referred to as Type C. Disease-prone types share certain similarities, but can be differentiated successfully both experimentally (Kneier & Temoshok, 1984) and by interview/questionnaire (Eysenck, 1988). While most interest has been directed towards Types A and C, there has also been some interest in the study of the healthy type of person, Type B (Friedman & Rosenman, 1974) or Type 4 (Grossarth-Maticek, Eysenck & Vetter, 1988). This may be defined negatively in terms of the absence of traits characteristic of cancer-prone and CHD-prone personalities, or positively in terms of active health-promoting traits. The difference is of course of little practical importance; a given trait may be formulated positively, or negatively, and scored in the health-giving or disease-prone direction. Table 1 shows some of the concepts related to the disease-prone and the healthy personality (Friedman & Booth-Kewley, 1987), respectively. Obviously these varied conceptions have a great deal in common, and the present study reports an attempt to bring this consensus to a focus, and demonstrate its relevance to actual physical health. What seemed to us to be the defining feature of the healthy personality was autonomy, emotional independence, and self-regulation, i.e. the ability to actively regulate one' s own life, without a degree of emotional dependence on other people that acted in such a way as to thwart one's needs and aims. The concept of 'locus of control' has some similarity to self-regulation, but is rather narrower in its meaning. Both are clearly related to low neuroticism (Eysenck, 1994a). The term 'self-regulation' has been used in the past with similar but somewhat differing meaning (Schwartz, 1983; Leventhal, Nerenz & Strauss, 1980; Carver & Scheier, 1982) as an aspect of control theory. These authors review self-regulation in terms of coping with symptoms or medical treatments 781
Page 111: 2063633596 Log in for more options!
Self-regulation and mortality Table 2. Personality and other correlate~ of the six Grossarth-Maticek types (Schmitz. 1992. 1993) Types 1 2 3 4 5 6 N +++ +++ ++ + +++ E .... ++ - + P ~ + =, -- _-- ++ L = = -, = + - Autonomic anxiety + + + =* - + := Cognitive anxiety + + + + + - - + + + State anxiety + + + + -- - - + + Dogmatism + + + + + + + - - + + + Alienation + + + + + +'+ - + + + Can't describe feelings + + + + + + ,,~ - - = + Can't communicate feelings + + + + + - + + + Alexithymia + + = = - + = Task-oriented ,= - = + + + - Emotion-oriented + + + + + + + + - - = + + Coping Avoidance-oriented + + + + + = = = Distraction + + + + + + = = = Social diversion = = + = = = Psychosomatic complaints Physical exhaustion + + + + 4- - - + + Insom~tia + + + - - + + + + + Cardiovascular problems + + + + + - + + + + Depressive tendencies + + + + + + + -- - + + + + + Impulsiveness + + + + + + - - = + + + Abuse of drugs Psychopath. +. + + = - = + Alcohol + + + + = - + + + + + Drugs + + + + ffi -- -- = + Smoking + + + - -- = + + 783 interviewer-administration involving the establishment of trust, and the explanation of obscure or complex questions, has the greatest validity. The second problem is that response may depend on the circumstances leading to the establishment of a given sample; a sample consisting of people coming for psychotherapy is more likely to give truthful answers than a random sample uncertain about the relevance of the questions asked. These problems are closely linked to the hypothesis that a major aspect of the cancer-prone personality, for instance, is the suppression of feelings and emotional responses; such denial may lead to differential responding in different conditions of test Table 3. Personality of other correlates of the six Grossarth-Maticek types (Sandin et al., 1993a, b) Types 1 2 3 4 5 6 Immunological, Cardiovascular ' Respiratory Gastrointestinal Neurology: sensorial Skin Musculoskeletal Genito-urinary N p Alexithymia Coping Task-oriented Emotion-oriented Avoidance-oriented Social support Anger-state Anger-strait Angevin Anger-out Anger-control AnSer.~-x
Page 112: 2063633597 Log in for more options!
~ett-regulat~on ant1 mortality Table 2, Personality and other correlates of the six Orossarth-Maticek types (Schmitz, 1992, 1993) Types ! 2 3 4 5 6 N +++ +++ ++ + +++ E .... ++ - + p = + = - __ ++ I. = -- =, = 4- - Autonomic anxiety + + + Cognitive anxiety + + + + + + + + State anxiety + + + + = - - + + Dogmatism + + + + + + + - - + + + Alienation + + + + + + + - + + + Can't describe feelings + + + + + + .... + Can't communicate feelings + + + + + - + + + Alexithymia + + = Task-oriented ffi - ffi + + + - Emotion-oriented + + + + + + + + - - = + + Coping Avoidance-oriented + + + + + Distraction + + + + + + -- Social diversion = = + = = Psychosomatic complaints Physical exhaustion + + + + ÷ - - + + Insomnia + + + - - + + + + + Cardiovascular problems + + + + + - + + + + Depressive tendencies + + + + + + + - - + + + + + Impulsiveness + + + + + + - - = + + + Abuse of drugs Psychopath. + + + = - = + Alcohol + + + + ffi - + + + + + Drugs + + + + .... + Smoking + + + - - = + + 783 interviewer-administration involving the establishment of trust, and the explanation of obscure or complex questions, has the greatest validity. The second problem is that response may depend on the circumstances leading to the establishment of a given sample; a sample consisting of people coming for psychotherapy is more likely to give truthful answers than a random sample uncertain about the relevance of the questions asked. These problems are closely linked to the hypothesis that a major aspect of the cancer-prone personality, for instance, is the suppression of feelings and emotional responses; such denial may lead to differential responding in different conditions of test Table 3. Personality of other correlates of the six Grossarth-Maticek types (Sandin et al., 1993a, b) Types 1 2 3 4 5 6 Immunological + + + - = + Cardiovascular + + + + + - = + Respiratory + + + + =~ - = + Gastrointestinal + + + + - = + Neurology: sensorial + + + + + + + - - + + Skin + + + + = = + Musculoskeletal . + + + + + + - = + . Genito-urinary + + + + - = + N ++ ++ ++ - = + E .... 4- = = p = ++ - ffi = + Alexithymia + + ..... Coping Task-oriented - - - + + = ffi Emotion-oriented + + + - = + + Avoidance-oriented + + + + - = + Social support - - ffi + + ffi = STAXI Anger-state = + =, m = + Anger-strait + + + + + -' = + + Anger-in + + + + + + = + + Anger-out =, + + + + = = + + Anger-control = - - + = -- Anger..ex + + + + + + = ffi +
Page 113: 2063633598 Log in for more options!
1~. ~JrossarLil-~la~lcoK an~ t~. J. l~ysencK administration. Intelligence, too, may play a part; complex questions embodying complicated theories may not be easily understood by persons with below-average IQs. If we may take the results of the studies summarized in Tables 2 and 3 as suggesting the nature of the 'healthy' (Type 4) and 'unhealthy' (Types I and 2) personality, we see that the 'healthy personality' is low in psychopathology (neuroticism and psychoticism), extraverted, task-oriented rather than emotion-oriented, and controlled in his anger. We may compare these characteristics with those noted in an early but still valuable study that played a pioneering role in this field (Hinkle & Wolff, 1957). They studied three rather homogeneous groups, composed of over 4000 men and women, looking at their history of major and minor illnesses, as well as their circumstances, personalities, and stresses and stress reactions. Their first finding was that the distribution of illnesses was not Gaussian, but negative binomial, a sort of distribution that occurs in groups when the members of the group have different 'risks' of becoming ill. In other words, people differ in their predisposition to become ill. In addition, those so predisposed showed an increased susceptibility to illness in general; they developed many different types of minor or major illness, not just one or two. (Number of major illnesses correlated 0.40 with number of minor illnesses.) There was a clear correlation between number of illnesses and stress experienced, in terms of objective events like divorces, separations, conflicts with family members, uncongenial living and working arrangements, etc. Further, clusters of illness often occurred during periods of significant stress. Constitutional differences predisposing to disease have not been found to differentiate the 'healthy' from the 'diseased'. The subjectivity of the 'stresses' involved becomes apparent in the conclusion drawn by the authors "that illness often occurs when a person perceives his life situation as peculiarly threatening to him, even though this life situation may not appear to be threatening to an outside observer, and that people who maintain good health in a setting of what are 'objectively' difficult life situations do not usually perceive these situations as difficult." The study closely targeted psychological factors similar to those found in Tables 2 and 3 as related to illness predisposition. "Those people who had the greater number of bodily illnesses, regardless of their nature and regardless of their etiology, were the ones who experienced the greater number of disturbances of mood, thought, and behaviour. For example, not uncommonly, persons were seen with recurrent episodes of anxiety, depression, chronic obsessive and compulsive symptoms, or character disturbances; symptoms of this type, with exacerbations and remissions, might predominate in their illness pattern throughout life. But such people, as a group, also had more bodily illnesses of all types than were found among those who had few or no disturbances of mood, thought, or behaviour. This can be put in other terms by saying that ... there was a parallelism between the occurrence of psychoneuroses and psychoses and the occurrence of bodily illness." (p. 446; italics not in original). 2063633598 THE SELF-REGULATION INVENTORY(SRI) To investigate the hypothetical relationship between personality and illness, a self-regulation inventory wasconstructed using questions based on those that had in past research proved useful in predicting good health or poor health respectively, reversing the scoring for the latter so that a high score indicated good health, a low score poor health. Likert-scale scoring on a six-point scale was used. Scores can vary between 105 and 630. The Cronbach ~ reliability for various groups centred on 0.80. For purposes of presentation scores were grouped into six groups, from 1 (low self-regulation) to 6 (high self-regulation). The six steps are coded in multiples of 105. Thus a score of 1 is obtained when the total point score is between 105 and 209; a score of 2 is obtained when the total point score is between 210 and 314, etc. The number of men and women with each score is given in Table 4. A detailed statistical analysis of the questionnaire will be given in a later publication; here we shall be concerned with the validity of the questionnaire as regards predictive accuracy of mortality. Ss were tested by trained interviewers in 1973, and mortality established in 1988; thus the study reports a 15-year follow-up. Data were collected by 116 trained students in all. Ss were randomly selected on the basis of lists of inhabitants in Heidelberg, Germany, at the time. (Copies of the questionnaire can be obtained from H. J. Eysenck.) Table 4 shows the degree of self-regulation for the men and women who took part in the study.
Page 114: 2063633599 Log in for more options!
Selt~regulauon an~l ~0rtality Tabl~ 4. Degre~ of self-regulation and mortality in women and men Group 1 2 3 4 5 6 Total Women 150 316 535 912 502 193 2608 5.7% 12.1% 20.5% 34.9% 19.2% 7.4% Men 154 509 1221 813 308 I03 3108 4.9% 16.3% 39.2% 26.1% 9.9% 3.3% Total 304 825 1756 1725 810 296 5716 5.3% 14.4% 30.7% 30.1% 30.1% 5.1% 785 Table 5. Degree of self-regulation and mortality in women Group Score Score Score Score Score Score 1 2 3 4 5 6 150 316 535 912 502 193 N 5.7% 12.1% 20.5% 34.9% 19.2% 7.4% Cancer 25 43 58 35 15 4 16.6% 13.6% 10.9% 3.8% 2.9% 2.0% CHD 45 60 96 51 14 5 30.0% 18.9% 17.9% 5.5% 2.7% 2.5% Other causes 52 79 147 130 37 7 of death 34.6% 25.0% 27.4% 14.2% 7.3% 3.6% Still alive 28 134 234 696 436 177 18.6% 42.4% 43.7% 76.3% 86.8% 91.7% Total 122 182 301 216 66 18 mortality 8 ! .3% 57.5% 56.2% 23.6% 13.1% 8.2% Average age (1973) 55.7 56.1 57.8 58.3 56.9 58.8 Table 6. Degree of self-regulation and mortality in men Group Score Score Score Score Score Score I 2 3 4 5 6 154 509 1221 813 308 103 N 4.9% 16.3% 39.2% 26.1% " 9.9% 3.3% Cancer 22 63 126 29 8 2 14.2% 12.3% 10.3% 3.5% 2.5% 1.9% 49 121 251 48 10 2 31.15% 23.7% 20.5% 5.9% 3.5% 1.9% 51 128 349 92 15 5 33.1% 25.1% 28.5% 11.3% 4.8% 4.8% 32 197 495 644 275 94 20.7% 38.7% 40.5% 79.2% 89.3% 91.2% 122 312 726 169 33 9 79.2% 61.2% 59.4% 20.7% 10.7% 8.7% CHD O~her causes of death Still alive Total mortality Average age (1973) 57.8 56.5 55.9 57.2 58.9 58.4 It is clear that women are significantly higher on the S-R scale (P < 0.001 by Mann-Whitney U-test). This agrees well with the universal tendency of women to live longer than men. Tables 5 and 6 show, separately for women (Table 5) and men (Table 6) the interaction between degree of self-regulation and mortality from Cancer, CHD, and other causes of death. Also given are number still living and total mortality, g2 values were calculated for total mortality vs still living, cancer vs still living, CHD vs still living, and other causes of death vs still living; all were significant at P < 0001 for the sexes separately. Also given are the average ages of the S-R groups. (Ages ranged from 45 to 68 yr in 1973.) Thus for all causes of death (cancer, CHD, other) there is a very significant correlation between S-R and mortality. Figures 1 and 2 show the results diagramatically. Table 7 shows the relationship between S-R scores and a number of risk factors in a small group of 571 persons where more detailed investigation was possible. Clearly those low on self-regulation have higher blood pressure, suffer more from diabetes, are more overweight and lacking in exercise,
Page 115: 2063633600 Log in for more options!
786 R. Grossarth-Maticek and H. J. Eysenck Prospective 1973 - 1988 study: females (N -- 2608) 35 - • Cancer " / / 30- . CHD 25- " Other o 20 -- o 15 -- / / 5 4 3 2 1 High Self regulation Low Fig. 1. Mo~lity and de~ee of self-~gulafion; 2608 women. smoke more, drink more, have more accidents, have a poorer diet, are more often ill, spend more time in hospital, and report more symptoms leading to medical treatment. All these are at high levels of significance, with P < 0.001. Table 8 lists smokers in relation to self-regulation for men only. There are two groups, those still alive, and those who had died. (There were too few women smokers in 1973 to make results meaningful.) Among the former, smoking is positively related to higher degrees in self-regulation. In those who died, smoking was more frequent in those with low self-regulation, and they smoked Pros ~ective 1973 - 1988 study: males (N = 3108) 35 30 "" 25 o 20 O 0 6 High 5 4 .3 2 I Self regulation Low 0 O~ o~ O~ O O • . Fig. 2. Mortality and degree of self-regulation; 3108 men.
Page 116: 2063633601 Log in for more options!
S~lf-regulation and mortality 787 Table 7. Self-regulation as related to various physical risk factors Type Type Type T);pe Type Type 1 2 3 4 5 6 304 825 175 172 810 296 Blood pressure 168/93 155/90 144/86 135/75 123/71 121/70 Diabetes 39 68 69 11 2 1 12.6% 8.2% 3.9% 0.6% 0.2% 0.3% Overweight 183 478 80 I" 159 40 13 60.0% 57.9% 45.6% 9.2% 4.9% 4.3% Lack of exercise 194 536 961 201 62 10 63.8% 64.9% 54.7% 11.6% 7.6% 3.3% Number of cigarettes smoked per day Alcohol consumed daily (g) Number of accidents per year treated individ. (1970-1973) Poor nutrition Days ill per year (1970-1973) Days in hospital per year (1970-1973) Needing medicare care over 1 yr Number of symptoms leading to medical treatment (1970-1973) 40.2 35.1 30.6 15.1 11.2 7.7 83.6 80.2 64.9 19.8 I 1.6 I0 84 155 167 90 I0 I 27.5% 18.7% 9.5% 5.2% 1.2% 0.3% 265 557 718 401 89 19 87.1% 67.5% 40.9% 23.2% I0.9% 6.4% 64.7 57.2 31.5 16 18 15 22.8 20.6 10.6 4.3 2.5 1.1 71 125 216 99 36 8 23.3% 15.1% 12.3% 5.7% 4.4% 2.7% 14.3 12.8 11.4 4.7 2.3 1.2 more per day. These results for the relation between smoking and self-regulation may at first seem contradictory, but both are highly significant by X2 (P < 0.001). The results are in good agreement with previous studies (e.g. Friedman, Firman, Petitti, Siegelaub, Ury & Klatsky, 1983; Howard, Curmingham & Rechnitzer, 1985) which demonstrated that personality acts as a moderator of the effects of cigarette smoking on coronary risk, in the sense that smoking was having deleterious effects on heal.th only for people with CHD-prone personality, but not on those with psychologically healthy personalities. Eysenck (1994b) has shown that this effect occurs equally for cancer, and the results in Table 8 are clearly in line with this general rule. Data for alcohol consumption are given in Table 9. Among those alive in 1988, the relation between drinking and degree of self-regulation is reasonably linear, with low S-R scorers drinking less than Table 8. Self-regulation ahd smoking--in live and dead pmbands Type Type Type Type Type Type I 2 3 4 5 6 Total 154 509 1221 813 308 103 3108 Group 1" 32 197 495 644. 275 94 1737 55.9% 9 57 164 303 108 49 690 28.1% 28.9% 33.1% 47.0% 39.3% 52.1% 39.7% 15.3 15.6 14.7 24.6 21.7 22.0 122 312 726 169 33 8 1370 44.1% N Still alive Smokers (n;%) Cigarettes per day Total mortality No longer living Smokers (n;%) Cigarettes per day Total smokers Group 122 312 726 169 33 8 91 224 415 89 7 1 74.5% 71.7% 57.1% 40.8% 21.2% 12.5% 26.9% 25.6% 24.3% 23.9% 21.3% 21.3% 100 281 579 372 115 50 64.9% 55.2% 47.4% 45.7% 37.3% 48.5% *~. (linear) ffi 20.63, d.f. = I, P = 0.0000. ~'~ (linear) = 70.59, d.f. = I, P ffi 0.0000. 1370 44.1% 807 59.0% 1497 48.2;c 0
Page 117: 2063633602 Log in for more options!
788 R. Grossarth-Maticck and H. J. Eysenck Table 9. Self-regulation and drinking---in live and dead probands Type Type Type Type Type Type 1 2 3 4 5 6 Total N 154 509 1221 813 308 • 103 3108 Group !* Still alive32 197 495 644 275 94 1737 55.9% Alcohol consumed (n;%) 4 48 51 353 210 50 718 12.5% 24.3% 10.3% 54.8% 76.3% 53.1% 23.1% Daily intake (g) 21.6 23.6 39.8 48.7 42.6 44.6 Group llt No longer living 122 312 726 169 33 8.0 1370 44.1% Alcohol consumed (n;%) 85 197 617 17 6 + I 923 69.6% 63.1% 84.9% 10.0% 18.1% 12.5% 67.3% Daily intake (g) 75.8 79.4 69.6 28.3 24.2 25.3 Total alcohol consumed (n;%) 89 245 668 370 216 51 1639 57.7% 48.1% 54.7% 45.5% 70.1% 49.5% 52.7% 0 O~ O~ C.O 0 *.~ (Iinear)= 216.44, d.f. = 1, P = 0.0000. ~.Ztk-~ = 160.29, d.f. = 1, P = 0.0000. high scorers. For those who died, low S-R scores clearly drank more than high S-R scorers. We again see a paradox, and again this finds an explanation in previous research that showed clearly that the effects of alcohol are dependent on personality factors; Grossarth-Maticek & Eysenck (1991 a) found that alcohol consumption had a negative valence for health if drunk to drown one's sorrows, but not if drunk for pleasure, celebration, etc. This is an interesting feature common to smoking and drinking, showing that leaving out of account psychological factors may lead to serious misinterpretations of epidemiological data concerning the effects of cigarette and alcohol consumption. (The X2 results for our conclusions show P < 0.001 levels.) SELF-REGULATION AND GROSSARTH-MATICEK TYPOLOGY It is of interest to see to what extent the Grossarth-Maticek Typology (Grossarth-Maticek & Eysenck, 1990), with its six types, interacts with the self-regulation typology. It has often been objected that the Grossarth-Maticek methodology of assigning a person to one or other of the six types is faulty because: (1) it uses only a small portion of the available data, (2) it does not correct scores on one type by drawing on information regarding another type. Thus a Type 1 person with a high score on Type 4 might be expected to do better health-wise than a Type 1 person with a low Type 4 score. Profile scoring might be a better method of analysis ~han simply assigning a person to a given type just because he happened to score highest for that type, but from the beginning Grossarth-Maticek has used the simple typology concept, rather like Friedman and Rosenman used the Type A concept because to a medical audience this method of analysis might seem more natural and easier to follow. The fact that this simple typological approach has been very successful (Eysenck, 1991) does not mean that better methods should not be tried; it might be hoped that their use would improve predictive accuracy. A sub-group of 3240 men and women was selected on a random basis and administered the Personality Stress Inventory (Grossarth-Maticek & Eysenck, 1990), in order to cross-validate the two inventories. Table 10 shows the major findings. Results are given separately for bad and for good self-regulation (scores of 1, 2 or 3 vs 4, 5 or 6), subdivided by subjects according to Type (1, 2, 3, 4, 5 or 6). For each of the 12 sub-divisions (2 × 6) are given the number and percentage of deaths from cancer, CHD (infarct) and other causes. Clearly SR is vitally important, as the percentage of mortality figures for the High and low S-R scores show. This of course merely mirrors the data in Figs 1 and 2. Within the low S-R group, clearly Type 1 has the highest cancer mortality, Type 4 the least, while for Type 2 CHD has the highest mortality, with all the other types roughly on a par. For
Page 118: 2063633603 Log in for more options!
Self-regulation and mortality Table 10. Degree of stir-regulation and six Grossarth-Maticek types as related to mortality Type Type Type Type Type Type 1 2 3 4 5 6 Total N 392 Cancer 117 29.8% Infarct 51 13.0% Other causes of death 101 25.7% Average age (yr) 57.6 Mean S-R score 2.4 N 26O Cancer 4 1.5% lnfaret 4 1.5% Other causes of death 21 8.0% Average age (yr) 56.2 Mean S-R score 3.8 N 652 Cancer 121 18.5% Infarct 55 8%4% Other causes 122 of death 18.7% Poor Self-regulation (1, 2 or 3 points) 403 102 52 507 64 1520 50 17 10 81 12 287 12.4% 16.6% 19.2% 15.9% 18.7% 18.8% 119 19 10 69 10 278 29.5% 18.6% 19.2% 13.6% 15.8% 18.3% 99 24 13 105 17 359 24.5% 23.5% 25.0% 20.7% 26.5% 23.6% 57.4 57.3 58.2 58.4 58.1 2.3 2.5 3.0 2.1 2.4 Good Self-regulatlon (4, 5 or 6 points) 204 351 477 358 70 1720 4 3 2 3 + I 17 1.9% 0.8% 0.4% 0.8% 1.4% 1.0% 5 7 2 2 1 21 2.4% 1.9% 0.4% 0.5% 1.4% 1,2% 27 29 34 38 15 164 13.2% 8.2% 7.2% 10.6% 21.4% 9.5% 56.9 57.1 56.2 56.4 55.7 3.9 4.1 4.7 3.8 3.9 Total Degree of Self-regulation 607 453 529 865 134 3240 54 20 12 84 13 304 8.9% 4.4% 2.2% 9.7% 9.7% 9.4% 204 26 12 71 11 379 33.6% 5.7% 2.3% 8.2% 8.2% 11.7% 126 53 47 143 32 523 20.8% 11.7% 8.9% 16.5% 23.9% 16.1% 789 'Other causes', there is little to choose between Types. For the good S-R scores, Type 4 does best overall, but the other Types have mortality too low to produce marked differences. It is interesting to look at the ratios of good/bad SRI scores for each of the typologies. Going from 1 to 6, these are: 0.66; 0.51; 3.34; 9.17; 0.71; 1.09. Not unexpectedly, the 'healthy' Type 4 has much the highest ratio, followed by the fairly healthy Type 3; while the cancer-prone and CHD-prone Types 1 and 2 have much the lowest. It is apparent that the SRI measures much the same traits as does the Grossarth-Maticek Typology Type 4. Analyses by generalized linear model shows the main effects (Typology and Self-regulation) as well as their interaction are all significant at the P < 0.001 level. One important consequence of these findings would seem to be that questionnaires using a positive wording are as useful, if not better, at indicating psychological disposition to good health, as questionnaires using a negative wording are in indicating psychological disposition to bad health. Most people are apparently more likely to respond truthfully to positive than to negative questions, although this point would have to be established by a specially designed experiment. Physical risk factors for disease To study the relationship of physical risk factors to mortality, a score was based on a specially designed questionnaire, based on known risk factors which could be obtained relatively easily. Table 11 gives the items involved and the points given for the various items. The scale has a minimum of 0 points (no positive factors, high risk), and a maximum of 24 points (many positive factors, low risk). The scale takes into account genetic factors, exercise, nutrition, alcohol, smoking and direct estimates of poor fitness---overweight, high blood pressure, high cholesterol, etc. Different numbers of points can be obtained for different items, thus blood pressure is more important than smoking or drinking. The various items were of course specified in considerable detail for the interviewers. Table 12 shows the relationship between physical risk factor scores and (a) mortality and (b) SRI Scores. There is clearly a close relation between physical risk factors and mortality; the greater the number of positive factors, the greater the chance of survival, and the lower the risk of mortality. Conversely,
Page 119: 2063633604 Log in for more options!
790 R. Grossarth-Maticek and H.. J. Eysenck Table I I. Point scale for physical risk factors Points 1. A close member of fl~e family (parents, grandparents) has reached an age of 75 yr. Add one point for each such family member. Points 0-6, respectively 0-6 2. Regular exercise 2 3. Dally activity in fresh air, irrespective of the weather 1 4. Healthy nourishment 2 5. Sufficient amount of fluid intake 1 6. Normal body weight 1 7. Little alcohol 1 8. Non-smoker I 9. Normal blood pressure 2 10. Normal blood sugar 2 l I. Normal total cholesterol 2 12. Low consumption of coffee, black tea and Coca-Cola® 1 13. No stimulant or depressant psychopharmaca. I 14. Normal sensitivity for pain (not overly sensitive) 1 the smaller the number of positive factors, the greater the risk of mortality. Those with the most positive factors, i.e. 24 points, show a survival rate seven times greater than those with a score of 0 points. For those who died, probands with a score of 0 died 15 times more frequently than those with a score of 24. The relationship is significant by Mann-Whitney U-test, with P<0.00001. SRI also independently predicted mortality, with P < 0.00001 by Mann-Whitney U-test. The regression of S-R on physical risk factors appears linear for the dead group but curvilinear for the living; only a replication can show whether this is an accidental finding, of no importance. But clearly the S-R scale measures causes of death largely independent of physical causes. It will be obvious from Table 12 that physical risk factors, as expected, correlate separately with mortality, r (bis) between total mortality and physical risk factors is 0.36, P< 0.001. Using a Kruskal-Wallis ANOVA by ranks for the relationship between S-R and mortality, we obtain H= 3520.83, which with d.f. = 2 gives P < 0.00001. Carrying out the same type of analysis for physical risk factors, H = 1118.26, which with d.f. = 2 gives P < 0.00001. There is little correlation Table 12. Mortality as related to physical risk factors and self-regulation Still living Mortality Positive physical S-R S-R factors n % (%) n % (%) 0 20 0.6 4.8 315 13.9 3.1 1 21 0.6 4.9 206 9.1 3.0 2 34 1.0 4.7 170 7.5 2.8 3 47 1.4 4.6 ~ 153 6.7 3.9 4 96 2.8 4.3 104 4.6 3.1 5 78 2.3 3.9 107 4.7 3.3 6 103 3.0 3.6 I01 4.4 3.3 7 124 3.6 3.7 162 7.1 3.4 8 113 3.3 3.5 103 4.5 3.5 9 272 7.9 3.8 102 4.4 3.3 10 271 7.9 3.6 100 4.4 3.4 11 294 8.5 3.7 84 3.7 3.4 12 231 6.7 3.8 75 3.3 3.3 13 186 5.4 3.6 62 2.7 3.5 14 144 4.2 3.9 51 2.2 3.6 15 169 4.9 3.7 45 1.9 3.4 16 124 3.6 3.6 37 1.6 3.3 17 116 3.4 3.8 40 1.6 3.1 18 127 3.7 3.9 35 1.5 2.9 19 131 3.8 3.4 49 2.2 2.7 20 155 4.5 3.9 51 2.2 2.5 21 163 4.7 4.0 42 1.8 2.6 22 143 4.2 4.1 31 1.4 2.1 23 136 4.0 4.5 28 1.2 2.3 24 144 4.1 4.9 21 0.9 2.4 Total 3422 2274 0 0
Page 120: 2063633605 Log in for more options!
Self-regulation and mortality Table 13. Self-regulation and genetic determinances in cancer of the breast (degl'˘˘ of self-regulation) Cancer of the breast Healthy and living Group N S-R N % S-.R N % S-R 0 544 3.6 1 0.2 3.1 316 58.1 4.6 I 349 3.5 9 2.5 3.0 205 58.7 4.7 2 138 3.6 9 6.5 2.9 64 46.4 4.9 3 54 3.9 14 25.9 3.1 21 38.9 5.0 1085 33 3.0 606 55.6 791 between S-R and physical risk factors, Spearman p = - 0.24, which is significant statistically, but only accounts for less than 5% of common variance. It is possible to pursue the search for physical risk factors a little further by looking more closely at genetic factors, implied by the first item in Table 11. This can be done by looking directly at parents and grandparents who died of the same disease as the proband. Of course this is only possible in large groups with high mortality, e.g. wo .men with breast cancer. Table 13 shows the results for four groups of women who died of cancer of the breast. One group had no first-degree relatives who also died of cancer of the breast, one group had one such relative, one group had two such relatives, and one group had three. There is a clear-cut regre~siort: cancer of the breast increases with an increase in the number of relatives who died of such cancer, but there is no change in S-R, which clearly does not correlate with the genetic predisposition. Kruskal-Wallis ANOVA by rank gives H = 58.5, d.f. = 2 and P < 0.00001 .for mortality and genetic predisposition. Breast cancer patients are clearly separated from healthy probands in respect to genetic predisposition. Looking at S-R by itself, this gives a P < 0.130001 for the comparison with still living probands. Clearly sufferers from cancer of the breast are strongly predisposed to develop this type of cancer by both genetic factors and 'by low self-regulation. The causal nexus--an intervention study Although clearly there are important correlations between S-R and mortality, correlations largely independent of and larger than those observed between mortality and physical risk factors, it would be dangerous to interpret these correlations as necessarily involving causalitymarguing from correlation to causality is only too frequently done in epistemiology, particularly in relation to smoking (Eysenck, 1991). However, the hypothesis of a causal nexus can be given greater plausibility by intervention studies, i.e. by demonstrating that changing degree of S-R can change the risk of mortality. Previous studies have shown that autonomy training can change mortality risk very markedly (Grossarth-Maticek & Eysenck, 1991; Eysenek & Grossarth-Maticek, 1991), and an attempt to apply these methods in connection with the present study seemed worth-while. The experimental and control groups used in this study are of course not included in the group that formed the samples discussed thus far. We chose 700 persons in 1974 who showed high physical risk factors (e.g. high blood pressure, high cholesterol, high cigarette and alcohol consumption, lack of exercise, etc.), as well as low degree of self-regulation (below 3, average 2.5 points). These 350 probands were divided into two groups on a chance basis, and one group was administered autonomy training, the other was left alone. The principles of autonomy training have been discussed elsewhere (Grossarth-Maticek & Eysenck, 1991a). Beginning with the use of individual and bibliographic therapy, we followed up with a course of group therapy, involving altogether about 30 hr per person. ili Six months after completion of the therapeutic intervention probands were again administered the SRI. (The first occasion of administration was one month before the beginning of therapy.) As a result of the changes from first to second administration, probands were divided into four groups. Group I ,- showed an improvement in SRI scores, but with an average score still below 3.5. Group II showed "~" a " " " ~: markedly better degree of improvement, with values well below 3.5 the first tame, but a score above ~ 3.5 the second tame. (On the basxs of the results shown m Figs I and 2, 3.5 seems to have been a good ~. choice for making this diagnosis.) ,-, t Group III includes those probands whose scores were worse on the second occasion, and ~roup
Page 121: 2063633606 Log in for more options!
792 R. Grossarth-Maticek and H. J. Eysenck IV showed a marked deterioration. Thus Group I showed an improvement of 2 points or less, and a final score below 3.5. Group II showed an improvement of 2-5 points, and a final score above 3.5. Group III showed a deterioration of 1 point or less, and Group IV one of more than 1 point. There was also a small Group V where there was no change. The average age of the treatment group was 54.6 yr, of the control group 54.8 yr, an insignificant difference. Mortality was ascertained in 1993, giving a follow-up period of 19 yr. Nine probands in each group could not be located on follow-up, thus reducing the total number analysed to 2 × 341 = 682. Table 14 shows the results. Results show the following major findings. (1) Regardless of therapy or control, mortality in the five groups is similar, being highest in Group IV, lowest in Group II (markedly worse and markedly better), with Group III and Group I showing intermediate degree of mortality. (The numbers in group 5 are too small to be very meaningful.) In other words, improvement in S-R, whether achieved spontaneously or as the result of autonomy training, is significantly related (negatively) to mortality; those who improved are less likely to die than those who got worse in degree of S-R. (2) Overall, the group with autonomy training shows a significantly reduced mortality compared with the control group as regards mortality from all causes, as well as a higher percentage of probands who are healthy and live without any chronic disease---61.7% compared with 37.6% in the therapy and control group, respectively. This effect is clearly due to the fact that markedly improved probands are nearly eight times as frequent in the therapy group as in the control group. In the other, groups the advantage of the proband who underwent therapy is small, although present even in those where S-R scores get worse. It is interesting to note the changes in physical function which accompany any changes in S-R (Table 15). Measures are reported for blood pressure, cholesterol (total), cigarettes per diem, alcohol g/day, bodyweight, lack of exercise, and unhealthy nutrition. In each case, thefirst measure was taken before beginning therapy, the second after one year, i.e. six months after the second measurement of S-R. The results show that in the group with improved S-R, all the physical risk factors improve, while in the group with worsening S-R scores there is also a worsening of all the physical variables. The conclusion suggested by these data must be that (1) improvement in S-R is a systematic process which results not only in improvement in the physical sphere. (2) When looking for an improvement in the physical risk factors it would be advisable to try and improve the psychological risk factors, through improvement in S-R. 206363~606 I SUMMARY AND CONCLUSIONS The results of this large-scale prospective study suggest that psychological factors incorporated in the concept of the healthy personality have a profound influence on disease and mortality. Mens sana in corpore sano was the health slogan of the ancients; ~ seems that this combination constitutes a strong correlation between body and mind, and that changes in the psychological sphere produce changes in the physical sphere also. That of course is the main assertion of psychosomatic theory, and this study adds to the large literature supporting it. Psychological risk factors exert a largely independent influence on mortality, and can be influenced, modulated and changed decisively by autonomy training, a kind of behaviour therapy stressing management technique. The personality of probands incorporates their sensitivity to stress, their coping behaviours, and their general outlook on life; self-regulation is in many ways the opposite to neuroticism, constituting a flexible autonomous, functional way of solving problems and getting over difficulties, while neuroticism is linked with inappropriate emotional responses, rigidity, and inability to cope with stress, leading to feelings of helplessness, hopelessness and finally depression. [In the case of cancer, we are dealing with a tendency to suppression of emotion and denial; hence for the cancer-prone person low neuroticism scores may be predictive of cancer (Kissen & Eysenck, 1962). This denial factor may cause confusion; thus Kreitler and Kreitler (1991) found health oriented people scoring low on negative emotions, like anxiety and fear, but high on neuroticism.] It would seem that preventive medicine should pay attention to psychological factors that have been shown to be vitally important to survival, as well as modifiable by autonomy training which, particularly when administered in the
Page 122: 2063633607 Log in for more options!
CI Table 14. The preventive effects of autonomy training on mm~lity Therapy group (with autonomy training) causes Alive, CHD of death Alive ill N N Ca Control group Other causes CHD of death Alive 5 10 10 44 12 6.1% 12.3% 12.3% 54.3% 14.8% 8 9 10 157 15 4.0% 4.5% 5.0% 78.8% 7.5% 3 7 11 6 8 8.5% 20.0% 31A% 17.1% 22.8% 3 5 9 1 1 15.7% 26.3% 47.3% 5.2% 5.2% 1 ! 2 +2 I 14.2% 14.2%. 28.5% 28.5% 14.2% 20 32 42 210 37 5.8% 9A% 12.3% 61.7% 10.8% 81 Improving 196 17 29 8.6% 14.7% 199 Markedly Improved 25 I 1 4.0% 4.0% 35 Worse 80 7 16 8.7% 20.0% 19 Markedly worse 21 4 8 19.0% 38.0% 7 No change 19 2 3 10.5% 15.7% 341 Total 341 31 57 9.1% 16.7% 9 Not investigated 9 54.6 Mean age (yr) 54.8 15,3% 2 8.0% 21 26.3% 7 33.3% 4 21.0% 64 18.8% 88 44.8% 19 76.0% 15 18.7% ! 4.7% 5 26.3% 128 37.6% Table 15. Physiological and behavioural effects of autonomy training Alive, ill 32 16.3% 2 8.0% 21 26.3% ! 4.7% 5 26.3% 61 17.9% Therapy group Blood Cigarettes Alcohol Body Lack of Healthy pressure Cholesterol per day per g weight exercise nutrition n(= 341) n(= 341) Control group Blood Cigarettes Alcohol Body Lack of Heai~hy pressure Cholesterol per day per g weight exercise nutrition 163/I 19 276 28.9 86.3 + 17 49 49 152/96 259 26.3 70.1 + 13 13 49 162/120 291 31.6 90.6 + 15 102 17 148/90 255 23.6 42.3 + 7 ! i ! 13 163/117 165/118 161/112 169/115 164/99 163/I I0 287 24.6 90.4 + 14 20 17 289 27.7 95.3 + 15 26 18 288 20.8 85.3 + 13 10 13 305 30.6 97.2 + 16 11 14 273 25.3 70.7 + 12 2 3 273 26.1 69.4 + 9 2 3 Group I 81 196 Group 2 199 25 Group 3 35 80 169/123 Group 4 19 21 Group 5 '7 19 162/120 281 30.1 82.6 + 20 88 18 159/! I0 264 25.9 75.3 + 16 59 39 2 163/120 290 28.6 88.3 + 14 13 3 I 149/90 278 25. ! 50.2 + 8 6 16 2 168/i19 276 23.6 86.2 + 13 35 42 285 28.1 89.2 + 12 50 39 2 170/114 267 25.3 84.6 + !0 12 15 170/114 267 25.3 84.6 + 10 12 .15 162/98 276 26.7 68.5 + 13 6 5 I 162/99 278 26.2 68.7 + 14 5 4 2 L09~89890~
Page 123: 2063633608 Log in for more options!
Self-regulation and mortality 795 Kn˘ier, A. W. & Temoshok, L. (1984). Repressive coping reactions in patients with malignant mechanisms as compared with cardiovascular disease patients. Journal of Psychosomatic Medicine, 28, 145-155. Kobasa, S. C. (I 979). Stressful life events; personality, and health: An inquiry into hardiness. Journal of Personality and Social Psychology, 37, 1-17. Kowal, S. J. (I 955). Emotions as a cause of cancer: Eighteenth and nineteenth century contributions. Psychoanalytic Review, 42, 217-227. Kz~itler, S. & Kreitler, H. (1990). Repression and the anxiety-defensiveness factor: Psychological correlates and manifestations. Personality and Individual Differences, II, 559-570. Kreitler, S. & Kreitler, H. (1991 ). The psychological profile of the bealth-odented individual. European Journal of Personality, 5, 35-60. Langer, E. (1983). The Psychology of control. Beverley Hill, CA: Sage. Lesser, I. M. (198l). A review of the Alexithymia concept. Psychosomatic Medicine, 43, 531-543. Leventhal, H., Nerenz, D. & Strauss, A. (1980). Self-regulation and the mechanism for symptom appraisal. In D. Mechanic (Ed.), Psychosocial epidemiology. New York: Academic Publications. Mettler, C. C. & Mettler, F. A. (1947). History of Medicine. Philadelphia, PA: L. Biakston. Mithaug, D. (1993). Self-regulation theory: How optimal adjustment maximises gain. Westport, CT.: Praeger/Greenwood. Mullen, B. & Suls, J. (1982)."'Know Thyself': Stressful life events and the ameliorative effects of private-self-consciousness. Journal of Experimental Social Psychology, 18, 43-55. Osier, W. (1906). Aequanimitas. New York: McGraw-Hill. Peterson, C. & Seligman, M. (1987). Explanatory style and illness. Journal of Personality, 55, 237-265. Roseh, P. J. (1979). Stress and cancer: A disease of adaptation? In J. Tacke,'H. Selyer & S. B. Day (Eds), Stress and cancer (pp. 187-212). New York: Plenum Press. Roseh, P. J. (1980). Some thoughts on the endemiology of cancer. In S. B. Day, E. V. Sugarbeker & P. J. Rosch (Eds): Readings in ontology (pp. I-6). New York: The International Foundation for Biosocial Development and Human Health. Rueseh, J. (1948). The Infantile Personality. Psychosomatic Medicine, 10, 134--144. Sandin, B., Chorot, P., Jimenez, M. & Santad, M. (1993a). Stress behavior types, psychosomatic complaints and disease. Presented at the 23rd European Congress of Behavioural Cognitive Therapies, London, 22-25 September 1993. Sandin, B., Chorot, P., Santad, M. & Jimenez, M. (1993b). Stress behavior types, personality, Alexithymia-coping and state-trait: Anger expression. Presented at the 23rd European Congress of Behavioural Cognitive Therapies, London, 22-25 September 1993. Sebeier, M. F. & Carver, C. S. (1985). Optimism, coping and health: Assessment and implications of generalised expectation. Health Psychology, 4, 219-247. Schmidt, G. E. (1979). The brain as a health care system. In G. Shaw, N. Adler & P. Costa (Eds), Health psychology. San Francisco, CA: Jossey-Bass. Schmitz, P. G. (1992). Personality, stress-reaction and disease. Personality and Individual Differences, 13, 683-691. Schmltz, P. (1993). Personality, stress-reactions, and psychosomatic complaints. In A. van Heck, P. Bonainto, I. Deary and W. Novak (Eds). Personality Psychology in Europe, 4, 321-343. Tilburg: Tilburg University Press. Schwartz, G. E. (1983). Disregulation theory and disease: Applications to the repression of cerebral disconnection/cardiovas- cular disorder by patterns. Review of Applied Psychology, 32, 95-118. Seligman, M. (1975). Helplessness. San Francisco: Freeman. Seltzer, C. & Jablon, S. (1977). Army ranks ~ind subsequent mortality by cause: 23-years follow-up. American Journfl of Epidemiology, 105, 559-586.. Shigehisa, T. (1994). Psychosocial determinants of physical health and disease: A theoretical analysis of the mechanisms. Journal of Tokyo Kasei Gahuiu University, No. 34. Suls, E. & Fletcher, S. (1985). Self-attention, life stress and illness: A prospective study. Psychosomatic Medicine, 47, 465-48 I. Taylor, G. (1992). Psyehosomatics and self-regulation. In J. W. Barton, M. N. Eagle & D. L. Wolizky (Eds), Interface of psychoanalysis and psychology (pp. 464-480). Washington, DC: American Psychological Association. Taylor, G. J. (1994). The alexithymia construct: Conceptualization, validation, and relationship with basic dimensions of personality. New Trends in Experimental and Clinical Psychiatry, 10, 61-77. Temoshok, L. & Dreber, H. (1992). The Type C connection: The behavioral links to cancer and your health. New York: Random House. Tennen, H. & Affleck, G. (1987). The costs of benefits of optimistic explanation and dispositional optimism. Journal of Personality, 55, 3277-393. Turner, J., Sherwood, A. & Light, K. (1992). Individual differences in cardiovascular response to stress. New York: Plenum Press. 0 O~ O~ 0
Page 124: 2063633609 Log in for more options!
794 R. Gmssarth-Maticek and H. J. Eysenck form of group therapy, is very cost effective. Sole attention to smoking and other similar physical factors is counter-productive when it leads to the neglect of important psychological risk factors. Recognition of the psychological involvement in physical disease has been hindered by philosophical problems introduced by Descartes and the wholly erroneous notion of body and mind as totally separate substances. There is no evidence for, and much evidence against, this view, and just as physicists had to adopt the fundamental notion of a space-time continuum, so psychologists and physicians will have to return to the Hippocratic notion of a body-mind continuum. As Sir William Osier (1906), the father of English medicine, used to say: "It is very often much more important what person has the disease than what disease the person has." (pp. 258-259.) REFERENCES 206363:3809 ~ Adler, N., Boyce, T., Chesney, M., Cohen, S., Falkman, S., Kahn, R. & Syme, S. (1984). Socioeconomic status and health. American Psychologist, 49, 15-24. Bandura, A. (1977). Self-efficacy: Toward a unifying theory of behaviour change. Psychological Review, 84, 191-1215. Barrios, F. X. (1985). A comparison of global and specific estimates of self-control. Cognitive Therapy and Research, 9, 455-469. Carroll, D., Smith, G. D. & Bennett, P. (1994). Health and socio-economie status. The Psychologist, March, 122-125. Carver, C., Peterson, L., Follanbee, D. & Seheier, M. (1983). Effects of self-diverted attention in performance and persistence among persons high and low in test anxiety. Cognitive Therapy and Research, 7, 333-354. Carver, C. & Scheier, M. F. (1982). Control theory: A useful conceptual framework for personality framework for personality---social, clinical and health ~syehology. Psychological Bulletin, 92, 111-135. Cohen, S., Gwaltney, J., Doyle, W., Shoner, D., Firman, P. & Newson, J. (1955). State of trait negative affect as predictors of objective and subjective symptoms of respiratory viral infections. Journal of Personality and Social Psychology, 68, 159--169. Eyscnek, H. J. (1988). The respective importance of personality, cigarette smoking and interaction effects for the genesis of cancer and coronary heart disease. Personality and Individual Differences, 9, 453-464. Eysenek, H. J. (1990). Type 'A' behaviour and coronary heart disease. The third stage. Journal of Social Behaviour and Personality, 5, 25--44. Eysenek, H. J. (199 I). Smoking, personality and stress: Psychosocial factors in the prevention of cancer and coronary heart disease. New York: Springer. Eysenek, H. J. (1994a). Cancer, personality and stress: Prediction and prevention. Advances in Behaviour Research and Therapy, 16, 167-215. Eysenck, H. J. (1994b). Synergistic interaction between psychosocial and physical factors in the causation of lung cancer. In: C. Lewis, C. O'Sullivan & J. Burraelough (Eds), The psychoimmunology of cancer (pp. 163-178). Oxford: OUP. Eysenek, H. J. & Grossarth-Maticek, g. (1991) Creative novation behaviour therapy as a prophylactic treatment for cancer and coronary heart disease: Part II--Effects of treatment. Behaviour Research and Therapy, 29, 17-31. Friedman, G. D., Firman, B., Petitti, D., Siegelaub, A., Ury, H. & Klatsky, A. (1983). Psychological questionnaire score, cigarette smoking, and myocardial infarction: A continuing enigma. Preventive Medicine, 12, 533-546. Friedman, H. S. (199 I). Hostility, coping attitudes. Washington, DC: American Psychological Association. Friedman, H. S. & Booth-Kewley, S. (1987). The "disease-prone personality". American Psychologist, 42, 539-595. Friedman, M. & Rosenman, R. (1974). Type-A behavior and your heart. New York: Knopf. Glover, H., Ohlde, C., Silver, S., Packard, P., Goodniek, P. & Hamlin, C. (1995). Vulnerability scale: A preliminary report of psychometric properties. Psychological Reports, 75, 1651-1668. Greet, S. (1983). Cancer and the mind. British Journal of Psychiatry, 143, 535-543. Grossarth-Madcek, R. (1976). Das Verhalten als Krebsriskfaktor. Heidelberg: Reike Sozialwissensehaftliche Onkologie. Grossarth-Maticek, R. (1989). Disposition, exposition, Verhaltens-muster,Organvorsehidigung und Stimulierung dos zentralen Nervensystems in der "A"tiologie des Bronchial-,-Magen- und LeberKarzinoma. Deutsche Zeitschri.a fur Onkologie, 21, 62-78. Grussarth-Matieek, R. & Eysenek, H. J. (1990). Personality, stress and disease: Description and validation of a new inventory. Psychological Reports, 66, 355-373. Grossarth-Maticek, R. & Eysenek, H. J. (1991a). Creative novation behaviour as a prophylactic treatment for cancer and coronary heart disease: I. Description of treatment. Behaviour Research and Therapy, 29, 1-16. Grossarth-Madeek, g. & Eysenck, H. (199 Ib). Personality stress, and motivational factors in drinking as determinants of risk for cancer and coronary heart disease. Psychological Reports, 69, 1027-1093. Grossarth-Madcek, R., Eysenck, H. J. & Barrett, P. (1993). The prediction of cancer and coronary heart disease as a function of the method of questionnaire administration. Psychological Reports, 73, 943-959. Grossarth-Matieek, R., Eysenek, H. J, & Boyle, G. J. (1995). Method of test administration as a factor in test validity: The use of a personality questionnaire in the prediction of cancer and coronary heart disease. Behaviour Research and Therapy, 33, 705-710. Grossarth-Matieek, R., Eysen~k, H. J. & Vetter, H. (1988). Personality type, smoking habit and their interaction as predictors of cancer and coronary heart disease. Personality and Individual Differences, 9, 479-495. Hinkl˘, L. & Wolff, H. (1957), TI~e nature of man's adaptation to his total environment and the relation of this to illness. Archives of lnternal Medicine, 99, 442--460. Howard, J., Cunningham, D. & Rechnitzer, P. (1985). Personality as a moderator of the effects of cigarette smoking and coronary risk. Preventive Medicine, 14, 26--33. Jonson, E. (1990). The deadly emotions. New York: Praeger. Kissen, D. M. & Eysenek, H. J. (1962). Personality in male lung cancer patients. Journal of Psychosomatic Research, 6, 123-137,
Page 125: 2063633610 Log in for more options!
2063633610
Page 126: 2063633611 Log in for more options!
Environmental and Molecular Mutagenesis 30:11-20 (1997) Research Articles DNA Damage in Nasal Respiratory Epithelium From Children Exposed to Urban Pollution Uiian Caider6n-Garciduefias,I* Norma Osnaya,1 Antonio Rodriguez-Alcaraz,2 and Anna Viilarreai-Calder6n3 ~ Experimentai Pathology Section, Instituto Nacional de Pediatrla, Mexico City, Mexico 2Soc Mex ORL y CCC, Mexico City, Mexico SUniversidad Aut6noma Metropolitana, Xochimilco, Mexico City, Mexico The nasal cavity is the most common portal of entry to the human body and a well-known target site for a wide range of air pollutants and chemically induced toxicity a~d carcinogenicity. DNA single- sirand breaks (SSB) can be used as a biomarker of oxidant exposure and as an indicator of the carcino- genicity and mutagenicity of a substance. We ex- amined the utility of using the alkaline single cell gel eleclmphoresls assay (SCGE) for measuring DNA damage in children's nasal epithelium exposed to air pollutants. We studied 148 children, ages 6- 12, including 19 control children from a low pol- luted Paciffc port and 129 children from $ou~mest Metropolitan Mexico City, an urban polluted area with high ozone concentrations year-round. Three sets of two nasal biopsies were taken in a 3-month period. All exposed children had upper respiraton/ symptoms and DNA damage in their nasal cells. Key words: DNA strand breaks; ozone; urban nasal epithelium Eleven- and twelve.year-aids had the most DNA damage, and more than 30% of children aged 9- 12 exhibited patchy areas of squamous metaplasia over high-flow nasal regions. These areas had the greatest numbers of damaged DNA cells (P 0.001) and a large number of DNA tails > 80 (P < 0.001) when compared to the contralateral macroscopically normal site in the same child. The youngest children with significantly less outdoor ex. posure displayed patchy areas of goblet cell hyper- plasia and had the least DNA damage. These find- ings suggest that SCGE can be used to monitor DNA damage in children's nasal epithelium and, fisrther, the identification of DNA damage in nasal proliferative epithelium could be regarded as a sen- tinel lesion, most likely due to severe and" sustained cell injun/. Environ. Mol. Mutagen. 30:11-20, 1997 © 1997Wiley.Llss, Inc. pollution; comet assay; children's DNA damage; INTRODUCTION Exposure to 0-, concentrations that exceed the current US Environmental Protection Agency National Ambient Mr Quality Standard (120 ppb) is a daily occurrence for ,~-AIHons of p~ople throughout the world. Southwest Met- ropolitan Mexico City (SWMMC) is a highly polluted urban environment with daily ozone concentrations > 0.12 ppm all year long. School children am an espe- cially highly exposed group because they engage in play and coml~itive outdoor physical activities in the after- noon, when O3 levels am at their peak. Ozone., the product of volatile hydzocaflxm degradation to nitrogen oxides, is a potent nonradical oxidant and a ajor component of photochemical smog; concerns con- unue to increase about its potential health hazard for hu- rnans [Lippman, 1993; Bascom et al., 1996]. The potential health effe~-ts on children receiving a lifetime exposure to a complex mixture of pollutants, including high ozone @ ] 997 Wiley-Hss, Inc. concentrations are of concern, given the capability of ozone alone to cause respiratory epithelial damage in experimen- tal animals and humans [Tepper et al., 1989; Chang et al., 1991; Calderdn-Garciduefias et al., 1992, 1994; Pino et al., 1992; Harkema et al., 1993]. Although exposure to 03 primarily affects the terminal bronchioles and alveolL the resp/ratory eFitheiinm in the nose, the first part of the respiratory airway, which conditions between I0,000 and 20,000 liters of air, receives the highest Os concentration during nasal breathing [Henderson et al., 1993]. Significant nasal epithelial lesions have been described both in animals and in humans exposed to Os [Harkema et al., 1987, 1989; Calder6n-Crarciduefias et al., 1992]. *Correspondence to: Dr. LiHan Calderon-Garciduefias, Cerm del Vigio lante 96, Romero de Terreros, Coyoacan 04310, Mexico DF, Mexico; F_,-mail: lcaldera@mail~.rnain.cona~.mx. Received 28 August 1996; revised and a~cepted 26 December 1996.
Page 127: 2063633612 Log in for more options!
12 Calder6n-Garc|duefias et al. Ozone produces damage by both radical and nonradical mediamd processes. Ozone-induced free radical formation involves the reaction of O~ with olefinic compounds or electron donors [Pryor, 1994]." Recent studies have sug- gested that damage to DNA could be produced aRer expo- sure to ambient levels of O3; ozone exposure in vivo of Hsher 344 rats induces DNA damage in alveolar macro- phages [Hanley et al., 1993]. A similar induction is seen in bronchioalveolar macrophages and tracheal epithelial cells of guinea pigs exposed to 1.0 ppm O3 for 2 hours and in healthy human volunteers exposed m 0.4 ppm O3 for 2 hours [Lee et al., 1995]. Hydrogen peroxide has been shown to induce DNA single-su'and breaks (SSB) in the human lung cell line A549 [Baker and He, 1991] and in the adeno SV40 wansformed human bronchial epio thelial cells (BEAS) in a dose-dependent manner [Mc- Donald and Ducore, 1993]. Further, O3 degrades unsatu- rated fatty acids, like arachidonic acid (AA), m hydrogen peroxide and carbonyl compounds [Madden et al., 1993]. Ozonized AA potentiates the formation of DNA SSB in cultured human lung cells [Kozumbo et al., 1996]. Ozone exposure also causes airway inflammation; activated neu- trophils exer~ deleterious effects, including generation of oxygen radicals that mediate cellular injury, that is, nu- cieic acid base damage., DNA smmd crosslinkage, and DNA SSB that may result in celluiar repair, proliferation, differentiation, or mansformation [Cochmne, 1991]. In a recent study, we reported the induction of DNA damage in nasal respiratory cells of newly arrived young males to Mexico City and the presence of significant num- bers of SSB in nasal cells of 12-year-olds and adults with a lifetime exposure to the city's polluted environment [Calderdn-Garcidueflas et al., 1996]. The exposed chil- dren studied showed two interesting findings. First, they all had statistically significant numbers of DNA-damaged nasal cells compared with children of the same age and socioeconomic status living in a low polluted environ- merit. Second, the Mexico City children displayed patches of macroscopicaUy abnormal mucosa over high-flow na- sal areas [Hahn et al., 1993] located on the inferior and middle mrbinates. In the present study we extended the documentation of DNA-damaged nasal cells (detection of DNA damage by the single cell gel electrophoresis assay [SCGE], pH > 13) to include elementary school children ages 6 through 12; to determine if the areas ofmacrosoop- ically abnormal mucosa were exclusive of older children or could be detected in younger ones, to define these abnormal mucosal areas histologically and to look for any differences in DNA damage between the macroscopically abnormal and normal nasal epithelium. MATERIAI.S AND METHODS Pollutont Methodolow/ A~nosphtric pollutants and memomlogical conditions wer, moni- tor~ at the P~dr,gal station, located in SWMMC downwind of the major diurnal emissions in Meu'opolimn Mexico City and 3 miles or less from the children's neighborhood. Ozone w~s monitored by using a Beckman 950 chemilumine~ance analyzer with a calibration routine in accordance with USEPA procedures. We also monitored NO~. $O~, mmpemmm, mladve humidity, wind speed, and rain evenm. The maximal concenmnions, number of hours equal to or above the N AAQS. and the time of occurrence of pollutant pesks, were recorded. Dam from Manzauilio, the Pacific port connol area. were obtained from the Sludy Population The projec~ was approved by the Institute Nacional de Pediatda Re- view Boards for Human Studies. and informed written consent was obtained from the children's parenm. The study group consismd of 148 chikL, en. including a comzol population of 19 children and an exposed Southwest Meu-opoiitsn Mexico City gmop of 129 cldldren. All partici- pants in the study had a personal negative history of active smoking and environmental tobacco smoke exposure. The information obtained from each child and pax~nt (usually the mother) included age, sex, place and length of residency, socioeconomic status, daily outdoor time, level of physical activity and time of day when it took place, dietary intake, honsehuld cooking methods, patents' ocm~padonal history, history of toxic exposures and toba~,o e~xposum, family history of respiratory disease, personal history of allergies, and rt;spiratory and otolaryn- gology symptoms, including epistaxis, rhinorre~ quality and quantity of mumm, nasal dryness, nasal obsmmtion, cough, thoracic pain. and recent respiratory illness (in tim previous 3 months). Children with a history of earonos~.throat surgical pro~edmes, in nend of treatment for atopiv or inf~tions rhinitis, bronchitis, asthma, allvrgi~ diseases, or known expostmm to harmful substan~ (solvents. paints, metals, photo- copying machines) wet, ~luded from the study. The contsol children included 9 girls and I0 boys. aged 11.21 + 0..5 years, with a daylight exposure of 6.26 + 0.98 hours. These children lived in a low-polluted Pacific port; they seidom lefft their small town, and they had never been to a larg~ city. The exposed group incluck;d 65 girls and 64 boys. ages 6-12. an averag~ of 21 children per age group. These children were lifetime residents in SWMMC. all attended the same school, had the same socioeconomic level and lived in the same neighborhood. 2063633612 : W~ ~btalned ~amples ~f n~al r~pi~ory epitheiinm with ~ dispos~bl~ pl~ti˘ cur~tm ~hino-P~b~o ASL ,4~llngmn, Text) under dir~:t visual in~.-'tion. Th~ first se~ ~f binpdes w~ obtained from the inferio~ surf~:~ of the po~t-'~ior portion ~f the inferior n~al turbinm~ ~2 biopsie~ per child, 14g children). The s~coad ~t (32 childnm) w~ I~t~" ~ ~bnm'm~l mucosal ~ p~t on the anm~ior h~ad of the inferio~ and middl~ turbin~ and ~h~:m'iz~ by irregular p~:hes whid~ho~y d~'~scd muco~. The third se~ w~ ~ 4 ~ ~ ~bnm-mal muco~l ~ ~ d~eribed ~bove and the ˘ontmlm- ~ idend~d m~ro~:opically ne~'mal ~tomi~l ~ 04 child,s). Occ~don~l m~-ing of th~ ipdlm~ral ~y~ and sn~..zin~ wer~ ~ th~ p~u~- One biopsy sampl~ per child w~ immediamly h~o m~r~:d in I ml of cold RPIVl116~0 medinm (GIbo~, Grand Island, and ~-ved for the viability pmpidium iodid~ ~PI) ~clu~ion ~ el~˘u'opbo~is a~.~y. The s~c~nd biop~ was fixed in nentra110% f~rmaldehyd~. gently sh~k~u~ the glass mb~; ˘onm~l ~nples required mincing with scalp~l blad~ and vo~g f~ I0 s~ond~. F~ the vi~bllity pl of th~ ~ su~:~mdon w~ t~ with th~ PI as.~y in an EPIC~ P~file II C~ult~ Fl~w C~om~er ~Conlt~, I-liale~h, FLL Obs~-vadon~
Page 128: 2063633613 Log in for more options!
were made as to the overall adequacy of the single-call separation, distribution of cell types, and ciliary motility. Single Cell Gel Electmphoresis Assay We asse~ed DNA damage by the S~GE assay [Singh e˘ al.. 1988]. Briefly. the single na~l cell suspension volume was adjus~d to 50,000 callgS0 ~L Thes~ cells wer~ mixed with 50 ~i of low malting agsrose at 37"~ and then placed on precienned microscope slides (Fisher fully f~osted slides, Haber Scientific, Pittsburgh, PA), which were already covered with a thin layer of 0-5% normal.malting agarose. The slides were kept at 4"C for 5 minutes to allow solidification of the agarose and then immersed in a ft~hly made cold 4C lysin$ solution (1% .-:dium um:osinate, 2.5 M NaC1, I00 ~ NarEDTA, 10 raM, Tris pH 10, and 1% Triton X-100) for 1 hour to lyse the cells, The slides were then removed f~om the lysing solution and placed on a horizontal gel electrophomsis unit (Easy Cast, Model B2 Owl Scientific Inc. Wood- burn, MA). The unit was filled with fresh alectrophoredc alkaline buffer (I mM EDTA and 300 ram NaOH), and the slides were allowed to set for 20 minutes to pennk unwinding of DNA before alectmphoresis. Electmphonmis wm conducted for the next 20 minutes at 25 V and 300 mA by u~ing an alecm3phoresls-compact power supply (Buchler Insummeat~ Kansas CIW, MO). Aft~ alecu~phonmls, the slides were washed gently with 0.4 M Tri~ pH 7.5 and then stained with 25 ttl of 20 ttg/ml ethidium bromide in distilled water. Observations were made ~ing an Olympus AH-2 microscope equipped with an excitation filter of 515-560 nm and a barrier filter of 590 nm. We analyzed a minimum of 50 randomly selected cells per sample, and the score was based on the observations of one slide reader, thus minimizing variability due to subjective scoring. To quantimm DNA migration, we measm~i with an ocular micmmemr the DNA pauem length of individual cells in two replicate slides from the same nasal sample. For each cell the length of the image (nucleus plus migrated DNA) was measured in micrometers at a 250-fold magnification. To elaborate the histograms of the distribu- tion of DNA mlgnuion we arbiwarily divided the scale into four groups: <10 ~m, 10-40 lun, 41-80 ttm, 81-120 ttm and >121 p.m. DNA from =vntrol cells (human fresh lymphocytes) appeared as a round pattern that did not migrate in the gel The SCGE assay utilizes the principle that cells with damaged DNA will migrate a greater distance in an alectro- phomfic fiald under the alkaline conditions used. Comet tails am caused by the increased migration of the smaller DNA fragments toward the L~ght Microscopy Formaldehyde.fixed samples were processed in paraffin, cut at 5 ttm ~-~d stained with hematoxylin-cosin and alcian blue periodic acid Schiff .. ,B/PAS pH 2.5). Cell suspensions used for the SCGE assay were stained with Papanicolau stain. Statistical Analysis Data capture was 100% for the 148 participant chikkren, Statistical evaluation of dam consis~i of nonparametri˘ KruskalLWallh to test for differences in the numbers of calls with DNA tails < 10 pm between control and exposed g~oups; differences in the numbers of cells with t~ils <10 tun among the exposed groups themselves and differences in :" n~ DNA taft lcogth among exposed ~oups. The Z2 test was used for differences in the frequency and pwcenmg˘ of undamaged DNA cells in mam'oscopicaily normal vs. abnormal biopsies and ANOVA analysis for multiple comparisons for the outdoor ˘xposom analysis of SWMMC children. All values are reposed as ±SD. P < 0.05 was considered significant. Children's Nasal Mucosa and DNA Damage 13 RESULTS Air Quality Data SWMMC residents are recurrently exposed to a com- plex mixture of air pollutants, ozone being the main pol- lutant. Since the fall of 1986, O3 concentrations on and above the current NAAQS (0.12 ppm as I hour maximum concentration, not to be exceeded more than once per year) have been recorded in SWMMC throughout all sea- sons, an average of 3 - 1 hour/day [Garc~a-Guti&'rez et al., 1991]. Exposed children were studied in a 3-month period (September-November 1995) characterized by an average of 82 hours/month with O3 > 0.12 ppm, the highest O3 value was recorded on September 22 at 1400 hours (0.286 ppm). NO~ concentrations were on average 0-~49, 0.908, and 1.283 pproJday, while SO~ values were on average 0.257, 0.318, and 0.380 ppra/day, for Septem- ber, October, and November, respectively. The conu'ol population on the Pacific pore was sampled on January 1995 with aunospheric and meteorological conditions av- erage for the season: 26°C; relative humidity 87%; wind speed 9-18 ~ and no detectable air pollutants. Study Population Clinical Data Nasal and respiratory symptoms were absent in the control children. The youngest SWIVIMC children had the least epistaxis (7/22) and chest discomfort (3/22) and denied nasal dryness; while 11-year-olds had the highest incidence of epistaxis (21/26), nasal obstruction (19/26), nasal dryness (20/26), cough (25/26), and chest discom- fort (24/26). The finding by direct ENT endoscopic visual inspection of a macroscopically abnormal nasal mucosa, predominantly over the anterior head of the inferior and middle turbinates (irregular, sharply demarcated, geo- graphical patches of thinner, depressed, opaque, whitish- gray mucosa), was uncommon in first graders (1/22, 4_~%). The highest frequency was observed in 9- to 12- year-olds (30-35%) These patches of abnormal mucosa decreased in size and number toward the middle and pos- terior head of the affected mrbinates. The outdoor expo- sure time was significantly higher in grades 2-6 than in first graders (P < 0.001)~ older children spend more dine outdoors and engage in physical activities. Single-Cell Gel Electrophomsis Assay A signi~cant difference (P < 0.0001) in the numbers of DNA tails < 10 ~ (interpreted as undamaged cells), was observed between control and exposed children. The numbers of nasal cells with DNA damage in control chil- dren was low (17 __ 6.07%) and all of them migrated in the range of 10-40 ~n. By contrast, SWMMC children showed 82.16 __. 6.4% of nasal cells with DNA damage. The largest numbers of damaged cells among the Mexico
Page 129: 2063633614 Log in for more options!
14 C.alder6n-Garddueflas et al. 0 DNA Tall Length ~m) Hg. 1. Di~ribution of comet ~ in nasal cells of the 14 SWMMC childt~ that had an area of whitish. ~ nasal mucosa and a contralateral grossly unremarkable epithelium, both are~ were biopsied and subjected to the SCGE assay. Macroscopically abnormal mtw, osal ,ageas con~spond histologically to squamous metaplastic epithelium and show a marked decnutse in the numbe~ of undamaged DNA ceils (< I0 gin) as well as a significant diffeze~ce in the numbe~ of DNA tails 81-120 ltm when compared to the contralate~al macroscopically normal ~ite in the same child (data from 14 children. 28 biopsies). City children were observed in 11- and 12-year-olds, and, furthermore, these two groups had significantly more ceils with DNA tails in-the range of 81-120 pan than younger children (P < 0.001). A similar trend was observed for the three older children groups; they had a statistically significant number of ceils zrfigrating in the range of 40- 80 tun (P = 0.03, 0.02, and 0.003 for ages 10, 11, and 12, respectively) when compared with children age 6 through 9. We also compared the SCGE findings in the 32 biopsy samples taken from abnormal nasal areas vs. the results of the 129 exposed original samples. The dif- ferences between these two sets of samples were statisti- cally significant in the numbers of ceils with DNA tails < 10 I.tm, markedly decreased in the 32 biopsies (P = 0.001) and in the numbers of cells with DNA migration lengths in the range of 80-120 p.m, significantly elevated in the macroscopically abnormal nasal biopsies (P ffi 0.009). We then proceeded to analyze the 28 samples taken from the 14 children that had an area of whitish- gray, depressed mucosa and a conwalateral grossly unre- markable epithelium. Again, the macroscopically ~bnor- real mucosa had the least numbers of ceils with tails < 10 p.m (P < 0.001) and a large number of DNA tails >81 ttm (P < 0.001) (Fig. 1). Cell Viabilities and Histopaibology Viable nasal cells were 72.5 __. 6.3% for control chil- dren and 63.4 _ 7.2% for exposed ones. There were no differences in cell viability between school grades or in r~lafion to gender or anatomical location of the biopsies. An average of 2 mm of nasal epithelium was present in the 194 biopsies examined. Control children had normal mucociliary epithelium, which in the fresh s~at~ showed strong, regular beating movements, while exposed chil- ciren, for the most part, had weak, irregular ciliary beating movements with multifocal loss of cilia or attenuated cilia (Hg. 2A). Patchy areas of an apparent goblet cell hyper- plasi~. ~ (Fig. 2B) were present in the first set of biopsies in all exposed children. These areas had a marked ten- dency to decrease in the older children (18/22, 15/23, 10/23, 9/22, 2/26, and 3/19, respectively, for ages 6-12). Goblet cells in the exposed children exhibited increased alcianophilic mucous (Fig 2C). No attempt was made to quantify the numbers of goblet ceils in the biopsy sam- pies, since we did not have a basal lamina included in them. A mild neutrophilic intraepitheJial infiltrate was present in all of the exposed biopsies (Fig 2A). The mac- roscopicaily abnormal mucosal samples were character- ized by no identifiable mucociliary epithelium; instead, there was a metapiasti˘ squamous epithelium with mild to moderate variation in nuclear size and prominent nucleoli; disc~te areas with microvessel proliferation were also seen impinging upon the basal layer (Fig. 2D). DISCUSSION 20636336 14 The present study documents the results of the single cell gel electrophoresis assay in detecting DNA damage in nasal respiratory epithelium of two groups of elemenr~y school children, a group from a low-polluted Pacific coastal area and a highty exposed group from Southwest Mem3poiltan Mexico City. The single ceil gel electropho- resis assay under alkaline conditions (pH > 13) is capable of detecting single- and double-swand breaks, alkali-labile sites, and DNA repair sites LTice, 1995]. In our study, children living in a low-polluted environment had sig- rdflcantly less DNA nasal damage than SWMMC ct~l- dren. Further, exposed SWMMC older elementary schoot children had greater DNA migration when compared to younger ones. Since migration length correlates cLirectty to DNA fragment size, this parameter is expected to be proportional to the extent of DNA damage. Moreover, more than 30% of SWMMC children ages 9-12 exhibited patchy areas of sqnamous metapiasia over high-flow nasal regions, with statistically significant DNA damage com- pared to biopsies of SWMMC children with still identifi- able respiratory epithelium or with goblet cell hyper- piasia. The atmosphere of SWMMC is a complex mixture of air pollutants, many of which have not been identified. However, ozone is the key index pollutant for the area and the only monitored pollutant that exceeds the NAAQS every day, all year round. Ozone, therefore has been the
Page 130: 2063633615 Log in for more options!
focus of our attention because it 'is highly reactive and interacts with a wide variety of organic molecules, includ- ing unsaturated fatty acids, proteins, and nucleic acids to produce toxic free radical intermediates, initiates cascades of free radical reactions that damage genetic integrity, and causes, at relatively high concentrations, extensive DNA damage as reflected by strand breaks, DNA in- terstrand crosslinks, and DNA protein crosslinks [Ha- melin, 1985; Victorin, 1992; Feig et al., 1994]. Nelson and Kastan [1994] have reported that, since DNA damage may predispose cells to genomie alterations associated with neoplastic transformation, and broken DNA ends :nay be potentially recombinogenic, resulting in chromo- some segment deletions, translocations and or duplication in cells that traverse the cell cycle, the detection of DNA damage in nasal proliferating epithelium can then be re- garded as a sentinel lesion, the result of severe and sus- tained cell injury. These authors have also emphasized that DNA strand breaks are a considerable threat to cell viability and cell genome integrity and that different types of cells appear to be endowed with different DNA repair capacities and vary in their propensity to generate DNA strand breaks after exposure to genotoxic agents. These observations are extremely relevant to our findings, since in the exposed children, squamous metaplastic epithelium located over high flow nasal areas displayed the most DNA damage. This metaplastie epithelium lacks goblet cells, and mucus with its known antioxidant effect is markedly decreased [Cross et al., 1984]; this increases the exposure of the underlying cells to ozone and other pollutants. By sharp contrast, the nasal respiratory epithe- .ium with identifiable ciliated and goblet cells and the patchy areas with goblet cell hyperplasia, had signifi- candy less DNA damage. Thus, mucus cells appear to reduce the direct or indirect toxic effect of 03 and other pollutants on nasal tissues. Two points of interest are worth discussing here: first, the finding of goblet cell hyperplasia in the SWMMC-exposed younger children and, second, the progressive diminution of this important protective mechanism as the children grow older in their ?olluted environment. Harkema and colleagues [1987] described a mucus cell hyperplasia in the nasal transi- tional epithelium (TE) of monkeys exposed to 0.15 ppm 03, 8 hours/day for 6 days, while in Fisher rats (F344/ N) exposed to 0.8 ppm 03, 6 hours/day for 7 days, they described a mucus cell metaplasia in the TE lining the lateral aspects of the aasoturbinates, the lateral wall and the maxilloturbinates [Harkema et al.. 1989]. Therefore, the nasal goblet cell hyperplasia and metaplasia seen in O3-exposed monkeys and rats, as well as the extensive ::.'onchiolar metaplasia observed in the terminal bronchi- ˘~les of rats exposed chronically to 0.5 and 1.0 ppm O3 [Stockstill et al., 1995], may represent an adaptive mecha- nism to the continued ozone insult. Ozone could affect epithelial secretory cells directly with a resulting in- Children's Nasal Mucosa and DNA Damage 15 creased proliferation or could cause proliferation of undif- ferentiated cells selectively into goblet cells [Harkema and Hotehkiss, 1995]. Regardless of the mechanisms, it seems that goblet cell hyperplasia most likely represents a protective, adaptive mechanism that apparently de- creases in humans with prolonged pollution exposure. The second point of interest is the fact that in experi- mental animals, nasal epithelial lesions develop in specific sites of the nasal passages for many inhaled toxicants [Morgan and.Monticello, 1990]. According to these re- searchers, th~distfibution of chemically induced lesions in the respiratory tract is influenced by one or more of the following factors: (1) regional uptake patterns, (2) cellular susceptibility to a given dose of a chemical, and (3) local clearance processes by the mucosa and the vas- culature. While the squamous epithelium in the rat nasal vestibule is fairy resistant to inhaled gaseous irritants [Jiang et al., 1986], in nonhuman primates, the transitional epithelium, located between the anterior squamous epithe- lium and the most posterior respiratory epithelium and the ethmoid turbinate, is the major target site for O3 toxicity [Harkema et al., 1987; Hatch et al., 1995]. Therefore, to find areas of squamous metaplasia with severe DNA damage over the anterior heads of the anterior and middle turbinates coincides with a lesion pattern that reflects the major inspiratory airflow streams [Kimbell and Morgan, 1991; Hahn et al., 1993; Kimbell et al., 1993]. This pattern might be expected for materials delivered in high local concentrations as a result of inspiratory airflow with a diminishing anterior-to-posterior severity gradient due to the scrubbing action of airway secretions [Kimbell and Morgan, 1991]. Kimbell and coworkers [1993] concluded that, while airflow patterns and aiiavay diffusion play a role in determining ozone lesion location, airway lining and wall factors are also important determinants. Regional uptake of inhaled gases is influenced by the nature of the nasal lining, with complex interactions be- tween inspired gas and lining layers [Morris et al., 1986; Bogdanffy et al., 1987]. Although the greatest concern during assessment of nasal toxicity is the cancerous re- sponse, the relationship between adaptive responses (i.e., squamous metaplasia) and human nasal carcinogenesis remains problematic. Monticello and Morgan [1995] em- phasize the difference in rodents between adaptive squa- mous metaplasia of the nasal transitional or respiratory epithelia and the squamous metaplasia with prominent keratinization, an ominous finding with respect to cancer. Chlorine gas is a good example of an upper respiratory toxicant, but not a carcinogen in rats and mice. It induces lesions confined to the nose in F344 rats and B6C3F1 mice, the lesions are more severe in the anterior nasal cavity and include mucosal inflammation, respiratory epi- thelial hyperplasia, squamous metaplasia, and goblet cell hypertrophy and hyperplasia [Wolf et al., 1995]. On the other hand, formaldehyde, a major air pollutant and a Ix.', o 0~
Page 131: 2063633616 Log in for more options!
16 Calder6n-Garciduefias et al. F~g. 2, Nasal biopsies from exposed SWMMC children. A: Biopsy from a 7-year-old girl shows identifiable respiratory epi~elium with short cilia, mild variation in nuclear size, prominent nucleoli and a fex˘ scattered neutrophils. H&E x l14. B: Biopsy from a 6-year-old boy showing an apparent increase in goblet cells, short cilia, and deciliated areas, along with scattered PMNs. H&E x90. C: Same biopsy as Figure B. showing numerous goblet cells identified by the abundant alcianophi- lie material stained blue with the PAS-AB pH 2.5 stain ×90. D: Squa- indUS metaplastie epithelium with moderate variation in nuclear size has replaced the normal respiratory, epithelium over the anterior head of the middle turbinate in this 12-year-old boy. Discrete areas with microvesset proliferation are seen impinging upon the basal layer, H&E ×90.
Page 132: 2063633617 Log in for more options!
Children's Nasal Mucosa and DNA Damage 17 Fig. 2. (Continued) potent carcinogen in F344 rats exposed long-term to high doses, causes DNA SSB and DNA protein crosslinks [Morgan et al., 1986: Reuzel et al.. 1990: Casanova et al., 1991; Cassee and Feron, 1994]. Rhinitis, squamous metaplasia, and hyperplasia of the nasal respiratory epi- thelium along with increases in cell proliferation precede
Page 133: 2063633618 Log in for more options!
18 Calder6n-Garciduefias et al. the appearance of squamous cell carcinomas in the nasal passages. The location of the tumors correlates well with the distribution of histological evidence of acute cytotox- icity and with areas of inhibition of nasal mucociliary function. Further, areas where tumors are notably absent, that is, the medial aspect of the maxilloturbinate, are more resistant to DNA damage induced by dimethylnitrosamine than are those of the nasoturbinates [Bermudez, 1991]. The interpretation of squamous metaplasia with severe DNA damage in children exposed to a highly polluted atmosphere is an important challenge to pathologists, tox- icologists, epidemiologists, ENT physicians, and pediatri- cians, as is the assignment of squamous metaplasia and other potentially adaptive changes to a specific disease process. Recently developed tissue microdissection tech- niques that allow the procurement and genetic analysis of selected cell populations [Zhuang et aL, 1996]; the determination of oxidative DNA damage (8-hydroxy- deoxyguanosine) [Cheng et al., 1992; Yarborough et al., 1996], the detection of defects in loci on chromosome 11 [Ward et al., 1993], and the analysis of expression of retinoid receptors and different molecular weight keratins [L. Hu et al., 1991: Lancillotti et al., 1992; X. Hu et al., 1994] could be useful in the investigation of these adap- tive versus adverse nasal mucosal changes. The harmful health consequences of the polluted air to which the SWMMC residents are exposed, and the long delay that will occur before our air is cleaner [Blake and Rowland. 1995] makes it crucial to develop strategic approaches to determine the nasal pathology underlying mechanisms, the mapping of lesion distribution patterns, the identification of chronic air pollutant exposure bio- markers, and the definition of the potential relevance of noncancer responses in a range of disease states such as rhinitis, epistaxis, impairment of nasal flow, and mucocili- ary activity, dysosmia, and pathological states such as dysplasia and cancer. Based on the striking finding of an apparent goblet cell hyperplasia and less DNA damage in the nasal ceils of the youngest children examined and its correlation with a lesser outdoor exposure, the first step to protect children ought to be a drastic reduction in their outdoor exposure time and an avoidance of physical exertion at the maximal O3 concentrations periods. In summary., a lifetime exposure to a complex mixture of air pollutants with O3 as the main pollutant, produces significant nasal lesions in exposed children. The finding of particularly severe nasal cell DNA damage in areas of squamous metaplasia located over high-flow nasal re- gions, opens a series of questions about the relevance of these lesions. Are these squamous metaplastic cells more prone to mutations and malignant transformation? Do they represent innocuous adaptive responses? Or could we eventually apply the statement by Farber and Rubin [1991]: "'an adaptive response reveals its less beneficent aspect in neoplasia, when the stress becomes too severe or prolonged." ACKNOWLEDGMENTS We thank all the children who took part in this study, Gerardo Barragfin for statistical support, Humberto Gar- nica and Donald Joyner for the art work, Leticia Rarnfrez for ..h..istological support, Raquel Garc~a for flow cytometry support, Jessica Villarreal-Calder6n for the control popu- lation clinical assistance, Dr. Michael C. Madden of the U.S. Environmental Protection Agency for support and instruction in the use of the SCGE assay, Drs. Julian Preston and Douglas Wolf of the Chemical Industry Insti- tute of Toxicology, Dr. Raymond Tice of the Integrated Laboratory Systems for helpful discussions, Dr. Barbara Kuyper for her editorial support, and Sadie Leak for secre- tarial assistance. 2063633618 , REFERENCES Baker M, He S ( 1991): Elaboration of cellular DNA breaks by hydroper- oxides. Fre~ Radicals Biol Med 11:563-572. Baseom R, Bromberg PA, Costa DA, Devlin R, Dockery DW, Frampton MW, Lambert W, Samet JM, Speizer FE, Utetl M (1996): Health effects of outdoor pollution, Part L Am J Respir Crit Care Med 153:3-50. Bermudez E (199 l): Assessment of genotoxic effects in rat nasal epithe- lium. In Barrow CS (ed): "Toxicology of the Nasal Passages." New York: Hemisphere, pp 275-290. Blake DR, Rowland FS ( 1995): Urban leakage of liquefied petroleum gas and its impact on Mexico City air quality. Science 269:953- 956. Bogdanffy MS. Morgan PH. Start TB, Morgan KT (1987): Binding of formaldehyde to human and rat nasal mucosa and bovine serum albumin. Toxicol Lett 38:145-154. Calder6n-Garoiduefias L. Osorno-Velazquez A. Bravo-Alvarez H, Del- gado-Chavez R, Barrios-ML, quez R (1992): Histopathological changes of the nasal mucosa in southwest metropolitan Mexico City inhabitants. Am J Pathol 140:225-232. Ca/der6n-Garcidueflas L, Rodrfguez-Alcaraz A, Garofa R, Sfinchez G, Barragfm G, Camacho R, Ramfrez L (1994): Human nasal muco- sal changes after exposure to urban pollution. Environ Health Perspect 102: t074-1080. Calder6n-Garciduefias L. Osnaya-Brizuela N, Ramirez-Martfnez L, Vit- larreal-Calder6n A (1996): DNA strand breaks in human nasal respiratory epithelium am induced upon exposure to urban poilu- tion. Environ Health Perspeet 104:160-168. Casanova M. Morgan KT. Steinhagen WH. Everitt JI, Popp JAo Heck H d'A ( 1991): Covalent binding of inhaled formaldehyde to DNA in the respiratory tract of Rhesus monkeys: Pharmacokinetics, rat-to monkey interspecies scaling and extrapolation to man. Fund Appt Toxicol 17:409-428. Cassee F1L Feron VJ ( 1994): Biochemical and histopathological changes in nasal epithelium of rats after 3-day intermittent exposure to formaldehyde and ozone alone or in combination. Toxicol Lett 7 2:257-268. Chang L. Miller FG, Ultman J. Huang Y, Stockstill BL. Grose EC, Menache MG. Miller FG. Costa DL, Crapo JD (1991): Alveolar epithelial injury by subchronic exposure to low concentrations
Page 134: 2063633619 Log in for more options!
of ozone correlate with cumulative exposure. Toxicol Appl Phar- mace! 109:219-234. Cheng KC, Cahill DS, Kasai H. Nlshimura S, Loeb LA (1992): 8- Hydroxyguanine. an abundant form of oxidative DNA damage, causes G -" T and A -" C substitutions. ] Bioi Chore 267:166- 172. Cochrane CG ( 199 ! ): Mechanisms of oxidant injury of cells. Mdi Aspect MOd 12:137-14-7. Cross AE, Halliwell B, Allen A (1984): Antioxidant protection: A func- tion of tracheobronchial and gastrointestinal mucus. Lancet 1:1328-1330. Darzynkiewicz 7- Li X, Gong J ( 1994): Assays of Cell Viability: dis- crimination of cells dying by apoptosis. In Darzynkiewicz Z ted): • 'Flow Cytometry.'" San Diego, CA: Academic Press, pp 15- 38. 7afoer F_,, Rubin H (199l): Cellular adaptation in the origin and develop- ment of cancer. Cancer Res 51:702-722. Feig DL Reid TM, Loeb LA (1994): Reactive oxygen species in tumori- genesis. Cancer Res 54:1890-t894. Garcfa.Gutidrrez A, Herrera-Hemandez M, Bravo-A/varez H (1991): Campus ozone concentrations related to new blends in gasoline sold in Mexico City: A statistical analysis. J Air Waste Manag Assoc 145:A115-4. Hahn I, Scherer PW, Mosell MM (1~)93): Velocity profiles measured for airflow through a large-scale model of the human nasal cavity. .I Appi Physiol 75:2273-2287. Hamelin C (1985).'. Production of single and double.strand breaks in plasmid DNA by ozone. Int J Radiat Oncol 11:253-257. Hanley NM, Kozambo WK, Costa DL, Tice RR. Madden MC (1993): Induction of DNA single strand breaks in lung cells by ozone exposure in rive and in vitro. Am Rev Respir Dis 147:A670. Harkema JR, Hotchkiss JA (1995): Ozone-induced proliferative and metaplastic lesions in nasal transitional and respiratory epithe- Lium. In Miller FJ (ed): "Comparative Pathology: Nasal Toxicity and Dosimetry of Inhaled Xenobiotics." Washington, DC: Tay- lor and Francis, pp 187-204. Harkema JR. Hopper CG, Hyde DM. St. George J, Wilson DW, Dungw- orth DL (1987): Response of the macaque nasal epithelium to ambient levels of ozone: a morphologic and morphometdc study of the transitional and respiratory epithelium. Am J Pathol 128:29-44. Harkema JR. Hotchkiss IA. Henderson FR (1989): Effects of 0.12 ~nd 0.80 ppm ozone on rat nasal and nasopharyngeal epithelial muco- substances: Quantitative histochemistry. Toxicol Pathol 17:525- 535. Harkema JR. Hopper CG, Hyde DM. St. George JA, Wilson DW, Dungworth DL ( 1993): Response of macaque bronchiolar epithe- lium to ambient concentrations of ozone. Am J Pathol 143:857- 866. latch GE. Harkema JR. Graham RC '( 1995): Ozone dosimetry studies in the nose and eye using oxygen-18. In Miller FJ (ed): "Nasal ToMciry and Dosimetry of Inhaled Xenobiotics.'" Washington. DC: Taylor and Francis, pp 125-134. Henderson RF, Hotchkiss JA. Chang IY. Scott BR. Harkema JR ( 1993): Effect of cumulative exposure in nasal response to ozone. Tox- icoi Appl Pharmacol 119:59-65. Hu L, Crowe DL, Rheinwald JG. Chambon P. Gudas L/( 1991): Abnor- mal expression of retinoic acid receptors and keratin 19 by human oral and epidermal squamous cell carcinoma cell lines. Cancer Res 51:3972-3981. !u X, Re JY. Lee JS. Shin DM. Hong WK, Lotan R (1994): Differential expression of nuclear retinoid receptors in normal, premaiignant and malignant head and neck tissues. Cancer Res 54:3580-3587. Jiang XZ. Morgan KT. Beauchamp Re ( 1986): Histopathology of acute and suhacute nasal toxicity. In Barrow CS (ed): "'Toxicology of the Nasal Passages." New York: Hemisphere, pp 51-66. Children's Nasal Mucosa and DNA Damage 19 KJmbell JS. Morgan KT (1991): Airfow effects on regional disposition of particles and gases on the upper respiratory apparatus. Radiat Desire Protec 38:213-219. Kiml~ll JS, Gross EA. Joyner DR. Godo MN, Morgan KT (1993): Application of computational fluid dynamics to regional dosime- try of inhaled chemicals in the upper respiratory tract of the rat. Toxicol Appi Pharmacol 121:253-263. Kozumbo WJ, Hanley NM. Agarwal S, Thomas M J, Madden MC (1996): Products of ozoniz˘d amchidonic acid potentiate the for- marion of DNA single strand breaks in cultured human lung cells. Environ Mol Mutagen 27:185-195. Lancillord F, Darwiche N, Celli G, EM Luca LM (1992): Retinoid status and the control of k˘ratin expression and adhesion during histo- genesis of squamous metaplasia of tracheal epithelium. Cancer Res 52:6144-6152. Lee JG, Madden MC, Hatch GE, Bottei G, Reed W, Adler K.B. Devlin RB (1995): Ozone exposure in rive induces increases in DNA single strand breaks in human and guinea pig lung cells. Am J Respir Crit Car~ Med 151:A498. Lippman M (1993): Health effects of trophospheric ozone: Review of recent research findings and their implications to ambient air quality standards. J Exp Anal Environ Epidemiol 3:103-129. Madden MC, Friedman M, Hanley N, Siegler E, Quay L Becket S, Devlin RB. Koren HS (1993): Chemical nature and immunotoxi- cologlcal properties of arachidonic acid degradation products formed by exposure to ozone. Environ Health Perspect 101:154- 164. McDonald PJ, Ducore JM (1993): Hydrogen peroxide induces DNA single strand breaks in respiratory epithelial cells. Inflammation 17:715-722. Monticello TM, Morgan KT ( 1995): Nasal lesion distribution and toxic- ity in the squamous epithelial re#on. In Miller FJ (ed): "'Nasal Toxicity and Dosimetry of Inhaled Xenobiotics." Washington. DC: Taylor and Francis, pp 177-186. Morgan KT, Monticello TM ( [990): Airflow, gas deposition, and lesion distribution in the nasal passages. Environ Health Perspect 83:209-218. Morgan KT, Jiang XZ, Start TB, Kerns WD (1986): More precise localization of nasal tumors associated with chronic exposure of F-344 rats to formaldehyde gas. Toxicol Appl Pharmacol 82:264-271. Morris JB, Clay R.I, Cavanagh DH (1986): Sp~ies differences in upper respiratory tract deposition of acetone and ethanol vapors. Fun- dam Appl Toxicol 7:671-680. Nelson WG Kastan MB ( 1994): DNA strand breaks: The DNA template alterations that trigger p-53 dependent DNA damage response pathways. Mol Cell Biol 14.:1815-1823. Pine MV, Levin JR. Stovall MY. Hyde DM (1992): Pulmonary inflam- mation and epithelial injury in response to acute ozone exposure in the rat. Toxicol Appl Pharmacol 112:64-72 Pryor WA (1994): Mechanisms of radical formation from reaction to ozone with target molecules in the tung. Free Radicals Biol Med 17:451-465. Reuzel PG, Wilmer JGM, Woutersen RA, Zwart A, Rombout PJA, Fen'on VJ (1990~: Interactive effects of ozone and formaldehyde on the nasal respiratory lining epithelium in rats. J Toxicol Envi- ron Health 29:279-292. Singh NP, McCoy MT, Tice RR. Schneider EL (1988): A simple tech- nique for the quantitation of low levels of DNA damage in indi- vidual cells. Exp Cell Res 175:184-191. Stockstill BL, Chang LY, Menache MG. Mellick PW, Mercer RR, Crape JD (1995): Bronchiolarized metaplasia and interstitial fibrosis in rat lungs chronically exposed to high ambient levels of ozone. Toxicol Appl Pharmacol 134:251-263. Tepper JS, Costa DL. Lehmann JR, Weber MF, Hatch GE (1989): Unattenuated structural and biochemical alterations in the rat
Page 135: 2063633620 Log in for more options!
20 Calder6n-Garciduefias et ai. lung during functional adaptation to oz~ue. Am Rev Respir Dis 140:493-501. Tice RR (I 995): The single cell gel/comet assay: A microgel electropho- retie technique for the detection of DNA damage and repa/r in individual cells. In Phillip DH, Venitt S (eds): "Environmental Mutagenesis.'" Oxford, UK: Bios Scientific Publishers, pp 315- 337. Victorin K (1992): Review of the genotoxicity of ozone. Murat Res 277:221-238. Ward A J, Olive PL, Burr AEI, Rosin MP (1993): A sensitivity to oxida- tive stress is linked to chromosome t 1 but is not due m a differ- ence in single strand DNA breakage or repair. MutatRes 294:299-308. Wolf DC, Morgan KT, Gross EA, Barrow C, Moss OIL James Popp JA (1995): Two-year inhalation exposure of female and male B6C3F1 mice and F-364 rats to chlorine gas induces lesions confined to the nose. Fundam App| Toxicol 24: l 1 I-131. Yarborough A. Zhang YJ, Hsu TM, Santella RM (1996): Immunoperox- idase detection of 8-hydroxydeoxyguanosine in aflatoxin l- treated mt liver and human oral mucosal ceils. Cancer Res 56:683-688. Zhnang Z, Vortmeyer AO, Mark EI, Odze IL Enunert-Buck MR, Merino MI, Moon H, Liotta LA, Duray PH (1996): Barrett's esophagus: Metaplastic cells with loss of heterozygocity at the APC geue locus are clonal precursors to invasive adenocarcinoma. Cancer Res 56:1961-1964. Accepted E. Zeiger
Page 136: 2063633621 Log in for more options!
2063633621
Page 137: 2063633622 Log in for more options!
Pergamon Environment International, Vol. 22, Suppl. 1, pp. $917-$925, 1996 Copyright O1996 Elsevier Science Lid Printed in the USA. All rights reserved 0160-4120/96 $15.00+.00 PII S0160-4120(96)00202-4 CO-CARCINOGENIC EFFECTS OF VARIOUS AGENTS INRATS FOLLOWING EXPOSURE TO RADON AND RADON DAUGHTERS G. Monchaux, J.P. Mortier, P. Fdtsch, P. Rochefort, E. Douriez, M. Morin, and R. Maximilien Commissariat ~ l'Energie Atorriique, Direction des Sciences du Vivant, D6partement de Radiobiologie et Radiopathologie, Laboratoire de Canc~rologie Exp6dmentale, 92265, Fontenay aux Roses Cedex, France E19512-403 M (Received 5 December 1995; accepted 23 June 1996) Combined exposure to radon and to various occupational or environmental airborne pollutants may lead to synergistic effects for lung cancer induction. Experimentally, a co-carcinogenic effect results in increased tumour incidence after combined administration of the potential carcinogens. This paper is a review based on a standardized l~rotocol developed to identify potential co-carcinogenic agents, using an in vivo model in rats. Rats were exposed to 3.6 J h m"3 (1000 WLM) of radon, followed by exposure to the agent to be studied. Different types of compounds were studied, inotuding chemicals, mineral particles and fibres, and diesel exhaust particulates. The greatest synergistic effects were observed after administration of chemical compounds known to be cytochrome P-450 1A1 inducers which are metabolized to mutagenic or non-mutagenic forms. The results observed after treatment by cytochrome P-450 1A 1 inducers indicated that radon exposure seems to specifically increase early proliferation of target cells during the co-carcinogenic process. Combined exposure to radon and tobacco smoke resulted in a multipticative synergistic effect. For the same cumulative radon exposure, the incidence of lung carcinomas increased with the cumulative exposure to tobacco smoke, lntrapleural injection of various mineral fibres following exposure to radon resulted only in an additive co-carcinogenic effect, whereas intratracheal instillation of different minerals associated with metallic mine ores did not result in significant synergistic effects. Under the experimental conditions used, no synergistic effect was observed after combined exposure to radon and diesel exhaust. Copyright 1~1996 Elsevier Science Ltd INTRODUCTION Combined exposure to radon and its progeny and various occupational or environmental airborne pollu- tants may lead to synergistic effects for lung cancer induction. In humans, an increased incidence ofpulmo- nary neoplasia has been observed in different groups exposed to radon and its daughters. These include uranium miners (Archer et al. 1973; Sevc et al. 1976; Howe et al. 1986; Samet et al. 1989, 1991), iron miners (Pham et al. 1983; Jorgensen 1984; Radford and Renard St. Clair 1984), and other miners (Fox et al. 1981; Solli et al. 1985), especially cigarette smokers ( Edling 1982; Saccomanno et al. 1988), suggesting that co-carcino- genic mechanisms may be involved in the Pathogenesis of lung cancer. In laboratory animals, a co-carcinogenic effect results in increased tumour rates after combined administration of the potential carcinogens (Berenblum 1969). A standardized protocol was developed in Sprague-Dawley rats to identify potential co-carcino- genic agents. In dais, rats are exposed to 3.6 J h m-3 (I000 WLM) of radon followed by exposure to the agent to be studied (Monchaux et al. 1994a). All the experiments reported here were lifespan studies in which, after exposure, rats were allowed to live until they died or were moribund and then killdd. In these $917
Page 138: 2063633623 Log in for more options!
$918 experiments, rats were exposed at a potential alpha energy concentration (PAEC) of 25 mJ m"3 (1202 WL), 5 h/d, 4 d/week for a total exposure of 142 h over 7 weeks, resulting in a cumulative exposure of about 3.61 J h m"3 (1004 WLM) rbunded to. 3.6 .J h m"3 (1000 WLM). Exposure to 3.6 J h m"3 .(1000 WLM) of radon alone results in a lung cancer incidence of 20%. About 30% of the tumours are squamous cell carcinoma, 50% adeno- carcinoma, and 20% bronchioloalveolar carcinoma. The latency period is about 700 d. An increase in lung cancer incidence has been reported in rats exposed first to radon and its daughters and then to tobacco smoke (Chameaud et al. 1974; Cross et al. 1991). The effects of combined exposure to radon and tobacco smoke, and the effects of combined exposure to radon and various cytochrome P- 450 inducers are reviewed, based on the hypothesis that polycyelie hydrocarbons are involved.in the carcinogenic activity of several compounds. Moreover, as combined exposure to various carcinogens is common in some mining or industrial environments, the potential co- carcinogenic effects of environmental or industrial air- borne pollutants such as mineral fibres, diesel exhausts, or minerals associated with metallic mine ores in rats in combination with radon exposure are reviewed. COMBINED EFFECTS OF RADON AND OTHER AIRBORNE POLLUTANTS Combined exposure to radon and tobacco smoke The first experiments were carried out to investigate the effects of inhalation of radon and its daughters at various cumulative doses, before or after various passive exposures to tobacco smoke (Chameaud et al. 1982), using cigarettes with and without filters. For tobacco smoke exposures, the CO concentration within the inhalation chambers was about 40-50 ~tL L"I. For a 3.6 J h m-3 (I000 WLM) radon exposure, the incidence of lung carcinomas was slightly lower in rats exposed to tobacco smoke before radon exposure than in rats exposed to radon alone (Table 1), but the distribution of the different histological types of tumours were similar in the two groups. In contrast, a highly significant excess of lung carcinomas (P = 0.0014, Fisher's exact test), mainly of the squamous cell type, was observed in the group exposed to tobacco smoke after radon exposure. In this group, the incidence of lung carcinomas was almost four times greater than in the group exposed to radon alone. The results of further studies in which rats were exposed to cigarette smoke following exposure to radon are summarized in Table 2. For a 350-h exposure to passive tobacco smoke, the incidence of lung carcino- mas increased with the cumulative dose of radon. TI~ incidence of lung carcinomas was twice as high in the" group exposed to 5.76 J h m"3 (1600 WLM) of radon and tobacco smoke for 350 h than in the exposed to radon at 5.76 J h m"3 (1600 WLM) and was statistically significant (P = 0.0003, exact test). For a cumulative dose of radon and its daughters corresponding to 5.76 J h m3 (1600 WLM), the inci- dence of lung carcinomas increased with the cumulative exposure to tobacco smoke. The synergistic effect of combined exposure to radon and tobacco smoke decreased when the cumulative exposure to tobacco smoke decreased. Differences between rats exposed to 1000 WLM only and the groups exposed to radon at 5.76 J h m3 (1600 WLM) and to tobacco smoke for • 60 h or 100 h were not statistically significant, butthere Was a marginally significant difference between the group e:~posed to 5.76 J h m"3 (1600 WLM) of radon and tobacco smoke for 30 h compared with the group exposed to radon at 5.76 J h m"3 ( 1600 WLM) only, (P = 0.0557, Fisher's exact test). ,.~ The induction of lung carcinomas ~vas less efficient in rats exposed to tobacco smoke produced by filter cigarettes than in those exposed to cigarettes without filters. The incidence of lung carcinomas was higher (Fig. I), but not statistically significant in the groups exposed to radon and tobacco smoke combined than in the group exposed to radon alone. The proportion of o~ lung carcinomas was lower in the group exposed to filter cigarettes than in the group exposed to unfiltered cigarettes. In the group exposed to radon and filter cigarettes, adenocarcinomas were the commonest type oftumour and the incidence of this type of tumour was similar to that observed in the group exposed to radon only. The increased incidence of lung carcinomas in the group exposed to radon and non-filter cigarettes was ' mainly accounted for by an increased incidence of squamous cell carcinomas. Thes.e findings suggested a stronger synergistic effect of radon and non-filter cigar- ettes compared to that of radon and filter cigarettes. In rats exposed to radon and tobacco sffioke combined, for the same radon exposure, the incidence of lung carcinomas was greatly increased in the group exposed to radon and tobacco smoke compared ~vith the group exposed to radon only. Tumours observed in the groups exposed to radon and tobacco smoke were larger and more invasive than in the groups exposed to radon alone. These tumours also spread more to the pleura and the presence of intrapulmonary metastases or of multiple tumours in the lung was observed. For the same radon :~/..
Page 139: 2063633624 Log in for more options!
t, Co-carcinogenic effects of various agents in rats $919 Table 1. Incidence of the different histological types of lung carcinoma in rats exposed to tobacco smoke before and after radon exposure. Number of rats Proportion Squamous Bronehiolo Adeno with lung (%) of lung cell alveolar carcinomas carcinomas carcinomas carcinomas carcinomas Tobacco smoke'(350 h) 8 16 3 1 4 before radon 3.6 J h m"3 (~ 000 WLM) " Radon 3.6 J h m"3 I 1 22 3 1 7 (1000 WLM) only Tobacco smoke (350 h) 39 78 30 3 7 after Radon 3.6 2 h m"3 (I 000 WLM) Table 2. Incidence of lung carcinomas after combined exposure to radon and tobacco smoke according to the cumulative dose of radon and progeny and to the cumulative exposure to tobacco smoke. Number Number Proportion of rats of lung (%) of lung carcinomas carcinomas Radon only (40 WLM) 21 Tobacco smoke (350 h) 27 after radon (40 WLM) 5 3.5 Radon only (200 WLM) 63 Tobacco smoke (350 h) 75 after radon (200 WLM) Radon only (1600 WLM) 208 7 I1 16 21 81 39 Tobacco smoke (350 h) after radon (1600 WLM) 138 106 77 Tobacco smoke (100 h) after radon (1600 WLM) 35 II 32 Tobacco smoke (60 h) after radon (1600 WLM) Tobacco smoke (30 h) after radon (1600 WLM) 64 19 30 35 1 3 eXposure, the mean latent period for lung carcinomas was shorter in the group exposed to radon and then to tobacco smoke compared with the group exposed to radon alone (e.g., 682 d and 748 d, respectively, at 200 WLM radon exposure). For an identical tobacco .~oke exposure of 350 h, the mean latency period was ~nVersely related to the cumulative radon dose (e.g., .600 d in the 5.76 J h m-3 (1600 WLM) group and 682 d t~ the 0.72 J h m3 (200 WLM) group). All these results sho:ved a clear co-carcinogenic effect of exposure to radon and radon daughters and tobacco smoke in rats. Combined exposure to radon and various CYP 1A1 inducers In Sprague-Dawley rats exposed to radon at 3.6 J h m"3 (I000 WLM), about 30% of radon-induced lung carol-
Page 140: 2063633625 Log in for more options!
$920 G. Monchaux et al. 100" 80' 60' 40' I~ Squamous ccll c:~rcinomas [] Adcnocan:inomas [] Bronchioloalwolar ca~inomas [] All lung carcinomas 20' 1: radon 1600 WLM, 2: radon 1600 WLM + rig. with filters, 3: radon 1600 WLM + rig. without filters . Fig. 1. Histologic types of lung carcinomas after exposure to radon and tobacco smoke produced by filtered and unfiltered cigarettes. nomas are of the squamous cell type (Chameaud et al. 1984; Poncy et al. 1993; Morin et al. 1994). This proportion rose to 75% in rats exposed first to radon and then to tobacco smoke (Table 1). It has also been demonstrated that lung carcinomas, mostly of the squamous tell. type, can be induced in laboratory animals after either a single or repeated treatments with different chemical compounds (Hirano et al. 1974; Witschi et al, 1977; Cross et al. 1985; Gray et al. 1986; Gies et al. 1987; Archer 1989). An experimental model of co-carcinogenesis was developed, based on the hypothesis that polycyclic hydrocarbons are involved in the carcinogenic activity of several agents. Among tobacco smoke components, polycyclie aro- matic hydrocarbons (PAH) are metabolized to carcino- • genie substances by the cytochrome P-450 multigenic enzyme family (Queval et al. 1979). The metabolites generated by cytochrome P-450 1A1 (CYP 1A1) for most PAH are about 100-fold more mutagenic than those generated by the other P-450 enzymes. The aim of this study was to characterize the role of chemicals known to be cytochrome P-450 1A1 inducers and which are metabolized to mutagenic or non-mutagenic com- pounds, after exposure to radon and its decay products. The results were compared with those observed after combined exposure to radon and tobacco smoke. Rats were first exposed to radon and its daughters by inhalation at a cumulative exposure of about 3.6 J h m"3 (1000 WLM), and then treated by different CYP 450 IA1 inducers. These included methylcholanthrene (MC) which is metabolized to strong mutagenic compounds, 5,6 benzoflavone (,13NF) which is metabolized to a non-
Page 141: 2063633626 Log in for more options!
a.carcinogcnic ~ffects of various agents in rats $921 lutagenic compound and 2,3,7,8-tetrachlorodibenzo-p- .ioxin (TCDD) which is not metabolized and con- idered to be non-mutagenic. The same radon exposure protocol was used through- ~ut and eight groups .of experimental animals were .tistributed as follows: Group 1 was exposed to radon 8 h a day, 5 d a week for 4 ~,eeks so that the cumulative exposure was in the range of 3.6 J h m"3 (1000 WLM). Groups 2; 3, and 4 were given respectively 6 intra- muscular injections at formightly intervals of either [3NF (25 mg/kg), MC (25 mg/kg), or TCDD (1.34 ~tg/kg) dissolved in 2 mL of corn oil. Groups 5, 6, and 7 were exposed first.to radon in the same way as Group 1 and one month after the end of radon exposure were treated as Groups 2, 3, and 4, respectively. Group 8 comprised unexposed control animals. The results of lung carcinogenic and co-carcinogenic effects of the different CYP 1A1 inducers in Sprague- Dawley rats are summarized in Table 3. For the dif- ferent CYP 1 A1 inducers administered alone, there was a decreasing carcinogenic effect through MC to 13NF and TCDD. After radon exposure, each CYP 1A1 in- ducer was shown to have a clear co-carcinogenic effect. All the lesions induced were of the squamous cell type, irrespective of whether the inducer was meta- bolized into mutagenic or non-mutagenic compounds or not. The latent periods for squamous cell lesions in- duction ~vere short, i.e., less than 100 d for MC and [3NF, but longer, about 200 d, for TCDD. Biochemical studies based on the ethoxy resorufineO- de-ethylase (EROD) enzymatic activities associated with CYP 1A 1, showed that one month after the end of chemical treatment, a similar induction of CYP IA1 xvas observed in the lungs of all treated groups whether or not the rats were exposed to radon. This induction was about 30 to 40 fold greater than in controls. The EROD activity measured in rats exposed to radon alone was identical to that of controls. Thus, the role of radon in the carcinogenic process did not appear to involve specific changes in CYP IA1 ihduction. Histopathological analysis showed that lung squa- raous cell nodules and/or lung squamous cell carcino- mas occurred in the animals exposed to radon and the different CYP 1A1 inducers. The latency period for the induction ofsquamous cell lesions varied according to the inducer. In MC or I3NF treated rats, such lesions were observed systematically one month after the end of treatment whereas in the TCCD group, they were observed about three months later. In contrast, in animals not exposed to radon, such lesions were observed only in the MC-treated group. The early lesions consisted of hyperplastic areas of bronchiolar- type cells in the alveolar region which originated near the respiratory bronehioles and expressed CYP 1A1 from the beginning of the treatment. Metaplastic squa- mous cells arose from bronchiolar-type cell hyper- plasia and were gradually transformed into poorly- differentiated squamous cell nodules, squamous papil- lomas and ultimately squamous cell carcinomas (Poncy et al. 1993). The expression of CYP IA1 disappeared concomitantly with the development of squamous cell metaplasia. Thus, in this experimental model, the ex- pression of CYP 1AI in target cells appears to be restricted to the first stages of the co-carcinogenic pro- cess (Douriez et al. 1994), but neoplastic lesions ap- peared to be derived directly from the squamous cell nodules. These results could be in agreement with a specific co-carcinogenic effect in relation to the metabolism of endogenous compounds by CYP 1AI which could be initiated by metabolit~s formed during the catabolism of xdhobiotic inducers. Among these endogenous com- pounds, retinoic acid could be involved. A decreased lung concentration of retinoic acid has been reported after benzo-(a)-pyrene administration and an increased retinoic acid metabolism was observed in epidermal microsomes of MC-treated rats (Van Den Bossche et al. 1991). It has also been shown that depletion of vitamin A stimulates cell proliferation, induces squa- mous cell differentiation, and increases susceptibility to the development of chemically-induced lung cancers (Nettesheim et al. 1979; Chytil 1992). Additional studies are still in pro~ess to determine whether cyto- chrome P-450 1.A1 induction is a primary step in the aetiolog2˘ ofsquamous cell carcinoma. However, such a two-stage model of lung c~ircinoma seems to be restricted to the Sprague-Dawley strain, since it has not been possible to reproduce it in other strains of rats in which severe lung vasculitis, pleural exudate, and fatal heart failure were frequently observed after treatment by [3NF (Masse et al. 1992). Combined exposure to radon and mineral fibres The experimental protocol described above was also used to study the potential co-carcinogenic effects of radon and mineral fibres. Acid leached chrysotile fibres were shown to exhibit less carcinogenic activity in vivo than untreated fibres (Morgan et al. 1977; Monchaux et al. 1981). Since mesothelial cells are considered to be the target cells for the induction oftumours by mineral fibres, this experiment was designed to investigate the
Page 142: 2063633627 Log in for more options!
$922 G. Monchaux et al. potential synergistic action of different kinds of un- leached or acid leached asbestos fib~'es and other mineral dusts injected into the pleural cavity of rats after previous inhalation of radon and its daughters (Bignon et al. 1983). In these experiments, 60 rats exposed to 10.8 J h m"3 (3000 WLM) of radon were used as controls. Ten groups of 10 rats each were exposed tO the same dose of radon and then, 2 weeks later were injected intra- pleurally with 2 mg of mineral dust, unleached or • leached asbestos fibres, glass fibres, and two varieties of quartz. No rats were exposed to mineral fibres alone. The results of this study were compared with those of previous experiments in which rats were inoculated intrapleurally with various doses of asbestos and other mineral fibres (Wagner et al. 1973; Monchaux et al. 1981). In the 157 rats examined microscopically, 83 malig- nant thoracic tumours were observed. Of the 60 control rats, 17 (28%) developed tumours, and 66 out of 97 (68%) in the group given an intrapleural inject!on of mineral dust. These tumours were classified either as lung carcinomas or pleural tumours. Lung carcinomas were differentiated into squamous cell carcinoma, bronchi01o-alveolar carcinoma, and adenocarcinoma. Some tumours displayed the characteristics of squamous cell carcinoma and adenocarcinoma and were classified as mixed pattern. Pleural tumours were differentiated into typical mesothelioma and combined pulmonary pleural tumours. The latter consisted of lung tumours, of the squam0us cell, bronchiolo-alveolar, or adenocarci- noma type which also exhibited a mesothelial pattern when they spread to the serosal surface of the pleura. Primary tumours of the pleura could not be distin- guished from an extension to the pleura of a pulmonary tumour which mimics the histological pattern of a mesothelioma. Lung carcinomas, mainly of the squamous cell and bronchiolo-alveolar types, occurred in all groups. No pleural tumours were observed in rats which inhaled radon only. Typical mesotheliomata only occurred in the group of rats injected with asbestos fibres, whereas combined pulmonary pleural tumours were observed in rats injected with the different mineral fibres (leached or unleached asbestos and glass fibres), and with the two varieties of quartz. The proportion of lung cancer increased from 28% in rats which inhaled radon only, to 68% in those given an intrapleural injection of mineral dust after radon in- halation, demonstrating the synergistic effect of this type of insult. The carcinogenicity of asbestos at the level of the pleura was amplified when intrapleural inoculations of dusts were given after the previous inhalation of radon and its daughters. In the groups exposed to radon and mineral fibres combined, espeeial'ly in the group ex- posed to radon and. chrysotile fibres, tumours were almost eyenly distributed between bronchoPuimonary carcinomas (2/6), combined pulmonary pleural tumours (2/6), and pleural mesotheliomas (2/6). Thus, combined exposure to radon and mineral fibres resulted in an additive co-carcinogenic effect, showing that roughly one third of lung carcinomas could be related to radon exposure, about one third of typical pleural meso- thelioma could be related to fibre exposure, and another third of combined pulmonary pleural tumours could be related to the combined effect of radon and mineral dusts at the level of the pleura. Combined exposure to radon and minerals from metallic.mine ores The potential carcinogenic or co-carcinogenic role of four minerals present in the ores of metallic mines was also investigated. These included nemalite (a contami- nant of Quebec chrysotile), biotite (present in many granites and in the French uranium ore), iron pyrites (present in various iron and gold ores), and finally iron- rich chlorite (present in iron, tungsten, and gold ores). The effects of these minerals were studied in rats (Monchaux et al. 1994b), either alone or following radon exposure, in relation to the potential combined exposure for workers in some of these mines. The iron pyrite used was prepared by air ageing of the powder. Five groups of 30 rats were each given 4 intratracheal instillations of 10 mg mineral dust, suspended in phos- phate buffered saline (PBS). Five other groups of rats were given 4 intratracheal injections of the same mineral dusts, one month after the end of a 3..6 J h m-3 (I 000 WLM) radon exposure. In control rats, instilled with PBS buffer alone, 2 lung carcinomas were ob- served, a squamous cell carcinoma and an adenocarci- noma. Iri the groups treated by mineral dust alone, the only lung carcinomas observed were a squamous-cell carcinoma in the group treated with air-~iged iron pyrites and an adenocarcinoma in the group treated with chlorite. In the group exposed to radon and PBS buffer, 9 lung carcinomas were observed among 5 rats. In the groups treated by mineral dusts after previous radon inhalation exposure, lung carcinomas and one pleural mesothelioma were observed. A slight nonsignificant increase in the incidence of lung carcinomas was observed in rats exposed to both radon and minerals,
Page 143: 2063633628 Log in for more options!
Co.carcinogenic effects ofvarious agents in rats $923 especially, nemalite, air-aged iron pyrites, and chlorite, compared to rats exposed to radon and PBS buffer. The occurrence of a pleural mesothelioma in the group exposed to biotite might be related to a specific carcinogenic effect of mineral dust at the level of the pleura. In the groups injected with mineral dusts after radon exposure, the lung carcinomas were mostly large and more invasive compared to those observed in the group treated by radon'and PBS buffer. There were also more tumors which had spread to the pleura, and more intrapulmonary metastases or multiple lung tumours in the group exposed to both radon and mineral dusts than in the group exposed to radon and PBS buffer. These results, as those previously reported with cro- cidolite asbestos administered by inhalation (Wagner et al. 1974; 1994), demonstrate neither a clear carcino- genic effec~ of the minerals from metallic mine ores insiilled intratracheally, nor a strong co-carcinogenic effect of these minerals after previou~ radon exposure. Combined exposure to radon and diesel exhausts The use of diesel-powered vehicles is steadily in- creasing worldwide. Among the numerous epidemio- logical studies on diesel-exhaust exposed populations, only two, a case control study (Garschik et al. 1987) and a retrospective cohort study in railroad workers (Garschik et al. 1988), showed a significant association between diesel exhaust inhalation and lung cancer, suggesting that occupational exposure to diesel exhausts results in a small but significant excess risk of lung cancer. Experimentally, some evidence of a carcino- genic effect has been previously reported in rats after exposure to diesel exhaust dontaining high concentra- tions of diesel soot particles for periods of up to 2 y (Heinrich et al. 1986; Mauderty et al. 1987; Brightwell et al. 1989). The potential synergistic effects of diesel exhaust were investigated in rats after previous exposure to radon and radon daughters (Monchaux et al. 1994c). Three groups of 50 rats each were used. Group 1 was exposed to radon alone; Group 2 was first exposed to radon, and one month after the end of radon inhalation, to diesel exhaust; and Group 3 was exposed to diesel exhaust only. Rats were exposed to radon and its decay products to give a cumulative dose of 3.6 J h m"3 (I000 WLM). Diesel exhaust exposure was performed at high concentrations, but for limited periods to allow com- parison with experiments in which rats were first ex- posed to radon and then to tobacco smoke. Thus, rats were exposed to the exhaust produced by a diesel- powered engine vehicle used in the Raz6s uranium mines for 5 h a day, 5 d a week, for 3 months (300 h). The CO concentration was adjusted to 20-25 gL L"1 (20-25 ppm) and the diesel particle burden, to 4-5 mg Histopathologie analysis of the 3 groups of 50 rats revealed a total of 28 malignant thoracic tumours in 25 animals. These tumours were differentiated into lung carcinomas (squamous cell carcinoma, bronchiolo- alveolar carcinoma, and adenocarcinoma) and pleural mesothelioma. The incidence of each histological type of tumour in the different groups of exposed rats showed that lung carcinomas occurred in all groups, but only one pleural mesothelioma with a fibrosarcomatous pattern was observed in the group exposed to both radon and diesel exhausts. A slight, but nonsignificant in- crease in the incidence of thoracic tumours was ob- served in rats after combined exposure to radon and diesel exhaust compared to rats exposed to radon alone. The proportion of rats with thoracic tumours rose from 20% in the group which ifihaled radon only, to 28% in the group exposed to radon and diesel exhausts combined. There was only one pleural mesothelioma in the latter group. The proportion of rats with lung carcinomas was 20% in the group exposed to radon alone, and 26% in the group exposed to radon and diesel exhausts combined. However, the number of lung carcinomas was identical in both groups: t3 lung carcinomas among 10 of the rats in the group exposed to radon alone, and 13 among 13 of the rats in the group exposed to radon and diesel exhaust. These results showed that exposure to diesel exhaust only did not increase the incidence of lung cancer in rats. Combined exposure to radon and diesel exhausts induced a nonsignificant increase in the incidence of lung carcinomas compared to exposure to radon alone. Thus, it does not appear that inhalation of diesel exhaust either alone, or after previous radon inhalation, has a clear carcinogenic or co-carcinogenic effect. CONCLUSION These results demonstrate the potential co-carcino- genic action of various environmental or industrial airborne pollutants combined with radon exposure, showing either a multiplicative, an additive, or a nul effect. The strongest co-carcinogenic effect was shown by combined exposure first to radon and then to t~bacco smoke, which resulted in an increased incidence of lung carcinomas, mainly of the squamous cell type. For the same cumulative radon exposure, the incidence of lung
Page 144: 2063633629 Log in for more options!
$924 carcinomas increased with the cumulative exposure to tobacco smoke. The use of filter cigarettes only modi- fied the distribution of histological tumour types. In the group exposed to radon and filtered cigarettes, adeno- canzinomas prevailed but the proportion of this type of turnout was similar to that observed in rats exposed to radon alone. In rats exposed to radon and unfiltered cigarettes, the increased incidence of lung carcinomas was due mainly to an increase in the squamous type cell carcinoma. These results showed a trend toward a preferential differentiation to the squamous cell type in lung carcinomas induced in rats by combined exposure to radon and industrial or environmental airborne pol- lutants. The results observed after treatment by cyto- chrome P-450 IA1 inducers indicated that radon ex- posure increases specifically the early proliferation o,˘ target cells during the co-carcinogenio process. They suggest that expression ofCYP 1AI in some particular cell types could be an early stage ofa co-carcfnogenic process induced after local pulmonary irradiation by radon and its daughters. These also indicated the possible application of this 'radon model' to the in- vestigation of possible interactions between exposure to two occupational and/or environmental pollutants. This experimental model for risk assessment is important be- cause human industrial occupational or environmental exposures are nearly atway.s not single but multiple. Acknowledgment--This study was supported in part by the Commission of the European Communities (Contract FI3P.CT920042). REFERENCES Archer, V.E.; Wagoner, J.K.; Lundin, F.E. Lung cancer among ura- nium miners in the United States• Health Phys. 25:351-371; 1973• Archer, V.E. Comment on "A histologic study of the influence of - cigarette smoking in suppressing Rn daughters carcinogenesis in dogs". Health Phys. 56: 255; 1989. Berenblum, I. A re-evaluation of the concept of cocarcinogenesis. In: Hamburger, F., ed. Progress in experimental tumor research. Vol. 11. New York: S. Karger; 1969: 21-30. Bignon, J.; Monchaux, G.; Chameaud, J.; Jhurand, M.C.; Lafuma, J.; Masse, R. Incidence of various types of thoracic malignancy induced in rats by intrapleural injection of 2 mg of various mineral dtrsts after inhalation of 222 Rn. Carcinogenesis 4:621 628; 1983• Brightwell, J.; Fouillet, X.; Cassano-Zoppi, A.L.; Bernstein, D.; Crawley, F.; Duchosal, F.; Gatz, R.; Perczel, S.; Pfei(er, H. Tumors of the respiratory tract in rats and hamsters following chronic inhalation of diesel engine exhaust emissions. J. Appl. Toxicol. 9: 23-32; 1989. Chameaud, J.; Permud, R.; Lafuma, J.; Masse, R.; Pradel, J. Lesions and tung cancers induced in rats by inhaled radon 222 at various equilibrium with radon daughters. In: Karde, E.; Park, J., eds. Experimental lung cancer. Carcinogenesis and bioassays. Berlin, Heidelberg, New York: Springer-Verlag; 1974:411-421. G. Monchauxet~. Chameaud, J.; Pcrraud, R.; Chretien, J.; Masse, R.; Lafuma, J. Lung carcinogenesis during in vivo cigarette smoking and radon daughters exposure in rats. In: Recent results in cancer rese .aa:h. Voi. 82. Berlin-Heidelberg: Springer-Vertag; 1982:11-20. Chameaud, J.; Masse, R.; Lafuma, J. Influence of radon daughter exposure at low doses on occurence of lung cancer in rat~ Radiat. Prot. Dosim. 7: 385-388; 1984• Cross, F.T.; Palmer, R.F.; Filipy, R.E.; Dagle, G.E.; Stuart, B.O. Carcinogenic effects of radon daughters, uranium ore dust and cigarette smoke in beagle dogs. Health Phys. 42: 33-51; 1982. Cross, F.T.; Buschbom, R.L.; Dagle, G.E.; Gideon, K.M.; Gies, R.A.; Gilbert, E.S. Inhalation hazards to uranium miners. In: Pacific Northwest Laboratory annual report for 1990 to the DOE Office of Energy Research. Part I: Biomedical sciences. Richland, WA: 1991: 99352. Chytii, F. The lungs and vitamin A. Am. J. Physiol. 262: 517-527; 1992. Douriez, E.; Kermanac'ho P.; Fritsch, P.; Bisson, M.; Mortier, J.P.; Monchaux, G.; Morin, M.; Laurcnt, P. Cocarcinogenic effect of ˘ytochrome P-450 1A1 inducers for epidermoid lung tumour induction in rats previously exposed to radon. Radial Prot. Dosim. 56: 105-108; 1994. Edling, C. Lung cancer and smoking in a group of iron ore miners. Am. J. lndustr. Med. 3: 191-199; 1982. Fox, A.J.; Goldblatt, P.; Kinlen, L.J. A study of the mortality of Cornish tin miners. Br..i'. Ind. Med. 38: 378-380; 1981. Garschik, E.; Schenker, M.B.; Munoz, A.; Segal, M.; Smith, T.J.; Woskie, S.R.; Hammond, S.K.; Speizer, F.E. A case-control study of lung cancer and diesel exhaust exposure in railroad workers. Am. Rev. Respir. Dis. 135: 1242-1248; 1987. Garschik, E.: Schenker, M.B.; Munoz, A.; Segal, M.; Smith, T.J.; Woskie, S.R.; Hammond, S.K.; Speizer, F.E. A retrospective cohort study of lung cancer and diesel exhaust exposure in railroad workers. Am. Rev. Respir. Dis. 137: 820-825; 1988. Gies, R.A.; Cross, F.T.; Dagle, G.E. A histologic study of the influence of cigarette smoking in suppressing Rn daughters carcinogenesis in dogs. Health Phys. 53: 527-529; 1987. Gray, R.G.; Lafuma, J.; Parish, S.E.; Peto, R. Lung tumors and radon inhalation in over 2000 rats: Al~roximate lir.e~ity across a wide range of doses and potentiation by tobacco smoke. In: Thompson, R.C.; Mahaffey, J.A., eds. Life-span radiation effects studies in animals: What can they tell us? Office of Scientific and Technical Information, United States Department of EnergT; 1986: 592-607. Gross, P.; Tolker, E.; Babyak, M.A.; Kaschak, M. Experimental lung cancer in hamsters. Arch. Environ. Health I I : 59-65; 1985. Heinrich, U.; Muhle, H.; Takenaka, S.; Ernst, H.; Fuhst, R.; Mohr, U.; Port, F.; St0ber, W. Chronic effects on the respiratory, tract of hamsters, mice and rats after long-term animal inhalation of hi'gh concentrations of filtered and unfiltered diesel engine emissions. J. Appl. Toxicol. 6: 383-395; 1986. " Hirano, T.; Stanton, M.; Layard, M. Measurement of epidermoid carcinoma development induced in the lung of rats by 3- methylcholanthrene-containing beeswax pellets. J. Nat. Cancer Inst. 53: 1209-1219; 1974. Howe, G.IL; Nair, R.C.; Newcombe, H.B.; Hiller, A.B.; Abbat, .I.D. Lung cancer mortality (1950-80) in relation to radon daughter exposure in a cohort of workers at the Eldorado Beaverlodge uranium mine. J. Nat. Cancer Inst. 77: 357-362; 1986. Jorgensen, H.S. Lung cancer among underground workers in the iron ore mines of Kiruna based on thirty, years of observation. Ann. Acad. Med. 13(suppl.): 371-377; 1984.
Page 145: 2063633630 Log in for more options!
Co-carcinogenic effects of various agents in rats $925 Masse, R.; Morlier, J.P.; Morin, M.; Chameaud, J.; Lafuma, J. Animals exposed to radon. Radiat. Prot. Dosim. 45: 603-610; 1992. Mauderly, J.L.; Jones, R.K.: Griffith, W.C.; Henderson, R.F.; McClellan, R.O. Diesel exhaust is a pulmonary carcinogen in rats exposed chronically by inhalation. Fundam. Appl. Toxicol. 9: 208-221; 1987. Monchaux, .G,; Bignon, J.: Jaurand, M.C.; Lafuma, J.: S~bastien, P.; Masse, R.; Hirsch, A.; Goni, J. Mesotheliomas in rats following inoculation with acid-leached chrysotile asbestos and other mineral fibres. Carcinogenesis 2: 229-236; 1981. Monchanx, G.; Morlier, J.P.; Modn, M.; Chameaud. J.: Lafuma, J.; Masse, R. Carcinogenic and cocarcinogenic effects of radon and radon daughters in rats. Environ. Health Perspect. 102: 64-73;. 1994a. z /~'~,˘ ,U/q Monchaux, G.; Morlier, J.P.; Morin, M.; Zalma. R.; Ogata, H.; P6zerat, H.; Masse, R. Carcinogenic effects in rats of exposure to different minerals from metallic mi~,,: ores, radon and radon daughters. In: Davis, J.M.G.; Jaurand, M.C., eds. Cellular and molecular effects of mineral and synthetic dusts and fibres. NATO ASI Series. Vol H85. Berlin, Heidelberg: Springer- Verlag; 1994b: 159-164. Monchaux, G.; Morlier, J.P.; Chameaud, J.; Debroche, M.; Morin, M.; Masse, R. Carcinogenic effects on rats of exposure to mixtures of diesel exhausts, radon and rad6n daughters. Ann. Oceup. Hyg. 38(suppl. 1): 281-288; 1994c. Morgan, A.; Davis. P. Wagner, J.C.; BerD,, G., Holmes, A. The biological effects of magnesium-leached chry. sotile asbestos. Br. J. Exp. Pathol. 58: 465-473: 1977. Morin, M.; Masse. R.; Lafuma, J. Etude exp6rimentale des diff&ents types histologiques de cancers pulmonaires induits par l'irradiation. (Experimental study of different histologie types of lung cancer after irradiation). C.R. Acad. Sci. Paris. Sciences de la Vie (Life Sciences) 317; 1994: 90-93. Nettesheim, P.; Snyder, C.; Rim, J.C.S. Vitamin A and the sus- ceptibility of respiratory, tract tissues to carcinogenic insult. Environ. Health Perspect. 29: 89-93; 1979. Pham, Q.T.; Gaertner, k4.; Mur, J.M.; Braun, P.: Gabiano, M.; Sadoul, P. Incidence of iung cancer among iron miners. Eur. J. Respir. Dis. 64: 534-540; 1983. Pency, J.L.; Laroque, P.: Fritsch, P.; Monchaux, G.: Chameaud, J.; Masse, R. An experimental two-stage rat model of lung car- cinoma initiated by radon exposure. In: Cross, F.T., ed. Twenty- ninth Hanford symposium on health and the environment. "Indoor radon and lung cancer: Reality or myth?" 15-19 October 1990. Richland, WA, Part 2. Columbus, Richland: Battelle Press; 1993: 803-819. Queval, P.; Beaumatin, J.; Morin, M.; Courtois, D.; Lafuma, J. Inducibility ofmicrosomal enzymes in normal and precancerous lung tissue. Synergistic action of 5-6 benzoflavone or methyl- cholanthrene in radiation induced carcinogenesis. Biomedicine 31: 182-186; 1979. Radford, E.P.; Renard St. Clair, K.G. Lung cancer in Swedish iron ore miners exposed to low doses of radon daughters. N. Engl. J. Med. 310: 1485-1494; 1984. Saccomanno, G.; Huth, G.C.; Auerbach, O. et al. Relationship of radioactive radon daughters and cigarette smoking in the genesis of lung cancer in uranium miners. Cancer 62: 1402- 1408; 1988. Samet, J.M.; Pathak, R.; Morgan, M.V.; Marbury, M.C.; Key C.R.; Valdivia, A.A. Radon progeny exposure and lung cancer risk in.New Mexico U miners: A case-control study. Health Phys. 56: 415-421; 1989. Samet, J.M.; Pathak, R.; Morgan, M.V.; Key, C.R.; Valdivia, A.A.; Lubin, J.H. Lung cancer mortality and exposure to radon progeny in a cohort of New Mexico underground uranium miners. Health Phys. 61: 745-752; 1991. Sevc, J.; Kunz, E.; Placek, V. Lung cancer in uranium miners and long term exposure to radon daughter products. Health Phys. 30: 433-437; 1976. Solli. L.H.; Andersen, A.; Stranden, E.: Langard, S. Cancer inci- den6e among workers exposed to radon and thoron daughters at a niobium mine. Scand. J. Work Environ. Health I 1 : 7-13; 1985. Van Den Bossche, H.; Willemsens, G. Retinoic acid and cyto- chrome P-450. In: Saurat, J.H., ed. Retinoids: 10 years on. Basel, Switzerland: Karger; 1991: 79-88. Wagner, J.C.; BerD', G.; Timbrell, V. Mesotheliomata in rats after inoculation with asbestos and other minerals. Br. J. Cancer 28: I73-185; 1973. Wagner, J'.C.; Berry: G.; Skidmore, LW.; Timbrell, V. The effects of the inhalation of asbestos in rats. Br. J. Cancer 29: 252-269; 1974. Wagner, J.C.; Griffiths, D.M.; Hill, R3. The effect of fibre size on the in vivo activity of UICC crocidolite. Br. J. Cancer 49: 453- 458; 1984. Witschi, H.P.; Williamson, D.; Lock, S. Enhancement ofurethan tumorigenesis in mouse lung by butylated hydroxytoluene. J. Nat. Cancer Inst. 58: 301-305; 1977.
Page 146: 2063633631 Log in for more options!
2063633631
Page 147: 2063633632 Log in for more options!
Proc. Nad. Acad. Sci. USA Vol. 94, pp. 7691-7697, July 1997 Colloquium Paper This paper serves as an introduction to the following papers which were presented at a colloquium entitled" "Genetics and the Origin of Species," organized by Francisco J. Ayala and Walter M. Fitch, held January 30-February 1, 1997, at the National Academy of Sciences Beckman Center in Irvine, CA. Genetics and the origin of species: An introduction FRANCISCO J. AYALA* AND WALTER M. FITCH Department of Ecology and Evolutionary Biology, University of California, lrvine, CA 9269%2525 Theodosius Dobzhansky (1900-1975) was a key author of the Synthetic Theory of Evolution, also known as the Modern Synthesis of Evolutionary Theory, which embodies a complex array of biological knowledge centered around Darwin's the- ory of evolution by natural selection couched in genetic terms. The epithet "synthetic" primarily alludes to the artful combi- nation of Darwin's natural selection with Mendelian genetics, but also to the incorporation of relevant knowledge from biological disciplines. In the 1920s and 1930s several theorists had developed mathematical accounts of natural selection as a genetic process. Dobzhansky's Genetics and the Origin of Species, published in 1937 (1), refashioned their formulations in language that biologists could understand, dressed the equations with natural history and experimental population genetics, and extended the synthesis to spcciation and other cardinal problems omitted by the mathematicians. The current Synthetic Theory has grown around that orig- inal synthesis. It is not just one single hypothesis (or theory) with its corroborating evidence, but a multidisciplinary body of knowledge bearing on biological evolution, an amalgam of well-established theories and working hypotheses, together with the observations and experiments that support accepted hypotheses (and falsify rejected ones), which jointly seek to explain the evolutionary process and its outcomes. These hypotheses, observations, and experiments often originate in disciplines such as genetics, embryology, zoology, botany, paleontology, and molecular biology. Currently, the "synthet- ic" epithet is often omitted and the compilation of relevant knowledge is simply known as the Theory of Evolution. This is still expanding, just like one of those "holding" business corporations that have grown around an original enterprise, but continue incorporating new profitable enterprises and discarding unprofitable ones. Darwin to Dobzhansky Darwin summarized the theory, of evolution by natural selec- tion in the Origin of Species (2) as follows: "As many more individuals are produced than can possibly survive, there must in every case be a struggle for existence, either one individual with another of the same species, or with the individuals of distinct species, or with the physical conditions of life .... Can it, then, be thought improbable, seeing that variations useful to man have undoubtedly occurred, that other variations, useful in some way to each being in the great and complex battle of life, should sometimes occur in the course of thousands of generations? If such do occur, can we doubt (remembering that many more individuals are born than can possibly survive) that individuals having any advantage, however slight, over others, would 1997 by The National Academy of Sciences 0027-8424/97/947691-752.00/0 PNAS is available online at http://www.pnas.org. have t~ best chance of surviving and of procreating their kind? On the other hand, we may feel sure that any variation in the least degree injurious would be rigidly destroyed. This preservation of favorable variations and the rejection of injurious variations, I call Natural Se- lection." Darwin's argument is that natural selection emerges as a necessary conclusion from two premises: (i) the assumption that hereditary variations useful to organisms occur, and (ii) the observation that more individuals are produced than can possibly survive. The most serious difficulty facing Darwin's evolutionary theory was the lack of an adequate theory of inheritance that would account for the preservation through the generations of the variations on which natural selection was supposed to act. Theories then current of "blending inheri- tance'" proposed that offspring merely struck an average between the characteristics of their parents. As Darwin be- came aware, blending inheritance could not account for the conservation of variations, because differences among variant offspring would be halved each generation, rapidly reducing the original variation to the average of the preexisting char- acteristics. The missing link in Darwin's argument was provided by Mendelian genetics. About the time the Origin of Species was published, the Augustinian monk Gregor Mendel was per- forming a long series of experiments with peas in the garden of his monastery in B~rm, Austria-Hungary (now Brno, Czech Republic). Mendel's paper, published in 1866, formulated the fundamental principles of a theory of heredity that accounts for biological inheritance through particulate factors (now called "genes") inherited one from each parent, which do not mix or blend but segregate in the formation of the sex cells, or gametes (3). Mendel's discoveries, however, remained unknown to Dar- win and, indeed, did not become generally known until 1900, when they were simultaneously rediscovered by several scien- tists. In the meantime, Darwinism in the latter part of the 19th century faced an alternative evolutionary theory known as neo-Lamarckism. This hypothesis shared with Lamarck's orig- inal theory the importance of use and disuse in the develop- ment and obliteration of organs, and it added the notion that the environment acts directly on organic structures, which explained their adaptation to the ways of life and environments of each organism. Adherents of this theory rejected natural selection as an explanation for adaptation to the environment. The rediscovery in 1900 of Mendel's theory of heredity, led to an emphasis on the role of heredity in evolution. In the Netherlands, Hugo de Vries (4) proposed a new theory of evolution known as mutationism, which essentially did away Abbreviation: MHC, major histocompatibility complex. *To whom reprint requests should be addressed at: Department of Ecology and Evolutionary Biology, University of California. 321 Steinhaus Hall. Irvine. CA 92697-2525. e-mail: FJAYALA@ UCI.EDU. 7691
Page 148: 2063633633 Log in for more options!
7692 Colloquium Paper: Ayala and Fitch with natural selection as a major evolutionary process. Ac- cording to de Vries (joined by other geneticists such as William Bateson in England), there are two kinds of variation in organisms. One is the "ordinary" variation observed among individuals of a species, which is of no lasting consequence in evolution because, according to de Vries, it could not "lead to a transgression of the species border even under conditions of the most stringent and continued selection." The other consists of the changes brought about by mutations, spontaneous alterations of genes that yield large modifications of the organism and give rise to new species. According to de Vries, a new species originates suddenly, produced by the existing one without any visible preparation and without transition. Mutationism was opposed by many naturalists, and in particular by the so-called biometricians, led by Briton Karl Pearson, who defended Darwinian natural selection as the major cause of evolution through the cumulative effects of small, continuous, individual variations (which the biometri- clans assumed passed from one generation to the next without being subject to Mendel's laws of inheritance). The controversy between mutationists (also referred to at the time as Mendelians) and biometricians approached a resolution in the 1920s and 1930s through the theoretical work of several geneticists (5). These geneticists used mathematical arguments to show, first, that. continuous variation (in such characteristics as size, number of eggs laid, and the like) could be explained by Mendel's laws; and second, that natural selection acting cumulatively on small variations could yield major evolutionary changes in form and function. Distin- guished members of this group of theoretical geneticists were tLA. Fisher and J. B. S. Haldane in Britain and Sewall Wright in the United States (6-8). Their work contributed to the downfall of mutationism and, most importantly, provided a theoretical framework for the integration of genetics into Darwin's theory of natural selection. Yet their work had a limited impact on contemporary biologists because it was formulated in a mathematical language that most biologists could not understand; because it was almost exclusively the- oretical, with little empirical corroboration; and because it was limited in scope, largely omitting many issues, such as speeia- tion, that were of great importance to evolutionists. Dobzhansky's Genetics and the Origin of Species advanced a reasonably comprehensive account of the evolutionary process in genetic terms, laced with experimental evidence supporting the theoretical arguments. It had an enormous impact on naturalists and experimental biologists, who rapidly embraced the new understanding of the evolutionary process as one of genetic change in populations. Interest in evolutionary studies was greatly stimulated, and contributions to the theory soon began to follow, extending the synthesis of genetics and natural selection to a variety of biological fields. The main writers who, together with Dobzhansky, may be considered the architects of the synthetic theory were the zoologists Ernst Mayr (9) and Julian Huxley (10), the paleon- tologist George G. Simpson (11), and the botanist George Ledyard Stebbins (12). [The National Academy of Sciences held in January 1994 a colloquium (13) to commemorate the 50th anniversary of the publication of Simpson's seminal book, Tempo and Mode in Evolution (11).] These researchers con- tributed to a burst of evolutionary studies in the traditional biological disciplines and in some emerging ones--notably population genetics and, later, evolutionary ecology. By 1950 acceptance of Darwin's theory of evolution by natural selec- tion was universal among biologists, and the synthetic theory had become widely adopted. The line of thought of Genetics and the Origin of Species is surprisingly modern--in part. no doubt, because it established the pattern that successive evolutionary investigations and treatises largely would follow. Dobzhansky writes in the pref- ace: "The problem of evolution may be approached in two Prec, Natl. Acad. Sci. USA 94 (1997) different ways. First, the sequence of the evolutionary events as they have actually taken place in the past history of various' organisms may be traced. Second, the mechanisms that bring, about evolutionary changes may be studied .... The present book is dedicated to a discussion of the mechanisms of species formation in terms of the known facts and theories of genet- ics." The.book starts with a consideration of organic diversity and discontinuity. Successively, it deals with mutation as the origin of hereditary variation, the role of chromosomal rear- rangements, variation in natural populations, natural selection, the origin of species by polyploidy, the origin of species through gradual development of reproductive isolation, physiological and genetic differences between ~pecies, and the concept of species as natural units. The book's organization was largely preserved~'n the second (1941) and third (1951) editions, and in Genetics of the Evolutionary Process (14), published in 1970, a book that Dobzhansky thought of as the fourth edition of the earlier one, but had changed too much for publication under the same title. Dobzhansky sought to extend the evolutionary synthesis to mankind in numerous articles and several books, most notably Mankind Evolving (15), published in 1962, a book that many judge to be as important as Genetics and the Origin of Species. Dobzhansky was a leading experimentalist and prolific writer, who published several books and nearly 600 papers dealing with leading questions in population and evolutionary genet- ics, as well as with philosophical problems and humanistic issues. The experimental organisms of most of his research were Drosophila fruitflies. A Man for All Seasons Theodosius Dobzhansky was born on January 25, 1900, in Nemirov, a small town 200 km southeast of Kiev in the Ukraine. He was the only child of Sophia Voinarsky and Grigory Dobrzhansky (precise transliteration of the Russian family name includes the letter "r"), a teacher of higia school mathematics. In 1910 the family moved to the outskirts of Kiev, where Dobzhansky lived through the tumultuous years of World War I and the Bolshevik revolution. In those times the family was often beset by various privations, including hunger. In his unpublished autobiographical Reminiscences for the "Oral History Project" of Columbia University, Dobzhansky states that his decision to become a biologist was made about 1912. Through his early high school years, Dobzhansky became an avid butterfly collector. A school teacher gave him access to a microscope that Dobzhansky used particularly during the long winter months. In the winter of 1915-t916 he met Victor Luehnik, a 25-year-old college drop-out, who was a dedicated entomologist specializing in Coecinellidae beetles. Luchnik convinced Dobzhansky that butterfly collecting would not lead anywhere and that he should become a specialist. Dobzhansky chose to work with ladybird beetles, which would be the subject of his first scientific publication in 1918. (Reference to Dobzhansky's publications can be found in the extensive bibliography published by the National Academy of Sciences, ref. 16.) Dobzhansky graduated in biology from the University of Kiev in 1921. Before his graduation, he was hired as an instructor in zoology at the Polytechnic Institute in Kiev. Fie taught there until 1924, when he became an assistant to Yuri Filipehenko, head of the new department of genetics at the University of Leningrad. Filipchenko was familiar with Thomas Hunt Morgan's work in the United States and had started a Drosophila laboratory, where Dobzhansky was en- couraged to investigate the pleiotropic effects of genes. In 1927, Dobzhansky obtained a fellowship from the Inter- national Education Board (Rockefeller Foundation)" and ar- rived in New York on December 27 to work with Thomas Hunt Morgan at Columbia University. In the summer of 1928 he
Page 149: 2063633634 Log in for more options!
~'~ Colloquium Paper: Ayala and Fitch followed Morgan to the California Institute. of Technology, Dobzhans y_ was appointed assistant professor of ge- netics in 19292 and professor of genetics in 1936. In 1940 he returned to New York as professor of zoology at Columbia University, where he remained until 1962, when he became professor at the Rockefeller Institute (renamed Rockefeller University in 1965) also in New York City. On July 1, 1970, Dobzhansky became professor emeritus at Rockefeller Uni- versity; in September 1971, he moved to the Department of Genetics at the University of California, Davis, where he was adjunct professor until his death in 1975. On August 8, 1924, Dobzhansky married Natalia (Natasha) Sivertzev, a geneticist in her own right, who was at the time working with the famous Russian biologist I. I. Schmalhansen in Kiev. Natasha was Dobzhansky's faithful companion and occasional scientific collaborator until her death from coro- nary thrombosis on February 22, 1969. The Dobzhanskys had ~,~.!y one child, Sophie, married until her recent death to • iichael D. Coe, professor of anthropology at Yale University. In a routine medical check-up on June 1, 1968, it was discovered that Dobzhansky suffered from chronic lymphatic leukemia, the least malignant form of leukemia. He was given a prognosis of"a few months to a few years" of life expectancy. Over the following 7 years, the progress of the leukemia was unexpectedly slow and, surprising to his physicians, it had little if any noticeable effect on his energy and work habits. How- ever, the disease took a conspicuous turn for the worse in the summer of 1975. In mid-November Dobzhansky started to receive chemotherapy, but continued living at home and working at the laboratory. He was convinced that the end of his life was near and dreaded that he might become unable to work and to care for himself. This never came to pass. He died of heart failure on the morning of December 18, 1975. The previous day, he had been working in the laboratory. Dobzhansky was an excellent teacher and distinguished educator of scientists. Throughout his academic career he had more than 30 graduate students and an even greater number of postdoctoral and visiting associates, many of them from foreign countries. Some of the most distinguished geneticists and evolutionists in the United States and abroad are his ~'ormer students. Dobzhansky spent long periods of time in foreign academic institutions, and was largely responsible for the establishment or development of genetics and evolutionary biology in various countries, notably Brazil, Chile, and Egypt. Dobzhansky gave generously of his time to other scientists, particularly to young ones and to students. But he resented time spent in committee activities, which he shunned as often as he reasonably could. Throughout his academic career, he avoided administrative posts, alleging, perhaps correctly, that he had neither temperament nor ability for management. Most certainly, he preferred to dedicate his working time to research and writing rather than to administration. Dobzhansky was a world traveler and an accomplished linguist able to speak fluently sLx languages and to read several more. He was a good naturalist and never lacked time for a hike in the California Sierras, the New England forests, or the Amazon jungles. He loved horseback riding but practiced no other sports. Dobzhansky's interests included the visual arts, music, history, Russian literature, cultural anthropology, phi- losophy, religion, and. of course, science. His artistic prefer- ences were unsystematic and definitely traditional. His favorite composer was Beethoven followed by Bach and other ba- toques; he loved Italian operas, but had little appreciation for most twentieth century music and a definite distaste for atonalism. (Of electronic and computer-composed music, he said that it is fit only for computers to listen to it.) In art, Dobzhansky admired the Italian Renaissance painters as well as the Dutch and Spanish masters of the seventeenth century; he appreciated the French Impressionists but detested cubism and all subsequent styles and schools of modern art. P~. c. Natl. Acad. Sci. USA 94 (1997) 7693 Dobzhansky's obvious personality traits were magnanimity and expansiveness. He recognized and generously praised the achievements of other scientists; he admired the intellect of his colleagues, even when admiration was alloyed with disagree- ment. He made many long-lasting friendships, usually started by professional interaction. Many of Dobzhansky's friends were scientists younger than himself, who either had worked in his laboratory as students, postdoctorals, or visitors, or had met him during his travels. He was conspicuously affectionate and loyal toward his friends; he expected affection and loyalty in return. Dobzhansky's exuberant personality was manifest not only in his friendships but also in his antipathies, which he was seldom able, or willing, to hide. .. Dobzhansky" was a religious man, although he apparently rejected fundamental beliefs of traditional religion, such as the existence"~f a personal God and of life beyond physical death. His religiosity was grounded on the conviction that there is meaning in the universe. He saw that meaning in the fact that evolution has produced the stupendous diversity of the living world and has progressed from primitive forms of life to mankind. Dobzhansky held that, in man, biological evolution has transcended itself into the realm of self-awareness and culture. He believed that somehow mankind would eventually evolve into higher levels of harmony and creativity. He was a metaphysical 6ptimist. Dobzhansky's prodigious scientific productivity was made possible by incredible energy and very disciplined work habits. His enormous success as the creator of new ideas and as a synthesizer was, at least in part, based on his broad knowledge, phenomenal memory, and an incisive mind able to see the relevance that a new discovery or a new theory might have with respect to other theories or problems. His success as an experimentalist depended on a wise blending of field and laboratory research; whenever possible he combined both in the study of a problem, often using laboratory studies to ascertain or to confirm the causal processes involved in the phenomena discovered in nature. He obtained the collabora- tion of mathematicians to design theoretical models for ex- perimental testing and to analyze statistically his empirical observations. He was no inventor or gadgeteer, but he had an uncanny ability to exploit the possibilities of any suitable experimental apparatus or experimental method. Dobzhansky received many honors and awards. He was president of several professional organizations, including the Genetics Society of America (1941), the American Society of Naturalists (1950), the Society for the Study of Evolution (1951), the American Society. of Zoologists (1963), the Amer- ican Teilhard de Chardin Association (1969), and the Behavior Genetics Association (1973). He was a member of the National Academy of Sciences, the American Academy of Arts and Sciences, the American Philosophical Society, and of many foreign academies, such as the Royal Society of London. He received more than 20 honorary degrees from universities in the United States and abroad. He received the Daniel Giraud Elliot Medal (1946) and the Kimber Genetics Award (1958) from the National Academy of Sciences and numerous other medals, including the National Medal of Science. which he received in January 1964 from President Lyndon Baines Johnson (16, 17). The 16 papers that follow were presented at a colloquium sponsored by the National Academy of Sciences to celebrate the 60th anniversary of the publication of Dobzhansky's Ge- netics and the Origin of Species. These papers are organized into four successive sections: Genetic Variation and Its Origins. Adaptation and Natural Selection, Population Differentiation and Speciation, and Patterns of Evolution. Genetic Variation and Its Origins In 1937, when Dobzhansky published Genetics and the Origin of Species (1), the DNA structure was not yet discovered, nor
Page 150: 2063633635 Log in for more options!
7694 Colloquium Paper: Ayala and Fitch were there any grounds to anticipate the tremendous impact that molecular biology would have on evolutionary research. We now know how genes are organized and function, and we can ask primeval questions such as what the original organisms were like or how ur-genes were organized. Walter Gilbert advanced in 1987 "the exon theory of genes" (18; see also 19) contending that introns have been around since the progenote, the earliest genetic organism, as spacers between the early, simple genes, and were thereafter used to assemble the complex genes that would later evolve as coalitions of the primitive ones. This hypothesis has been challenged with the alternative proposal that introns came about late in evolution and had nothing to do with the arrangement and rearrange- meat of gene pieces. Walter Gilbert, S. J. de Souza, and M. Long in "Origin of Genes" (20) review the two theories, as well as an intermediate position proposing that introns arose at the beginning of multicellularity and played a major role during the Cambrian explosion in creating new genes by exon shuffling. The authors argue that if exon shuffling originated with the progenote, exons should consist of an integer number of codons and should be correlated with compact regions of polypeptides. The evidence that they now present, they say, strongly suppo.rts the case. The ultimate source of genetic .variation was thought to be, at the time of the publication of Genetics and the Origin of Species, gene mutation. Dobzhansky was soon to realize that chromosomal mutations could also play important roles in the evolution sweepstakes. The significance of the transposable elements, fu'st discovered by Barbara McCllntock in the 1940s, would become apparent only several decades later. Transpos- able elements, say Margaret G. Kidwell and Damon Lisch (21), are ubiquitous in many kinds of organisms and account for 10-15% of the Drosophila's genome and more than 50% of maize's. Transposable elements provide, indeed, genetic vari- ation on a scale and variety that could hardly have been imagined even a few years ago. Kidwell and Liseh point out the manifold effects of trans- posable elements. In the genotypc, they are involved in many gone mutations, are ubiquitous, and incessantly shift their numbers and locations. Transposable elements modify phe- notypes as well, subtly in some cases, causing drastic alterna- tions of development and organization in others. From an evolutionary perspective, transposable elements may be seen as parasites of genomes, but like with other parasites, organ- isms have often become coadapted with them and have even learned to subvert them for their own benefit. The word "virus" does not appear in the index of any of the three editions of Genetics and the Origin of Species. By 1970, when Genetics of the Evolutiona~. Process (14) was published, viruses had become a favored organism of molecular genetics, and the term "viruses" is represented by six entries in the index, mostly referring to bacteriophages, but there is also a discussion of the myxomatosis virus, introduced in 1950 in Australia to control a rabbit population explosion. Two de- cades later, the accumulation of virus gene sequences com- bined with the development of new phylogenetie methodolo- gies has brought viruses into the mainstream of molecular evolution. Important insights that have been gained concern evolutionary processes but also epidemiology, public health, and geographic patterns of human migrations.. Waiter M. Fitch and colleagues (22) investigate the HA1 domain of the hemagglutinin gene from human influenza A viruses isolated throughout the world from 1984 to 1996. The gene is evolving at a rate of 5.7 × 10-3 substitutions per site per year, about one million times faster than cellular genes. In several positions of hemaggl.utinin a majority of the nucleotide substitutions are nonsynonymous--i.e., result in amino acid replacements--which strongly supports positive Darwinian selection rather than neutral evolution. The authors aver that Proc: Natl. Acad. Sci. USA 94 (1997) gene sequence phylogeni.es may manifest which isolates are most likely to cause future epidemics and might therefore be used for vaccine production. Dobzhansky's interest in human genetic diversity was mo- tivated by science but also by his enduring concern with the human predicament. He saw that the pervasiveness of genetic diversity was the foundation of human individuality but pro- vided no grounds for any sort of discrimination. Equality--as in equality in law and equality of opportunitym"pertains to the rights and the sacredness of life of every human being" (ref. 23, p. 4). In Mankind Evolving (15, p. 18) he wrote that "Human evolution has twq components, the biological or organic, and the cultural or superorganie. These components are neither mutually exe~siv.e nor independent, but interrelated and in- terdependeff~ Human evolution cannot be understood as a purely biological process, nor can it be adequately described as a history of culture. It is the interaction of biology and culture. There exists a feedback between biological and cultural pro- CesSe5." For more than three decades, L. L. CavallioSforza has sought to elucidate the geographic origins and dispersal patterns of human populations by investigating gene frequency distribu- tions. Genetic information has accumulated exponentially, encompassing protein-encoding genes, nuclear and mitochon- drial, as well as mierosatellite and other DNA sequences. "Genes, Peoples, and Languages" (24) emphasizes the African origin of modern humans, whence the other continents were colonized starting ,~100,000 years ago, first West Asia, then East Asia and Oceania, both probably through the coastal route of South Asia, and later Europe and America, both from East Asia and the latter certainly from the north, via the Bering land passage created in the ice ages. Cavalli-Sforza sees that the genetic conclusions are confirmed by trees of linguistic families, although these are temporally shallow. Adaptation and Natural Selection Starting in the late 1960s gel electrophoresis of soluble zymes uncovered stores of genetic variation, much greater than had been suspected, in all sorts of animal and plant popula- tions, as well as bacteria and other microorganisms. Whether this variation is adaptively important or just neutral noise became a matter of debate. The 1980s ushered in populational DNA sequencing. Much additional variation was discovered in the form of nucleotide differences between haplotypes. We now know that any two haplotypes of any gene differ on the average by several nucleotide substitutions, although most do not yield amino acid differences in the encoded protein. The neutral-selection controversy rages on. Richard R. Hudson and collaborators (25) investigate the Sod gene (coding for the Cu,Zn superoxide dismutase) in Drosophila rnelanogaster, where an unusual polymorphism prevails. At the protein level two alleles, Fast and Slow, are discerned, with Slow absent in some populations but reaching frequencies '~5-15% in many others. It turns out that all Slow alleles have identical DNA sequences (with trivial exceptions) eCcen when they originate from different world continents. The Fast alleles fall into two categories: roughly half of them are identical, whether they come from Europe, Asia, or the Americas; the other half are heterogeneous, most of them distinguished from each other by several nucleotide differ- ences. Adding to the puzzle is that the Fast alleles that are identical to each other are also identical to the Slow alleles except for the one nucleotide substitution that accounts for their different amino acid composition. Hudson and collabo- rators conclude that within the last few thousand years a previously rare allele has rapidly risen in frequency to the present levels. The process was driven by fairly strong natural selection.
Page 151: 2063633636 Log in for more options!
Colloquium Paper: Ayala and Fitch Polymorphisms shared between species were investigated long and hard by Dobzhansky, mostly chromosomal rearrange- ments present in two closely related species, Drosophila pseudoobscura and Drosophila persimilis. DNA sequencing has uncovered numerous trans-specifie polymorphisms, notably in the genes of the major histocompatibility complex (MHC) of .~nammals, where some shared alleles have persisted for mil- lions of years. In plants of the family Solanaceae, alleles that are self-incompatible in fertilization have persisted across species barriers for 70 million years. Drosophila species also share DNA sequence polymorphisms that are several million years old. Andrew G. Clark (26) develops mathematical models seek- hag to elucidate the causes of trans-specifie shared polymor- phisms. The shared self-incompatibility polymorphisms of plants and MHC alleles of humans and other primates are maintained by strong natural selection, because the protein ~reducts accrue a fitness advantage to the bearer of those .:eies if they are different. The Drosophila polymorphisms, ~aowever, are recent enough that they might have persisted by neutral drift. Three decades ago, Zuckerkandl and Pauling (27) conjec- tured that morphological evolution is largely caused by changes ha the expression of genes, rather than in the amino acid sequence of the encoded polypeptides. Natalia A. Tamarina, Michael Z. Ludwig, and Rollin C. Richmond (28) explore the issue in two homologous genes in two species, D. melanogaster (Est-6) and D. pseudoobscura (Est-SB). The coding regions of these two genes share 80% of their nueleotide and amino acid sequences. The regions flanking the genes are, in contrast, so different that it is difficult to align their sequences to ascertain homology. Tamarina and colleagues (28) make recourse to the magi- cian's bag of tricks available to Drosophila geneticists. They pick up regulatory DNA segments from D. pseudoobscura and introduce them in the appropriate locations olD. melanogaster. The expression of the gene in the D. metanogaster transgenie flies becomes substantially altered. The expression of the two genes in normal flies follows similar patterns, yet the gene- :'egulating apparatus has become different in the two species. it was not until the 1970s that demography was integrated into the theory of the dynamics of natural selection. Population genetics theory had until then treated all individuals in a population as effectively equivalent, without corroboration of longevity, age-dependent fecundity, and other life history parameters. The beginnings of an integration of the theories of population ecology and population genetics appeared ha the 1970s, although this integration never engaged much attention from theorists or experimentalists, perhaps because of the many complexities involved. Dobzhansky and some of his students and collaborators made important experimental con- tributions to the problems (see refs. 29-35). Wyatt W. Anderson and Takao K. Watanabe (36) analyze life history schedules of births and deaths to investigate the outcome of laboratory population experiments involving sev- eral chromosomal arrangements of D. pseudoobscura in vari- ous combinations. Coincidentally, it happens that all possible genetic outcomes occur: stable polymorphic equilibrium, un- stable polymorphie equilibrium, and fixation for one of the alternatives. The authors conclude that, in these populations, both viability and fertility are important fitness components. Age-dependent female fecundity plays a particularly signifi- cant role in the outcome. Population Differentiation and Speciation The concept of species is fundamental in evolutionary theory. The modern understanding of this concept can be traced to 1935 when Dobzhansky introduced what is now known as the "biological species concept" (37). Dobzhansky defined species Prec. Natl. Acad. Sci. USA 94 (1997) 7695 as "that stage in the evolutionary process at which the once actually or potentially interbreeding array of forms becomes segregated in two or more separate arrays which are physio- logically incapable of interbreeding" (37; also ref. 1, p. 312). Dobzhansky saw that the species is not only a category of classification, but in sexual organisms also a natural unit defined by the ability to interbreed or its absence. He called attention to the determining role played by reproduction "isolating mechanisms," a term that he created. The biological species concept has recently been challenged on the grounds that it unduly neglects phylogeny. John C. Avise and Kurt Wollenberg (38) examine this criticism by bringing to bear recent gene coalescence theory with an analysis of multiple, gender-defined pathways in genealogical pedigrees,Bey conclude that the supposed sharp distinction between the biological species concept and the phylogenetic constructs favored by the critics is illusory. "Historical descent and reproductive ties," they write, "are related aspects of phylogeny, and jointly illuminate biotic discontinuity." Among the reproductive isolating mechanisms identified by Dobzhansky (1) there was one, later called "gametic isolation," occurring when the "spermatozoa fail to reach the eggs, or to penetrate into the eggs; in higher plants, the pollen tube growth may be arrested if foreign pollen is placed on the stigma of the flower.'" Therese Markow (39) notes that the investi- gation of gametic isolation as an evolutionary mechanism has been unduly neglected. In the genus Drosophila alone, a huge diversification exists in the size and pattern of gametes and other internal reproductive traits affecting fertilization. For fertilization to occur, "sperm must successfully enter the female and be transported to the storage organs... [and] must stay alive with adequate motility until they are utilized by the female." Markow examines how these steps fail in different eases and draws a richly patterned quilt that one can see will likely be much extended as other organisms are investigated. The evolutionary possibilities by which these variegations may cgme about are virtually infinite. Coniferous forests and oak woodlands along the North American Pacific Coast are inhabited by Ensatina terrestrial salamanders. Several species were thought to occur in Cali- fornia, but detailed morphological and coloration analysis led to the conclusion in 1949 that various forms were parts of only one polytypie species arranged in the form of a ring around the Central Valley of California (40). Dobzhansky (41) saw that virtually all stages in a speciation process could be identified along the ring, with complete reproductive isolation between the terminal populations meeting in the southern part of the valley. In Dobzhansky's view speeiation was thwarted by ongoing gene flow via the intermediate populations around the ring. Wake and colleagues demonstrated in the late 1980s (42-44) that gene flow could not hold the complex together: an analysis of protein variation in 19 populations along the ring disclosed great genetic differentiation among populations. David B. Wake (45) reviews mitochondrial DNA and other variation. The Ensatina population array is old. consisting of a number of geographically and genetically distinct components that have reached or approximate full species level. The evolution- ary history elucidated is extremely complex, with repeated interludes of geographic separation and genetic interactions upon renewed contact. Peter R. Grant and Rosemary Grant (46) see that Dobzhan- sky's Genetics and the Origin of Species is an appropriate starting point for investigating the speciation process and the underlying genetic changes. But in one respect, they note, Dobzhansky's book is disappointing because it says nothing about the genetics of birds, which are their consuming research interest. Birds are made to serve a good purpose for illustrating geographical patterns of morphological variation within spe- cies, adaptation to newly colonized habitats, rapid radiation in
Page 152: 2063633637 Log in for more options!
7696 Colloquium Paper: Ayala and Fitch eroc. Natl. Acad. Sci. USA 94 (1997) archipelagos, and interspeeies competition. The evolution of reproductive isolation is considered, but "the genetics of speeiation are the genetics of other organisms, mainly Dro- sophila." Peter and Rosemary Grant note differences between spe- elation in birds and speeiation in Drosophila. It is significant that in birds the behavioral barriers that prevent mating evolve first, whereas post-mating isolation typically evolves much later, perhaps after gene exchange has all but ceased. Pre- mating isolation in birds may arise from nongenetie causes, often from factors such as song, which in many groups of birds is culturally inherited through an imprinting-like process. Of the factors involved in pre-mating isolation, such as plumage, morphology, and behavior, some are under singie-gene con- trol, but most are polygenetically determined, Patterns of Evolution The universal tree of life consists of three domains, or "em- pires," bacteria, arehaea, and eukarya. The three multicellular kingdoms, animals, plants, and fungi, are just 3 of the 10-12 extant major branches of the eukaryote domain. Molecular evolutionary investigations in the last decade have elucidated the large genetic diversity encompassed by the set of all eukaryotes and, hence, the reduced proportion represented by the multicellular kingdoms. The existence and great genetic heterogeneity of the archaea have been discovered by molec- ular evolutionists also in the last few years, and so have been most of the species and higher taxonomic groups. The recon- struction of the universal tree and the assessment of the genetic diversity of each branch are buttressed by the hypothesis of the molecular clock of evolution, which has multifarious other applications in other evolutionary studies. How good is the molecular clock? It has been known for some time that the time variance of molecular evolutionary events is larger than would be expected if the molecular clock were a stochastic clock, like the radio- active decay of isotopes. Francisco Ayala in "Vagaries of the Molecular Clock" (47) reviews two clocks, the genes Gpdh and Sod, investigated in his laboratory. Gpdh evolves in Drosophila very slowly, at a rate of 1.1 × 10-t° amino acid replacements per site per year. But the rate is much faster, -4.5 × 10- t0 in mammals, between Dipteran families, between animal phyla, or between plants, animals, and fungi. On the other hand, Sod evolves very fast in Drosophila, -, 16 × 10-10, which is also the rate in mammals and between Dipteran families; but the rate becomes much slower, 5.3 × 10- ~0, between animal phyla, and still slower, 3.3 × 10-~°, between plants, animals, and fungi. If one were to assume that Gpdh and Sod are good clocks and project the Drosophila rate to estimate the time of divergence of the three multicellular kingdoms, Gpdh would yield an estimate of 3,990 million years, Sod an estimate of 224 million years, both very much off the commonly accepted divergence time of '- 1,100 million years. It is unlikely that many molecular clocks are as erratic as Gpdt, or Sod, but molecular clocks should be applied with caution, particularly when remote extrapolations are made. The hypothesis of the molecular clock was originally pred- icated on the assumption that the evolutionary replacement of one amino acid for another, or one nucleotide for another is most often of no adaptive consequence. If such assumption would obtain, the process of molecular evolution would be governed by a time-dependent stochastic process. The assump- tion of adaptive inconsequence seems safest in the case of ,synonymous nucleotide substitutions, which do not change the amino acids encoded by a gene. Jeffrey Powell and Etsuko Moriyama (48) explore a vexing problem, namely that organ- isms do not use alternative synonymous codous with the frequencies expected if synonymous substitutions were incon- sequential. The deviations from random expectations are large in Drosophila genes and they often persist through long periods of evolution. Powell and Modyama (48) exclude differential mutation rates as the cause of the codon bias. Rather, they conclude that natural selection is the cause. The determining factor is the relative abundance of the tRNAs that execute the translation of genes into proteins: genes that are expressed at high rates favor eodons that match those tRNAs that are more abundant. The genes in the nucleus of plants often occur as "fami- lies"--i.e., a gene encoding a particular polypeptide may exist in several copies of more or less remote evolutionary origin. Michael Clegg, Michael P. Cummings, and Mary L. Durbin investigate "q;he Evolution of Plant Nuclear Genes" (49) by focusing on three gene families, rbcS, Chs, andAdh. Additional 6opies are~eeruited at different rates in these families: new Chs and rbcS genes are recruited 20 times faster than Adh genes. The multiplication of gene copies and their divergence is particularly notable for Chs genes in the evolution of flowering plants. The evolution of Adh in monocot plants is not consistent with the molecular clock hypothesis even for synonymous nucleotide substitutions. Clegg and colleagues conclude that natural selection plays a significant role in driving the evolu- tionary divergence of duplicated genes. They add that new alleles often arise by intragene recombination (49). Multigene families occur in animals as well as in plants. Notable in humans and other mammals are genes associated with the immune system, such as the MHC genes and immu- noglobulin (Ig) genes. Some multigene families, in animals as in plants, arise by concerted evolution, a process that generates new genes by interlocus recombination or gene conversion. Masatoshi Nei, Xun Gu and Tatyana Sitnikova (50) raise the question whether concerted evolution may account for the MHC and Ig families, as some authors have suggested. They note that member genes of these families are often more similar to homologous genes from different species than they are to other member genes within the same species. This would not be expected if concerted evolution were the main origi- nating process of gene multiplication within a family. Phylo- genetic analyses of several MHC and Ig multigene families display patterns inconsistent with the concerted evolution hypothesis. The evidence favors the conclusion that the cre- ation of new genes by gene duplication has repeatedly occurred in the evolutionary history of organisms. Some duplicated genes persist in the diversified descendant species for a long time; others effectively disappear, either because they are deleted or have become nonfunctional by deleterious muta- tions. We are grateful to the National Academy of Sciences for the generous grant that financed the colloquium and to Kenneth Fulton and Edward Patte, and the staff of the Arnold and Mabel Beckman Center for their skill and generous assistance during the colloquium and its preparation. Special gratitude is owed to Denise Chilcote, who was responsible for the ˘olloquium's logistics at all stages, and for her graciou~ and dedicated performance. Most of all, we are grateful to the speakers and their eo-anthors for their wonderful contribution to the colloquium and in the papers that follow. We have borrowed exten- sively from ref. 16 in the preparation of Dobzhansky's biographical statement. 1. Dobziaansky, Th. (1937) Genetics and the Origin of Species (Columbia Univ. Press, New York); 2nd Ed., 1941; 3rd Ed., 1951. 2. Darwin, C. (1859) On the Origin of Species by Means of Natural Selection (Murray, London). 3. Mendel, G. (1866) l/erh. Naturforsch. I"ereines Abhandlungen Brann 4, 3-47. de Vries, H. (1900) Rev. Gen. Bot. 12, 9,257-271. 5. Provine, W.G. (1971) The Origins of Theoretical Population Genetics (Univ. of Chicago Press, Chicago). 6. Fisher, R.A. (1930) T/re Genetical Theory of Natural Selection (Clarendon, Oxford).
Page 153: 2063633638 Log in for more options!
Colloquium Paper: Ayala and Fitch 7. Haldane, J. B. S. (1932) The Causes of Evolution (Harper, New York). 8. Wright, S. (1931) Genetics 16, 97-159. 9. Mayr, E. (1942) Systematics and the Orisin of Species (Columbia Univ. Press, New York). i0. Huxley, J. S. (1942) Evolution: The Modern Synthesis (Harper, New York). t,1. Simpson, G. G. (1944) Tempo and Mode in Evolution (Columbia Univ. Press, New York). 12. Stcbbins, (3. L. (1950) Variation and Evolution in Plants (Colum- bia Univ. Press, New York). 13. Fitch, W.M. & Ayala, F.J., cds. (1995) Tempo and Mode in Evolution (National Academy Press, Washington, DC). 14. Dobzhansky, Th. (1970) Genetics o[ the Evolutionary Process (Columbia Univ. Press, New York). 15. Dobzhansky, Th. (1962) Mankind Evolving (Yale Univ. Press, New Haven, CT). 16. Ayala, F.J. (1985) Biogr. Mere. Natl. Acad. Sci. U.S.A 55, 163-213. 17. Ayala, F.J. (1990) in Dictionary oj' Scientific Biography, Oillespic, C. C. (Scribner's, New York), VoL 17, Suppl. If, pp. 233--242. 18. Gilbert, W. (1987) Cold Spring Harbor Symp. Quant. Biol. 52, 901-905. 19. Doolittle, W. F. (1978) Nature (London) 272, 581-582. 20. Gilbert, W., de Souza, S. J., & Long, M. (1997) Prec. Natl. Acad. Sci. USA 94, 7698-7703. 21. Kidwdl, M. G. & Lisch, D. (1997) Prec. Natl.Acad. ScŁ USA 94, 7704-7711. 22. Fitch, W. M., Bush, R. M., Bender, C.A. & Cox, N.J. (1997) Prec. Natl. Acad. Sci. USA 94, 7712-7718. 23. Dobzhansky, Th. (1973) Genetic Diversity and Human Equality (Basic Books, New York). 24. Cavalli-Sforza, L.L (1997) Pro~ Natl. Acad. Sci. USA 94, 7719-7724. 25. Hudson, R. 1L, S~iez, A. G. & Aya/a, F..1". (1997) Pro~ Natl. Acad. ScL USA 94, 7725-7729. 26. Clark, A. G. (1997) Prec. Natl. Acad. Sci. USA 94, 7730-7734. 27. Zuckerkandl, E. & Pauling, L. (1965) in Evolving Genes and Proteins, eds. Bryson, V. & Vogel, H. J'. (Academic, New York), pp. 97-166. Prec. Natl. Acad. Sci. USA 94 (1997) 7697 28. Tamarina, N. A., Ludwig, M. Z. & Richmond, R. C. (1997) Prec. Natl. Acad. Sci. USA 94, 7735-7741. 29. Beardmore, J'. A., Dobzhansky, Th. & Pavlovsky, O.A. (1960) Heredity 14, 19-33. 30. Dobzhansky, Th., Lewontin, R. C. & Pavlovsky, O. (1964) He- redity 22, 169-186. 31. Ayala, F. J. (1970) in Essays in Evolution and Genetics in Honor of Theodosius Dobzhansky, cds. Hecht, M. K. & Stecre, W. C. (Applcton-Ccntury-Drofts, New York), pp. 121-158. 32. Ayala, F. J. (1969) Can. J. Genet. CytoL 11, 439-456. 33. Mueilcr, L D. & Ayala, F. J. (1981) Genetics 97, 667-677. 34. Mucticr, L. D. & Ayala, F.J. (1981) Prec. Natl. Acad. ScL USA 78, 1303-1305. 35. Mueiler, L.D., Guo, P. & AyaJ.a, F.J. (1991) Science 253, 433-435. 36. Anderson, W. W. & Watanab˘, T. K. (1997) Proc. Natl. Acad. Sci. USA ~1( 7742-7747. 37. Dobzhansky, Th. (1935) Philos. ScL 2, 344-355. 38. Arise, J. C. & Wo|lenberg, IC (1997) Prec. Natl. Acad. Sci. USA 94, 7748-7755. 39. Markow, T. A. (1997) Prec. Natl. Acad. Sci. USA 94, 7756-7760. 40. Stebbins, R. C. (1949) Univ. Calif. Publ. ZooL 48, 377-526. 41. Dobzhansky, Th. (1958) A Century oflDarwin, ed. Barnett, S. A. (Harvard Univ. Press, Cambridge, MA), pp. 19-55. 42. Wake, D. B. & Yanev, K. P. (1986) Evolution 40, 702-715. 43. Wake, D. B., Yanev, K. P. & Brown, C. W. (1986) Evolution 40, 866-868. 44. Wake, D. B., Yanev, K. P. & Frelow, M. M. (1989) in Speciation and its Consequences, e~. Otte, D. & Endler, J.A. (Sinauer, Sunderland, MA), pp. 134-157. 45. Wake, D.B. (1997) Prec. NatLAcad. Sci. USA 94, 7761-7767. 46. Grant, P. R. & Grant, B. R. (1997) Prec. Natl. Acad. Sci. USA 94, 7768-7775. 47. Ayala, F.J. (1997) Prec. Natl. Acad. Sci. USA 94, 7776-7783. 48. Poweil, ft. R. & Moriyama, E.N. (1997) Prec. Natl. Acad. Sci. USA 94, 7784-7790. 49. Clegg, M.T., Cummings, M.P. & Durbin, M.L. (1997). Prec. Natl. Acad. Sci. USA 94, 7791-7798. 50. Nei, M., Gu, X. & Simikova, T. (1997) Prec. Natl. Acad. Sci. USA 94, 7799-7806.
Page 154: 2063633639 Log in for more options!
2063633639
Page 155: 2063633640 Log in for more options!
Indoor Air 1997; 7:143-150 B925 XF~.7$ lad] Printed in Denmark. All rights reserved IND~IOR AIR 97 ~ClffdHKSGAARD INT PU]~L LTD DE Copyright © Munksgaard 1997 ll~DOOR AIR ISSN 0905-6947 Subjective Indoor Air Quality in Schools in Relation to Exposure GRETA SMEDJE1, DAN NORB~CK1 AND CHRISTER EDLING1 Abstract This paper presents data on indoor air quality in schools as perceived by those working in them and relates these data to exposure measurements. Data on subjective air quality, domestic exposures and health aspects were gathered by means of a ques- tionnaire which was sent to all personnel in 38 schools; it was completed by 1410 persons (85% of the total). Data on exposure were gathered by exposure measurements in classrooms. The re- sults indicate that 53% of the personnel perceived the indoor air quality as bad or very bad. It was perceived as worse by those who were younger, those who were dissatisfied with their psy- chosocial work climate and those who were not exposed to to- bacco smoke at home. In older school buildings and buildings with displacement ventilation there was less dissatisfaction with the air quality. There were no significant relations between com- plaints and air exchange rate or concentration of carbon dioxide. The air quality was perceived as worse at higher levels of ex- posure to a number of airborne compounds including volatile organic compounds, moulds, bacteria and respirable dust. It was concluded that exposure to indoor pollutants affects perception even at the low concentrations normally found indoors in nonin- dustrial buildings. Key words Subjective air quality; School personnel; Personal factors; Building characteristics; VOC; Microorganisms. Received 27 June 1995. Accepted for publication 12 November 1996. © Indoor Air (1997) Introduction Complaints concerning poor indoor air quality are common (Burge et al., 1987; Mendell, 1993; Skov et al., 1987; Sundell, 1994). Such complaints are often the starting-point for discussions about the medical rel- evance of indoor air quality, of investigations and measurements in the buildings, as well as of alter- ations. These measures often become both extensive and expensive. The validity of such complaints as an indicator of exposure is potentially of great interest. Most studies relating subjective air quality to exposure have dealt with one single exposure factor such as hu- midity, temperature or volatile organic compounds (VOC) (Andersen et al., 1974; Broder et al., 1993; Hud- nell et al., 1992; M61have et al., 1986; Reinikainen et al., 1992). Most of these studies were designed as experi- ments conducted over a certain period of time. In some epidemiological studies, mainly dealing with sick building symptoms, data on subjective air quality have been included. These studies typically deal with office workers (Zweers et al., 1992; Wallace et al., 1993). In recent years, there has been growing concern about the school environment in Sweden. The vast ma- jority of Swedish schoolchildren attend public elemen- tary and secondary schools from the age of 7 to 16 years. In schools the population density is high and poor ventilation, lack of maintenance and unsatisfac- tory cleaning are all thought to be common. Poor in- door air quality has been suggested as being related to the increase of allergic diseases that has occurred particularly among children and youths (NIPH, 1994) but few studies have been published on aspects of air quality in schools (Thorstensen et al., 1990; Gravesen et al., 1986; Munir et al., 1994). Norback has recently conducted a study dealing with different aspects of subjective air quality such as temperature, dry air and dust levels and has related these to exposures (Nor- back, 1995). The results show an association with the amount of fabrics in the classroom, the concentration of VOC and relative humidity, and the psychosocial work climate. We have undertaken a number of studies of asth- matic and sick building symptoms among school per- sonnel and pupils and have related these to the school environment and the indoor air quality. In this paper we pkesent the results concerning the subjective air quality in schools as perceived by the personnel in re- ~DepartmentofOccupationaland EnviromnentalMedicine, University Hospital, S-751 85Uppsala, Sweden. Fax +4618519978 THIS ARTIOLE IS FOR INDIVIDUAL USE ONLY AND ~AY NOT ~E FURTHER REPRODUCED OR STORED ELECTRONICALLY NITHOUT HRITTEN '" PERHISSION FROH THE COPYRIGHT HOLDER~ UHAUTHDRZZED R~PRGDUGFEO~ ~AY RESULTed.. IN FINANCIAL AND OTHER PENALTIES. ;
Page 156: 2063633641 Log in for more options!
Smedje, Norb~ick and Edling lation to degree of exposure. The aims of the study were: to study the prevalence of complaints about the indoor air among school personnel, to relate these complaints to factors in the school environment, and to consider the importance of personal and psychosocial factors and domestic exposures. A number of hypotheses were tested. Subjective in- door air quality was assumed to be related to different characteristics of the school building, indoor environ- ment, pollutants in the classroom air, psychosocial fac- tors of the work environment, personal factors, and ex- posures in the home. Material and Methods The Study Population In the county of Uppsala in mid Sweden, there were in 1992 approximately 130 public schools from which we randomly selected 40. The headmasters were asked if they wished their school to participate and 38 schools agreed to do so. The schools varied in respect of factors such as age, construction and size. The small- est had less than 10 employees and 50 pupils, while the largest had almost 100 employees and more than 500 pupils. One third of the schools were situated in the city of Uppsala (117000 inhabitants), one in the town of Enk6ping (19 000 inhabitants) and the others in minor communities or in the countryside. All public employees working in the school buildings were in- vited to participate in the study, regardless of occur pation or number of hours/week at work. In a few schools, cleaning was performed by private contractors whose employees were not included in the study. Information from the Personnel Symptoms were recorded by means of a self-adminis- tered questionnaire mailed in January-February 1993 to the homes of 1652 employees. The questionnaire requested information on per- sonal factors such as age, smoking habits, present dis- eases and symptoms and included questions about domestic exposure to e.g. environmental tobacco smoke and damp in the home. There were also three questions on different aspects of the psychosocial cli- mate at work; general satisfaction, stress, and climate of cooperation. Each of these questions consisted of an analogue rating scale measuring from 0 (minimum) to 1 (maximum). These questions had previously been used by Norback et al. (1990). One question concerned the subjective air quality by asking "How do you perceive the quality of air inside the school?" The possible answers were "very good", "good", "bad" and "very bad". If the quality of air was felt to vary, the subjects were asked to make an assessment of the average quality. The question con- cerned the indoor air quality during the last three months. Assessment of Exposure Between March and June 1993 exposure measurements were performed in the schools. In each school we chose 2-5 classrooms so that the different buildings were rep- resented; a total of 96 classrooms was investigated. We inspected the buildings and noted details of their con- struction, building materials, equipment such as the type of ventilation system, room size, lighting levels, and the presence of open shelves and fabrics. Odours and signs of damp in the construct-ion were also noted. The cleaning staff were asked about their cleaning rou- tines. In each classroom we measured the temperature, relative humidity and rate of air exchange, and the levels of carbon dioxide (CO2), carbon monoxide (CO), nitrogen dioxide (NO2i, formaldehyde, other volatile organic compounds (VOC), respirable dust, moulds, bacteria, settled dust and mite allergen. Respirable dust and CO2 were recorded during 15 minutes by direct reading instruments, the Sibata P- 5H2 and Riken RI 411-A, respectively. The Sibata was calibrated at the factory (Sibata Scientific Technology Ltd.); the Riken was calibrated at the Department of Occupational and Environmental Medicine. Room temperature and air humidity .were recorded by an Assman psychrometer. Dust, CO2, temperature and humidity were measured twice in each classroom, at the end of a lesson. General and local air exchange rates were measured by a tracer gas decay method using acetone as the tracer gas (Anundi et al., 1992). Based on the air exchange rate and the room volume, the supply air rate was calculated. Formaldehyde was measured with glass fibre filters impregnated with 2.4-dinitro-phenylhydrazine (And- ersson et al., 1981) with a sampling rate of 0.2 L/min for 4 h. The filters were analysed by liquid chromato- graphy. VOC were sampled in parallel on beaded char- coal sorbent tubes (SKC Anasorb 747) and coconut charcoal with the same sampling rate and time as for formaldehyde. The charcoal tubes were desorbed with one ml of carbon disulphide, and analysed by gas chromatography and mass spectrometry. Fourteen common compounds were identified and quantified using an external standard technique and selective ion monitoring (SIM). Airborne microorganisms were sampled on 25 mm nucleopore filter with a pore size of 0.4 ~m and a sampling rate of 1.5 L/min for 4 h. The total concentration of airborne microorganisms 144
Page 157: 2063633642 Log in for more options!
Subjective Indoor Air Quality in Schools in Relation to Exposure was determined by the CAMNEA method (Palmgren et al., 1986). Viable moulds and bacteria were deter- mined by incubation on two different media. The de- tection limit of viable organisms was 30 colony form- ing units (cfu) per m3 of air. Nitrogen dioxide was sampled with a passive sam- pling badge obtained from Toyo Roshi Kaisha, Ltd. (Yanagisawa and Nishimura, 1982) and placed in the classroom for 6-7 days after which it was analysed by liquid chromatography. However, following the recom- mendations of Lee et al. (1993), an overall mass trans- fer coefficient of 0.10 cm/s was used. Carbon monox- ide was measured by a passive colorimetric detector tube (Dr~ger 50/a-D) placed in the classroom for the same period as for NO2. Settled dust was collected from desks, chairs and the floor by a 400 W vacuum cleaner provided with a special dust collector from ALK Laboratories, Copen- hagen, containing a Millipore filter (pore size 6 ~m). After passing through a sieve containing a filter with a porosity of 300 gm, the amount of fine dust was de- termined by weighing the filters. The content of major mite allergens in the dust was determined by enzyme immunoassays and by the semi-quantative Acarex test (Bischoff et al., 1992). The measurements were made during normal activi- ties and under representative conditions. If the win- dows were normally kept open during lessons, they were also kept open when the measurements were made. When measuring the rate of air exchange, how- ever, the windows and doors were all closed. Temperature, relative humidity and levels of carbon dioxide, respirable dust and VOC were measured in the outdoor air, using the same methods as those ap- plied indoors. lationships, the relation to subjective air quality was analysed for each degree of room temperature and litre of supply air/person. Relations between different exposure variables were analysed by linear regression. In all the statistical analyses, two-tailed tests and a significance level of 5% were used. Results Questionnaire Data The questionnaire was mailed to 1652 subjects and I410 completed forms were returned, a response rate of 85%. The response rate was 87% for women and 80% for men, a difference which was statistically sigificant. Information about occupation was gathered by the questionnaire. For about two thirds of the study popu- lation, occupation was stated on address lists obtained from the schools, and it was therefore possible to esti- mate that the response rate was significantly higher among teachers than among those with other occu- pations. Those who had filled in the questionnaire but had not been working during the previous three months (49 subjects) were excluded, as were 58 sub- jects who had not answered the question about subjec- tive indoor air quality. The mean age of the subjects was 45 years, and the age range was from 16 to 64 years. Data on personal factors and domestic exposures are given in Table 1. On the analogue rating scale, general satisfaction with work was rated as 0.67, stress at work as 0.55 and climate of cooperation as 0.66. The subjective air quality was rated as bad, or very bad, by 53% of the subjects; the remainder considered it to be good, or very good. There were no significant Statistical Methods Analysis of relations between subjective air quality, questionnaire data and exposures were undertaken with multivariate statistical methods. Multiple logistic regression analysis was performed in several steps using the SPIDA statistical package (Gebski et al., 1992). Regression diagnostics available in the SPIDA package were used to test for collinearity. As a first step, all personal factors and domestic ex- posures were forced into the model. Secondly, non-sig- nificant factors were excluded. Thirdly, all school ex- posure variables were forced into the model one by one, keeping also the significant personal factors and domestic exposures in the statistical models. For total number of moulds and bacteria, logarithmic trans- formations of the raw data were used. In order to detect nonlinear exl~osure-response re- Table 1 Personal factors, domestic exposures and other character- istics of 1 303 school employees Gender, female 76% male 24% Occupation, teacher 54% other 46% Atopy 29%a Hay fever 16% Allergy to pets 9% Childhood eczema 14% Nickel allergy 22% Asthma 8% Smoker, present 19% former 29% Detached/semi detached domestic house 64% • Repainting indoors last year 24% Building dampness 15% Tobacco smoke at home 34% House pet 42% a Hay fever, pet allergy or childhood eczema. 145
Page 158: 2063633643 Log in for more options!
Smedie, Norb~ick and Edling Tabel 2 Subiective air quality in schools as perceived by 1 303 school employees Judgement Women Men Total % % % Very bad 15 13 14 Bad38 39 38 Good 43 45 44 Very good 4 3 4 differences in the ratings of women and men (Table 2). Among those working in schools with natural venti- lation, 49% were dissatisfied, as were 61% of those working in schools with a mechanical exhaust air sys- tem only, 56% of those in mechanically ventilated schools with a mixing flow, and 48% of those in dis- placement ventilated schools. Building Characteristics The mean age of the school buildings was 33 years; the oldest was built around the year 1900, the newest in 1992. The majority of the buildings had 1-2 storeys (82%) and 38% had a basement. Most (63%) were mainly built of stone. Mechanical supply and exhaust air systems, without air-conditioning, were found in 61%, while 27% had natural ventilation. The mean air exchange rate in the classrooms was 5.5 L/s • person, with a range from 0.1 to 22.4 L/s • person. The lowest air exchange rate was in buildings with natural venti- lation only. All the classrooms had hard floor cover- ings, almost all of PVC or linoleum. Eighty-four per- cent had walls of painted plaster. In 19% of the class- rooms there were visible signs of damp or a mouldy odour. All the classrooms had fluorescent strip light- ing; the mean lighting level was 14.8 W/m2. None of the schools had kerosene heating or other sources of indoor combustion. In about 70% of the schools the floors were cleaned once a day with a moistened mop, while 30% were cleaned every second day. The desks were usually wiped once a week. In nearly half the schools there were no routines for washing the cur- rains, while in the others they were usually washed once a year. Exposure Measurements The mean room temperature was 23.5°C but in ap- proximately a quarter of the measurements the tem- perature was 25°C or higher. The concentration of CO2 was above 1 000 ppm in 41% of the measurements. In 55% of the classrooms the concentration of form'alde- hyde was below the detection limit of 5 ~tg/m3. The highest concentrations of VOCs were of (x-pinene, lim- onene and 5-carene, n-un~tecane and n-decane, and toluene and xylene. The highest concentrations of NO2 and CO were found in schools in the city of Uppsala. Smoking was not allowed in any school building apart from in special smoking rooms. The most common microorganisms were Cladosporium, Mycelia sterilia, Penicillium, Yeasts and Pseudomonas. Using monoclonal antibodies, allergens from house dust mites Der p I were found in one sample only and Der f I in none. The Acarex method showed the presence of mites in three schools (Table 3). Data on exposure outdoors by the school is given in Table 4. Subjective Air Quality in Relation to Personal Factors and Domestic Exposure Air quality was perceived as being worse by those who were young, those who had an atopic disposition (hay fever, an allergy to pets or childhood eczema) or an allergy to nickel, those who were teachers, or those who were dissatisfied with the psychosocial climate at work. Air quality was perceived as being better by those who were exposed to tobacco smoke at home or those who had pets (Table 5). There were no significant relations between subjective air quality and gender, Table 3 Exposures in 96 classrooms Exposure factor Arithmetic Min-Max mean Temperature °C) Relative humidity (%) Carbon dioxide (ppm) Formaldehyde (lag/m3) Volatile organic compounds, coconut charcoal (l~g/m3)a Volatile organic compounds, Anasorb 747 (gg/m3)a Nitrogen dioxide (pg/m3) Carbon monoxide (pg/m3) Respirable dust (gg/m3) Total bacteria (103/m3) Viable bacteria (103/m3) Total moulds (103/m3) Viable moulds (103/m3) Settled dust (rag/classroom) 23.5 19.5-27.5 38 16-75 990 425-2 800 6 <5-72 30 1-280 35 2-302 6 1-11 0.2 <0.1-0.9 19 6-60 52 8-290 0.9 0.1-18 40 7-360 0.5 0,1-4.5 172 26-370 Sum of 14 identified VOC. Table 4 Exposures outdoors by 38 schools Exposure factor Arithmetic Min-Max mean Temperature (°C) 12 2-21 Relative humidity (%) 62 39-92 Carbon dioxide (ppm) 425 375-525 Volatile organic compounds, 5 1-25 coconut charcoal (l~g/m3)a Volatile organic compounds, 6 1-24 Anasorb 747 (gg/m3)a Respirable dust (l~g/m3) 10 5-22 a Sum of 14 identified VOC. 146
Page 159: 2063633644 Log in for more options!
Table 5 Personal factors, domestic exposures and psychosocial work climate sigificantly related to subjective air quality in schoolsa Factor Odds ratio CI (95%) Age 0.7b 0.6-0.8b Atopy 1.6 1.2-2.0 Nickel allergy 1.6 1.2-2-1 Environmental tobacco smoke at home 0.9 0.8-0.99 House pet 0.7 0.6-0.9 Stress at work 3.0 1.7-5.3 Cooperation at work 0.3 0.2-0.6 Being a teacher 2.1 1.6-2.6 Analysed by multiple logistic regression. Odds ratio expressed as change of coefficient per 10 years of age. Table 6 School exposures significantly related to subjective air quality in schoolsa Factor Odds ratio CI (95%) Age of building 0.9b 0.9-0.99b Exhaust ventilation 1.8 1.2-2.8 Displacement ventilation 0.7 0.5-0.9 Total moulds 1.9~ 1.3-2.8˘ Total bacteria 1.6˘ 1.1-2.3c Total VOC, coconut charcoal 1.8d 1.1-3.0d Total VOC, Anasorb 747 1.6d 1.1-2.4d Respirable dust 1.3e 1.1-1.5e Settled dust 1.5f 1.1-1.8f Analysed by multiple logistic regression and controlled for per- sonal and psychosocial factors and domestic exposure. Odds ratio expressed as change of coefficient per 10 years. Odds ratio expressed as change of coefficient per 10-fold in- crease of organisms. Odds ratio expressed as change of coefficient per 100 pg/m3. Odds ratio expressed as change of coefficient per 10 ~g/m3. Odds ratio expressed as change of coefficient per 100 mg. smoking habits, wearing of contact lenses, allergy to- wards furry animals, proneness to infection as a child, number of persons in the home, number of small children at home, age of the home, recent repainting, damp or wall-to-wall carpets at home. Subjective Air Quality in Schools in Relation to Characteristics of the School Buildings The air quality was perceived to be better in older buildings and in buildings with a mechanical air sup- ply and exhaust air system operating with the dis- placement principle. It was perceived as being worse in buildings with a mechanical exhaust system (with- out a mechanical air supply) (Table 6). No significant relations were found between subjective air quality and natural ventilation system, mechanical ventilation system with a mixing flow, air exchange rate, visible damp, lighting level, daylight factor, shelf-factor or fleece-factor. Subjective Indoor Air Quality in Schools in Relation to Exposure Subjective Air Quality in Schools in Relation to School Exposures The air quality in schools was perceived to be worse when the concentration of respirable dust, settled dust, total moulds, total bacteria or total VOC was higher (Table 6). When forcing these exposure factors into the statistical model at the same time, only total moulds and total VOC remained significantly related to subjective air quality. Thus, several of the ex- posure factors were correlated with each other. No significant relations were found between subjective air quality and CO2, room temperature, relative air humidity, CO, NO2, formaldehyde, viable moulds, or viable bacteria. Discussion Subjective air quality was significantl~..related to ex- posure to such factors as microorganisms, VOC and dust in the school environment, and to personal fac- tors, including age, at.opic disposition and perceived social climate at work. In all epidemiological studies, problems concerning the validity of the results will arise. One such problem concerns the representativeness of those who have completed the questionnaire compared with those who did not. In this study there was a response rate of 85%, which should be satisfactory, but there were some sig- nificant differences between those who participated and those who did not. Men, and those who were not teachers, were more frequently represented among the non-responders. Since there was no difference between men and women concerning the dependent variable, the difference in response rate between the sexes does not sigificantly affect the results of the study. Our re- sults showed that teachers were those most negative towards the indoor environment; therefore the lower response rate among those in other occupations may have resulted in the proportion of all employees who were dissatisfied with the air quality being slightly overestimated. The question used to characterize subjective air quality was more general than those used by certain other investigator's who asked about several different aspects such as "dry air", "stuffy air", "draught", and/or "hot/cold" (Nordstr6m et al., 1995; Norb~ick, 1995). It may be possible that by formulating the ques- tion as we did, the answers we received did not give us such detailed information, but our question corre- sponded more to people's perceptions since in problem b. uildings the complaints are often expressed as "poor ~ir", "dry air" or even "no air". Our question also cor- responded to the decipol unit for subjective air quality, 147
Page 160: 2063633645 Log in for more options!
Smedje, Norb~ick and Edling which is based on a two-level (acceptable, not accept- able) comprehensive judgement (Fanger, 1988). It may be argued that the subjects" judgement of air quality is really an accumulation of air quality percep- tions over a period of time, and that exposure measure- ments, conducted mainly in the course of one day, are not representative of that period. However, several of the exposure values, including temperature, CO2, res- pirable dust and VOC, are comparable with those re- corded in an earlier study of schools (Norb~ick, 1990), indicating that the environment is relatively stable. More important, since the exposure measurements were performed in randomly chosen classrooms on randomly chosen days, the potential lack of stabilily of the exposures would most probably lead to a non- differential misclassification which would, of course, result in less significant relations between the different exposures and subjective indoor air quality. So the re- lationships found should not have been caused by such potential variations of the exposures. It could also be said that the results can be explained by the subjects drawing a conclusion concerning the quality of air on the basis of visible defects such as obvious damp. There was, however, no significant cor- relation between subjective air quality and visible damp; this explanation thus seems unlikely. The results show that subjects with an atopic dispo- sition or an allergy to nickel were more negative about the indoor air quality in schools than subjects without such allergies. Younger subjects were also more prone to describe the indoor air quality as poor, which may reflect that younger persons have a lower odour threshold (Cometto-Muftiz and Cain, 1991). In this study we were able to confirm that the psychosocial work climate affects the perception of the indoor en- vironment (Norb~ick, 1995; NordstrOm et al., 1995). Those who were exposed to tobacco smoke (ETS) at home were more satisfied with the quality of the air at school; the demands for air quality made by these sub- jects may thus be fairly low. Although there was no significant relation between subjective air quality and smoking, many of those exposed to ETS were smokers themselves (46%). Those who had pets also perceived the subjective air quality as better. It should be noted that this result cannot be attributed to recall bias, since we controlled for allergic disposition. It has been reported from office environments (Stenberg, 1994, Skov et al., 1989) that women are more sensitive than men to poor indoor air. This has been assumed to be partly related to the fact that women and men often have different jobs and different work- ing conditions but we found no significant relatiorr'be- tween subjective air quality and gender. This may re- flect that the working conditions of men and women in schools are relatively similar. In this stud~ age of the building, exhaust ventilation system, and mechanical ventilation with supply air by displacement, were significantly related to subjective air quality. Ventilation by displacement has become widely used in Scandinavia during the last few years. In this type of system the air is supplied through a low velocity diffuser located at floor level, and extracted at ceiling level (SkSret and Mathi~en, 1983). Our results indicate that air quality may vary not only between buildings with mechanical ventilation and buildings with only natural ventilation, but also between build- ings with different types of mechanical ventilation system. Significant relations were found between subjective air quality and exposures to settled and airborne dust, total number of moulds, total bacteria and total VOC. It would thus seem that, even at low concentrations, these pollutants affect the perception of air quality. We have not traced the sources of the microorgan- isms. Visible ~igns of damp or smell were observed in 19% of the classrooms but the common presence of Cla- dosporium implies that there could be outdoor sources as well. Volatile organic compounds were sampled onto two different media (coconut and synthetic charcoal), and significant relations were found with both methods. The concept of total VOC has been questioned, one rea- son being that it includes different compounds with different effects (M61have and Damgaard Nielsen, 1992). Others claim that at these low level concen- trations, different VOCs form together a "'pattern", and that it is this pattern that can be perceived by humans (Berglund et al., 1982; Baird et al., 1987). It is important to investigate in future whether subjective air quality is related to any particular compound or group of com- pounds. Both settled dust and respirable airborne dust were related to perception of poor air quality. We have con- sidered the amount of settled dust collected by stan- dardized vacuum cleaning to be a measure of the stan- dard of cleaning. It is obvious that the cleaning rou- tines in s~hools are less comprehensive than those in, e.g., offices. Since dust may contain allergens or other compounds (Gyntelberg et al., 1994; Munir, 1994), cleaning routines should include not only the floor, but also the desks, chairs and fabrics. Raw et al. (1993) have shown that cleaning of furniture and fabrics sig- nificantly reduced sick building symptoms in an office building. Complaints about poor indoor air quality were not related to the concentration of CO2 or the air exchange 148
Page 161: 2063633646 Log in for more options!
rate. The significance of ventilation is still not known satisfactorily. It seems that at the same level of ex- posure to airborne pollutants, there are fewer com- plaints about poor air quality in naturally ventilated buildings compared to mechanically ventilated build- ings. Since mechanically ventilated buildings have higher air exchange rates, this indicates that the emis- sion of pollutants in these buildings differs consider- ably and is higher. This should be an important area for further research. Conclusions Our results show that subjective air quality in schools, as perceived by the occupants, is related to certain per- sonal, psychosocial and domestic factors. Controlling for these factors, it was found that subjective air qual- ity in schools is still significantly related to measured exposure levels of several airborne compounds. This indicates that complaints about poor indoor air quality are related to deficiences in the indoor environment. Acknowledgements This study was supported by grants from the Swedish Council for Work Life Research. References Andersen, I., Lundqvist, G.R., Jensen, P.L. and Proctor D.F. (1974) "Human response to 78-hour exposure to dry air", Archives of Environmental Health, 29, 319-324. Andersson, K., Hallgren, C., Levin, 5.0. and Nilsson, C.A. (1981) "Chemosorption sampling and analysis of formalde- hyde in air: influence on recovery during the simultaneous sampling of formaldehyde, phenol, furfural and furfuryl alchohol", Scandinavian fournal of Work, Environment and Health, 7, 282-289. Anundi, H., Norb~lck, D., Kinigalakis, G. and Johanson G. (1992) "Simplified measurement of air change rate using acetone as tracer gas". In: Proceedings of 41th Nordic Meeting on Work Environment, Reykjavik, Statens ArbetsmiljOstyrel- se, pp. 227-228 (in Swedish). Baird, J.C., Berglund, B., Berglund, U., Nicander-Bredberg, H. and Noma, E. (1987) "Distinguishing between healthy and sick preschools by chemical classification", Environment In- ternational, 13, 167-174. Berglund, B., Berglund, U., Lindvall, T. and Nicander-Bred- berg, H. (1982) "Olfactory and chemical characterization of indoor air. Towards a psychophysical model for air qual- ity", Environment h~ternationaI, 8, 327-332. Bischoff, E.R.C., Kniest, F.M. and Shirmacher, W. (1992) "Re- sults in dust samples with a new quantitative guanine as- sessment and evaluating of risk groups", Environmental Technology, 13, 377-382. Broder, I., Corey, P. and Pilger, C. (1993) "Influence of volatile organic compounds on the well-being of workers in office buildings". In: Volatile Organic Compounds in the Environ- ment, Indoor Air International, London: Lonsdale Press, pp. 595-604. Subjective Indoor Air Quality in Schools in Relation to Exposure Burge, S., Hedge, A., Wilson, S., Harris-Bass, J. and Robert- son, A.S. (1987) "Sick building syndrome: A study of 4373 office workers", Annals of Occupational Hygiene, 31, 493-504. Cometto-Mufiiz, J.E. and Cain, S.C. (1991) "Influence of air- borne contaminants on olfation and the common chemical sense", In: Getchell, T.V. et al. (eds), Smell and Taste in Health and Disease. New York: Raven Press, pp. 765-785. Fanger, EO. (1988) "Introdution of the olf and the decipol units to quantify air pollution perceived by humans in- doors and outdoors", Energy and Buildings, 12, 1-6. Gebski, V., Leung, O., McNeil, D. and Lunn D. (1992) SPIDA users manual, Version 6, Eastwood, Australia, Statistical Computing Laboratory. Gravesen, S., Larsen, L., Gyntelberg, F. and Skov, P. (1986) "Demonstration of microorganisms and dust in schools and offices", Allergy, 41, 520-525. Gyntelberg, F., Suadicani, P., Wohlfahrt Nielsen, J., Skov, P., ValbjOrn, O., Nielsen, P.A., Schneider, T., JOrgensen, O., Wol- koff, P., Wilkins, C.K., Gravesen, S. and Norn, S. (1994) "Dust and the sick building syndrome", Indoor Air, 4, 223-238. Hudnell, H.K., Otto, D.A., House, D.E. and MOlhave, L. (1992) "Exposure of humans to a volatile organic mixture. II. Sensory", Archives of Environmental Health, 47, 31-38. Lee, K., Yanagisawa, Y., Spengler, J.D., Ozkaynak, H. and Billick LH. (1993) "Sampling rate evaluation of NO2 Badge: (I) in indoor environments", Indoor Air, 3, 124-130. Mendell, M.J. (1993) "Non-specific ~ymptoms in office workers: A review and summary of "the epidemiologic literature", IndoorAir, 3, 227-236. Munir, A.K.M. (1994) Exposure to Indoor Allergens and Relation to Sensitization and Asthma in Children, Sweden, LinkOping University Medical Dissertations, No. 412. (Thesis). MOlhave, L., Bach, B. and Pedersen, O.F. (1986) "Human reac- tions to low concentrations of volatile organic com- pounds", Environment International, 12, 167-175. MOlhave, L. and Damgaard Nielsen, G. (1992) "Interpretation and limitations of the concept "total volatile organic com- pounds" (TVOC) as an indicator of human responses to exposures of volatile organic compounds (VOC) in indoor air", Indoor Air, 2, 65-77. National Institute of Public Health (NIPH) (1994) "The air that we breathe indoors", 1994:16 (in Swedish). Norb/ick, D. (1995) "Subjective indoor air quality in schools - the influence of high room temperature, carpeting, fleecy wall materials and volatile organic compounds (VOC)", In- &or Air, 5(4), 237-246. Norb~ick, D., TorgOn, M. and Edling, C. (1990) "Volatile or-~ ganic compounds, respirable dust, and personal factors re- lated to prevalence and incidence of sick building syn- drome in primary schools", British Journal of Industrial Medicine, 47, 733-741. NordstrOm, K., Norb~ick, D. and Akselsson, R. (1995) "Subjec- tive indoor air quality in hospitals - the influence of build- ing age, ventilation flow, and personal factors", Indoor En- vironment, 4, 37-44. Palmgren, U., StrOm, G., Blomqvist, G. and Malmberg, P. (1986) "Collection of airborne microorganisms on nucleo- pore filters, estimation and anlysis - CAMNEA method", Journal of Applied Bacteriology, 61, 401-406. Raw, G.J., Roys, M.S. and Whitehead, C. (1993), "Sick build- ing syndrome: Cleanliness is next to healthiness", Indoor Air, 3, 237-245. Reinikainen, L., Jaakkola, J.J.K. and Sepp~inen, O. (1992) "The effect of air humidification on symptoms and perception of indoor air quality in office workers: A six-period cross-over trial", Archives of Environmental Health, 47, 8-15. Skov, P., ValbjOrn, O. and DISG (1987) "The "sick" building syndrome in the office environment: The Danish town hall study", Environment hlternational, 13, 339-349. 149
Page 162: 2063633647 Log in for more options!
Smedje, Norb~ck and Edling Skov, P., Valbjorn, O., Pedersen, B.V. and DISG (1989) "Influ- ence of personal characteristics, job-related factors and psy- chosocial factors on the sick building syndrome", Scandi- navian Journal of Work, Enviromnent and Health, 15, 286-295. SkAret, E. and Mathisen, H.M. (1983) "Ventilation efficiency - a guide to efficient ventilation", ASHRAE Transactions, 89, 2B, 490-495. Stenberg, B. (1994) Office Illness - The Worker, The Work and The Workplace, UmeA University Medical Dissertations, New Series No 399. (Thesis) Sundell, J. (1994) On the Association between Building Venti- lation Characteristics, some Indoor Environmental Exposures, some Allergic Manifestations and Subjective Symptom Reports, Indoor Air, Supplement 2. Thorstensen, E., Hansen, C., Pejtersen, J., Clausen, G.H. and Fanger, P.O. (1990) "Air pollution sources and indoor air quality in schools". In: Proceedings of Indoor Air "90, Ottawa, Canada Mortgage and Housing Corporation, Vol. 1, pp. 531-536. Wallace, L.A., Nelson, C.J., Highsmith, R. and Dunteman, G. (1993) "Association of personal and workplace character- istics with health, comfort and odor: A survey of 3948 of- rice workers in three buildings", Indoor Air, 3, 193-205. Yanagisawa, Y. and Nishimura, H. (1982) "A badge-type per- sonal sampler for measurements of personal exposure to NO2 and NO in ambient air", Environment International, 8, 235-242. Zweers, T., Preller, L., Brunekreef, B. and Boleij, J.S.M. (1992) "Health and indoor climate complaints of 7043 office workers in 61 buildings in the Netherlands", Indoor Air, 2, 127-136. 150
Page 163: 2063633648 Log in for more options!
2063633648
Page 164: 2063633649 Log in for more options!
h JOUKNAL OI~ WOMEN'S HEALTH Volume 6, Number 1, 1997 Mary Ann Liebert, Inc. B925 XF11B ~9 OOLD J WOHENS HEALTH 97 ~O~ARĄ AR~ LIEEERT IRO PgBL NY 20-Year The Nurses' Health Study: Contribution to the Understanding of Health Among Women GRAHAM A. COLDITZ, M.D., Dr.P.H., JOANN E. MANSON, M.D., Dr.P.H., and SUSAN E. HANKINSON, R.N., Sc.D. ABSTRACT The Nurses' Health Study was designed as a prospective follow-up study to examine rela- tions between contraception and breast cancer. With follow-up questionnaires mailed every 2 years, investigators have added extensive details of lifestyle practices. The study, currently in its 20th year, has maintained high follow-up with >90% of participants responding to each of the follow-up cycles since 1988. The relations between use of hormones, diet, exercise, and other lifestyle practices have been related to the development of a wide range of chronic ill- nesses among women. This review describes the methods used to follow up the study par- ticipants and summarizes the major findings that have been described over the first 20 years of the study. We highlight additional areas added to the study in recent years to address emerging issues in women's health. Special emphasis is placed on the recent findings from the study, including relations between weight gain and heart disease, diabetes, and mortal- ity, the lack of relation between calcium and ogteoporotic fractures, and the positive relation between postmenopausal use of hormones and risk of breast cancer. INTRODUCTION THE NURSES' HEALTH STUDY COHORT initially comprised 121,700 female registered nurses who returned a mailed questionnaire in 1976. The nurses.were 30-55 years of age, mar- fled, and resided in one of 11 U.S. states (California, Connecticut, Florida, Maryland, Massachusetts, Michigan, New Jersey, New York, Ohio, Pennsylvania, or Texas) according to 1972 files provided by the state boards of nursing and the American Nurses' Association. In June 1976, under the direction of Frank E. Speizer, M.D., principal investigator, an intro- ductory letter, a two-page questionnaire, and a prepaid return envelope were sent to each nurse. Identical materials were mailed in September and December 1976 in an attempt to enlist the participation of previous nonrespon- dents. Overall, 70% of those invited to partici- pate in the study returned questionnaires.1 Funded initially to examine relations be- tween the use of oral contraceptives (OCs), cig- arette smoking, and risk of major illnesses in women, the study has been broadened over time to include the evaluation of health conse- Channing Laboratory, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts. This work was supported by grant CA 40356 from the National Institutes of Health. This manuscript expands on work previously summarized in J Am Med Worn Assoc 1995;50:40. THIS ARTICLE IS FOR INDIVIDUAL USE ONLY AND MAY NOT BE FURTHER REPRODUCED OR STORED ELECTRONICALLY WITHOUT WRITTEN PERMISSION FROM THE COPYRIGHT HOLDER. UNAUTHORIZED REPRODUCTION HAY RESULT IN FINAND~AZ A)~DDTHER PENAlTiES. 49
Page 165: 2063633650 Log in for more options!
5O COLDITZ ET AL. quences of many lifestyle practices, including diet, physical activity, and specific forms of es- trogen replacement therapy. Although the ma- jor source of funding remains the extramural program of the National Cancer Institute (NCI), the wide range of conditions studied has re- sulted in supplemental funding from the National Heart, Lung, and Blood Institute, the National Institute of Diabetes and Digestive and Kidney Diseases, the National Institute of Arthritis and Musculoskeletal and Skin Diseases, and the National Eye Institute. A more recent addition is funding from the National Institute on Aging to study work stress and quality of life. In addition, funding for pilot studies has been received from several pharmaceutical firms and from the National Dairy Council and the Florida Citrus Commission/Florida Department of Citrus. Thh research effort is coordinated by a group of investigators at Harvard Medical School and Harvard School of Public Health, who meet every 2 weeks to review the progress of the component studies and plan analyses and fur- ther research questions. The study was designed as a prospective co- hort investigation to define the relation between OCs and cancer. Based predominantly on data on women's use of OCs marketed dur~." g the 1960s and 1970s, the cohort provides extensive data on the health effects of these early OC for- mulafions. Nurses were chosen because of the higher accuracy of information that they would report than would a broader sample of women. Further, they were expected to understand some of the issues involved in research studies and so participate more readily than women in general. Information was collected from participants while they were free from disease, thus avoid- ing problems of recall of lifestyle factors that plague retrospective studies. Only participants free from disease are followed to examine dis- ease incidence. In an incidence-based follow-up study, the histories of those who subsequently develop disease are compared with the histories of women the same age who remain free from disease. Because we mail follow-up question- naires to all cohort members, women who have been diagnosed with cancer and other major ill- nesses also provide updated information. In the future, as numbers become sufficiently large, we may be able to examine diet, activity, and other lifestyle factors after diagnosis and their relation to survival. After the cohort was established in the initial grant period, additional funding was obtained from the NCI to follow the women to study hypotheses relating cigarette smoking, hair dyes, and postmenopausal hormones to the risk of a range of cancers and cardiovascular dis- eases. FOLLOW-UP OF PARTICIPANTS Follow-up questiormaires are mailed to all cohort members every 2 years. These ques- tionnaires are mailed along with cover letters and a newsletter that updates participants on the progress of the study. Each follow-up ques- tionnaire inquires about a number of exposures as well as the development of cancer, cardio- vascular disease, and other major medical con- ditions diagnosed since the last follow-up. The first follow-up questionnaire is mailed in June of even-numbered years (1978, 1980, 1982, and so on), and those who do not respond are sent a second mailing in September. On average, 80,000 women respond to the first mailing. .Subsequently, we send a third and fourth ques- tionnaire to those who still have not responded. Finally, a fifth mailing Of a short questionnaire that includes only a few key exposure variables and the list of major illnesses is sent. This fifth mailing, which includes a newsletter to update participants, is sent in June of odd-numbered years. This strategy ensures that any change of address is obtained from the post office (whose usual practice is to keep address forwarding or- ders for only 12 months). Most deaths are reported by the subject's next of kin or by postal authorities. These re- ports are supplemented by searches of the National Death Index for deaths among the nonrespondents. Using these methods, we es- timate that more than 98% of deaths in this co- hort have been identified.2 In 1982, we added a telephone follow-up to reach those women who had not responded to any of the five mailings. More than 14,000 women were successfully contacted and com- pleted a brief telephone interview focused on any newly diagnosed illness. Telephone fol-
Page 166: 2063633651 Log in for more options!
NURSES' HEALTH STUDY low-up was repeated after the 1986 follow-up cycle. In 1988, we used a series of additional ap- proaches, including sending questionnaires by UPS and certified mail;3 and achieved a re- sponse of 88%. In 1990 and subsequently, using both telephone and certified mail to reach initial nonresponders, responses were received from just over 90% of the women in the study. Overall, participation has been very high, a trib- ute to the dedication of the women in the study. Each year we are notified of more than 4000 address changes. In addition, some mail is re- turned to us as undeliverable. Using mecha- nisms developed over the last 20 years, we trace these women through direct contact with the local postmaster, the state boards of nurs- ing, and a contact person designated by the study participant (contacts were identified by study members in 1978, 1982, 1986, 1988, and again in 1992). Through these approaches, we have successfully located the majority of par- ticipants with whom we have lost contact at some time. CONFIRMATION OF SELF-REPORTED ILLNESSES For any report of cancer (except basal cell skin cancer), we seek written permission from study participants to review their medical records. We telephone nonrespondents to this request to obtain verbal confirmation of the in- formation reported on the follow-up question- naire (asking details of diagnosis and treat- ment, such as chemotherapy). All medical records are reviewed by trained physicians blinded to exposure information previously provided by the study participant. For women reporting a myocardial infarc- tion or stroke, we also seek the medical records pertaining to the initial diagnosis. Myocardial infarction is classified as confirmed if the records meet the criteria of the World Health Organization, including symptoms and either typical electrocardiogram changes or eleva- tions of serum cardiac enzymes.4 Stroke is alas- sifted according to the criteria developed by the National Survey of Stroke.5 On the 1982 questionnaire, we added an item seeking a history .of fracture of the hip or fore- arm and details regarding the diagnosis of gall- stones and cholecystectomy. Diagnostic details of these major medical conditions have been in- duded on subsequent follow-up question- naires. Using a similar approach, we have added documentation .of self-reported colon polyps and a range of eye conditions, includ- ing cataract surgery, macular degeneration, and glaucoma. After the 1984 follow-up questionnaire cycle, we mailed supplementary questionnaires to all women who had ever responded affirmatively to the question "Have you ever been diagnosed as having diabetes mellitus?" on any of the previous questionnaires. This supplementary questionnaire included items on symptoms of diabetes at the time of diagnosis, fasting and random glucose levels, oral glucose tolerance testing, presence of glycosuria or ketonuria, history of ketoacidosis (including hospitaliza- tion), history of diabetes treatment, and gesta- tional diabetes. Earlier cohort studies conducted in the United Kingdom to document the health con- sequences of cigarette smoking used popula- tions of doctors6 to reduce the likelihood of er- ror in the reporting of illnesses and to facilitate follow-up, as the professional register served as a means to trace the physicians. Similarly, in establishing a large cohort of women, a key consideration was the ability of participants to accurately report the diagnosis of major ill- nesses. Because each reported disease must be confirmed, even a small increase in documen- tation due to erroneous reporting would greatly increase the cost of the study. The ex- tremely accurate reporting of major medical conditions by Nurses' Health Study partici- pants has contributed greatly to the cost-effec- tive nature of this large study. After confirming illnesses reported on the • 1978 and 1980 follow-up questionnaires, we re- ported the level of agreement. Overall, almost all self-reported cancers were confirmed by medical record review.7 Application of strict criteria for cardiovascular end points may re- sult in rejection of some true cases and a slight underestimate of the true incidence of disease, but with few false-positive diagnoses. The reliability of reporting of hypertension, high blood cholesterol, fractures, and diabetes
Page 167: 2063633652 Log in for more options!
has been confirmed in random samples of women. Agreement between self-report and medical records has been high, more than 98% for those conditions. In contrast, for classic con- nective tissue diseases, we were only able to document <20% of cases when applying stan- dard diagnostic criteria as defined by the American College of Rheumatology to infor- mation contained in medical records. STATISTICAL ANALYSIS We perform statistical analyses on data col- lected prospectively from participants in the Nurses' Health Study. All data are analyzed for statistical purposes only, and the confidential- ity of participants is maintained by storing all questionnaire information by identification number only. Names and addresses are stored on a computer system separate from the com- puter that stores questionnaire response data. We use relative risk as a measure of association between exposure (lifestyle variables) and dis- ease. The relative risk, or rate ratio, is calcu- lated as the rate of disease among women in each category of an exposure (e.g., duration of use of OCs) divided by the rate of disease among women in the reference category (e.g., women who have never used OCs). Relative risks are adjusted for age in 5-year intervals. To control simultaneously for age and other po- tential confounding variables, we use either lo- gistic regression or proportional hazards (Cox) models. LIFESTYLE EXPOSURES The design of the Nurses' Health Study in- cludes several unique features. Among these is the repeated assessment of lifestyle and other exposure variables. Such repeated assessment is needed, at least in part, because of the ques- tions being asked by the study. For example, given a focus on OCs and health, we need to update the status of women who are using these or other exogenous hormones, such as those used in postmenopausal hormone ther- apy. The changing availability of products and their patterns of use, such as the addition of COLDITZ ET AL. progesfins to postmenopausal estrogen and varying number of days per month that these products are used, preclude the application of more controlled research designs to address risks associated with current prescribing pat- terns. Likewise, with > 1% of smokers stopping every year, it is necessary to update smoking status on a regular basis to accurately estimate the relation between current smoking and dis- ease as well as the benefits of quitting smok- ing. The repeated measurement of lifestyle al- lows for the study of many factors as they relate to health. Another benefit of repeated ques- tionnaires has been the ability to add items to the follow-up questionnaires to address new and evolving hypotheses. Among the many ad- ditions have been some of the diseases and conditions discussed and such variables as diet, physical activity, and screening behaviors. Several studies have grown out of the ongo- ing Nurses' Health Study: a study of mortality among spouses who use vasectomy as their form of contraception,8 a new study of younger nurses to address questions that we cannot ad- equately answer with the ongoing study, and the establishment of a cohort of children of the younger participants to examine adolescent diet, activity, and excess weight gain. Each study is made possible by the many compo- nents that already exist, including our data pro- cessing methods, software for data manage- ment and analysis, and, for the study of spouses, a population of women already com- mitted to health research. In 1980, a dietary component was added to the follow-up questionnaire. A food frequency questionnaire was pilot tested among study participants during 1979, and based on the re- sults, 61 food items were selected and included in the follow-up questionnaire mailed to all co- hort members in 1980. For each food, a com- monly used unit or portion (e.g., one egg or slice of bread) was specified, and the women were asked how often, on average over the past year, they had consumed that amount of each food. There were in possible responses, rang- ing from "never" to "six or more times per day." We also inquired in detail about the types of fat used in cooking and at the table and about the use of specific vitamin supplements. Nu- trient intakes were compiled by multiplying [ [ [ [ [ [ [ [ [ [
Page 168: 2063633653 Log in for more options!
NURSES' HEALTH STUDY the frequency of consumption of each unit of food by the nutrient content of the specified portions. This food frequency questionnaire has been evaluated extensively for reproducibility and validity. Nutrient intake assessed by this ques- tionnaire was compared with detailed diet records kept by a sample of 194 participants who weighed or measured everything they ate or drank for 4 weeks over the course of a year.9-11 In addition, various nutrients mea- sured in the blood (vitamin E, beta carotene, omega-3 fatty acids) were found to be corre- lated with the questionnaire estimates of in- take.12,13 The instrument's reproducibility was assessed in 1614 women14 and not found to be influenced by obesity or other personal char- acteristics, including cigarette smoking, alcohol intake, or age. These validation studies were crucial in establishing the validity of dietary questionnaires in large-scale studies and re- main the standard for such studies in the field of epidemiology. Since 1980, the food fre- quency questionnaire has been expanded to in- dude approximately 120 individual food items plus vitamin and mineral supplement use that collectively account for >90% of the major nu- trient intakes being measured. This expanded questionnaire was completed by the cohort in 1984, 1986, 1990, and 1994. BIOLOGIC SPECIMENS Toenail samples Because of evidence suggesting that sele- nium may be important in the etiology of can- cer and heart disease, our research group was interested in obtaining selenium exposure lev- els from participants in the cohort. It is not pos- sible to assess selenium intake from a food frequency questionnaire because of high vari- ability of selenium values within specific grains and vegetables as a result of variability in soil selenium content.~5 After validation of the use of toenails as a means to measure body sele- nium levels integrated over an extended pe- riod,16 we invited 92,000 participants to mail a set of 10 toenail clippings following the return of the 1982 follow-up questionnaire. In ~11, 53 68,213 women responded, and their nails are stored in a bank of toenail specimens that have been used in several analyses comparing women who have developed a serious illness during follow-up to a sample of those who have remained free from disease. Blood samples In 1989, the Nurses" Health Study research group was awarded funds to undertake the col- lection of blood specimens from participants in the cohort to address hypotheses related to hor- mone leveis, micronutrients, and risk of breast cancer. The collection of blood specimens was completed over a year-long period. The 1988 questionnaire asked participants if they would be willing to provide a blood sample, and those who indicated yes were sent a blood collection kit. More than .32,000 women participated in this additional phase of the study. Only about 6500 of the participants were premenopausal. Although their blood samples were not col- lected at a specific time in their menstrual cy- cle, the day their current cycle started was recorded on the study questionnaire. The women who provided blood samples were similar to those who did not in terms of both age and body mass index (BMI), although they were slightly less likely to be current cigarette smokers and more likely to be currently using postmenopausal hormones. Samples were sent by overnight delivery to our research labora- tory, where they were centrifuged, labeled, and stored on liquid nitrogen for subsequent nested case-control analyses. We will identify the blood samples from women who subsequently develop breast cancer during follow-up and compare hormone levels with those of controls who have remained free from cancer and are the same age as the women with breast cancer (i.e., a nested case-control analysis). Likewise, when stud3~ing hormones and risk of fractures or antioxidant levels and risk of cataracts or cardiovascular disease, we will identify women who provided blood samples and subsequently developed these conditions and a group of women who remained free from these diseases as a comparison group. Studies among a subset of postmen0pausal participants who provided repeated blood
Page 169: 2063633654 Log in for more options!
54 samples over 3 years have shown that a single blood sample, as obtained from the more than 30,000 women, is a good indicator of blood hor- mone levels over at least the previous 3 years.17 Analyses of hormone levels among post- menopausal participants in this study indicate that with increasing levels of obesity (BMI), higher levels of estrogens are present. For es- trone and estrone sulfate, the correlation was 0.37, and for bioavailable estradiol, it was 0.67.is Prolactin was the only hormone analyzed that was unassociated with BMI. Height was unas- sociated with plasma estrogens or prolactin. Alcohol intake was positively associated with estrone sulfate concentration (r = 0.17). These data suggest that the associations of BMI and al- cohol intake with subsequent breast cancer risk might be mediated, at least in part, through in- fluence on postmenopausal estrogen levels. The possibility of exploring the genetic basis for cancer, as well as other diseases, by assess- ing the stored blood for candidate genes is be- ing undertaken. This is a rapidly changing field, and, at present, it is not clear what the full extent of using blood samples from the co- hort will be. QUALITY OF LIFE AND SOCIAL NETWORKS Over the years, participants have indicated to us through letters returned with question- naires that they have concerns beyond the more directly biologic exposures (such as cigarette smoking and menopause) that we routinely record. In response to their concern, in the fall of 1991 we identified a series of questions to as- sess quality of life using the Medical Outcomes Study SF-36,19 work-related stress (including job demands and control),2° caregiving outside of work, retirement, and other measures of so- cial support or social networks.21 In 1992, we included these questions in the initial June mailing to all participants in the study. More than 70,000 women completed and returned questionnaires with these additional items re- lated to quality of life, thus forming the basis for detailed analyses relating these measures to changes over the life course as these women are followed through the next decade. COLDITZ ET AL. Comparing the mean score for each subscale on the SF-36 against the National Opinion Social Survey-General Social Survey,22 we ob- serve that for working women, the mean scores for nurses were quite comparable to U.S. work- ing women in general. The main difference ap- pears to be that the Nurses' Health Study par- ticipants reported ~gher levels of physical functioning compared with the general popu- lation of working women (Table 1). Initial analyses of the work stress questions show that there is substantial variability even within a single occupation. Inpatient and operating room nurses were more likely to be in high- strain jobs. Outpatient nurses in passive jobs and nurse educators were more likely to be in low-strain jobs or active jobs. Thus, although job demands and control do not measure unique aspects of nursing work, these data sug- gest that they are reasonably differentiating nursing work in expected ways. We also note that when we compare role functioning and vi- tality as measured by the SF-36 across cate- gories of job strain, women with high strain have substantially and significantly lower role physical and role emotional functioning and also lower vitality than women in active jobs. MAJOR FINDINGS AND CONTRIBUTIONS TO WOMEN'S HEALTH The major disease-related findings from the study over the first 18 years of follow-up are summarized in Table 2. Here we set forth the TABLE 1. COMPARISON OF SF-36 SCORES ON THE NATIONAL OPINION RESEARCH CEN'rER'S GENERAL SOCIAL SURVEY aND Ttm NURSES" HEALTH STUDY NORC-General Nurses" Health SI~-36 Subscale Social Survey Study Vitality 63.9 (60.7-67.1) 62.8 (62.5-63.0) Role emotional functioning 85.9 (81.2-90.5) 83.9 (83.5-84.2) Mental health 77.6 (75.0-80.3) 75.7 (75.3-75.9) Bodily pain 74.7 (71.2-78.2) 76.6 (76.3-76.8) Physical functioning 85.3 (82.5-88.1) 89.4 (89.2-89.6) Role physical functioning 87.1 (82.1-92.2) 82.0 (81.6-82.4)
Page 170: 2063633655 Log in for more options!
NURSES' HEALTH STUDY major lifestyle factors and their relations to ma- jor illnesses among women. For each associa- tion, a citation to the full published report is in- cluded. Of note, the study has also made major contributions to the methods of assessing diet and other lifestyle variables that are now in- corporated into many of the more recently cre- ated cohort studies, both in the United States and elsewhere. Many of these have been sum- marized previously.23 The major new findings reported over the past 2 years include a lack of association be- tween dietary calcium intake among post- menopausal women and risk of osteoporotic fractures. Higher intake of calcium from di- etary sources was not protective against frac- tures of the hip or wrist. In addition, a positive relation was observed between protein intake and risk of fractures. Dairy products high in protein and calcium were not protective against fractures. However, we observed a trend toward lower risks among women who consumed higher levels of milk during adoles- cence. We also reported that calcium intake does not protect against risk of colon cancer24 and that the risk of pancreatic cancer falls rapidly after cessation from cigarette smoking.25 Women who have used OCs for ->5 years have under half the risk of ovarian cancer compared with women who never used OCs.26 Impor- tantly, we have made major contributions to the framing of the revised dietary guidelines for Americans. A series of articles addressed the adverse effects of weight gain during adult life. Women who gained substantial weight af- ter age 18 are at significantly increased risk of coronary heart disease (CHD),27 noninsulin-de- pendent diabetes mellitus,2s and total mortal- ity29 compared with women who remained within 5 pounds of their weight at age 18. Based on these results and an extensive body of liter- ature showing physiologic changes with weight gain, the dietary guidelines now place greater emphasis on avoiding weight gain and state "Balance the food you eat with physical activity. Maintain or improve your weight."3° With regard to the use of postmenopausal hormones, we observed that longer use of hor- mones (->5 years) was associated with in- creased risk of breast cancer incidence and 55 mortality.31 Also, we reported that the addition of progestins to estrogen therapy did not re- duce the risk of breast cancer. Consistent with many other studies, early menopause is asso- ciated with substantially lower risk of breast cancer among women who do not take post- menopausal hormones. Current use of post- menopausal hormones continues to protect women against CHD.32 Within this cohort of women up to age 71, almost three cases of breast cancer are diagnosed for every heart at- tack. Other major findings that may lead to greater prevention of chronic illnesses include a de- crease in risk of colon cancer with longer du- rations of use of aspirin.33 The risk reduction was substantial after ->10 years of use. A de- crease in risk of colon cancer with moderate levels of physical activity also offers an impor- tant avenue for prevention. We reported that coffee drinking is not related to risk of CHD. Women consuming ->6 cups of coffee per day had a relative risk of CHD that was 0.95 (95% CI 0.73-1.26) compared with women who did not consume coffee.34 Suicide is less likely among women as level of coffee intake in- creases.3s Also with regard to risk of CHD, we observed that women who had worked rotat- ing shifts for ->6 years were at increased risk. One important feature of the prospective co- hort design is the ability to study total mortal- ity. With this outcome, we can begin to balance the risks and benefits of lifestyle choices, such as use of OCs, smoking, alcohol consumption, and body weight. Other studies that focus on one disease at a time are typically not able to address these important (and, from an indi- vidual perspective, often difficult) tradeoffs. Recent analyses have shown that use of OCs is not related to any overall increase in mortal- ity,36 that increasing body weight is associated with increased risk of mortality from all causes and separately from CHD and from cancer,29 that smoking is associated with increased mor- tality and that risk is reduced after stopping smoking,37 that alcohol is associated with in- creased mortality among women under age 40, and for women over age 50, light to moderate alcohol intake was associated with significant reduction in mortality.3s Importantly/ death from breast cancer was elevated among women
Page 171: 2063633656 Log in for more options!
TABLE 2. MAJOR FINDINGS FROM THE NURSES' HEALTH STUDY, 1976-1996 Breast Ca CHD~/stroke Colon Ca Fracture Diabetes Other diseases Cigarette smoking No relation with Smoking dominant Current Increased risk Increased risk Strong predictor current or past cause of CHD; strong smoking of hip of NIDDMa4a of lung cancer smoking43 dose-response related to fracture suicide,49 and relation44 polyps; strong cataractsSO; relation with risk of total Risk of CHD reduced cancer after mortality for by 14% within 2 30-year latent ex-smokers years of period42 approaches that stopping4s of never smoker after 10-14 Strong relation with years37 ' stroke46 reduced after stopping Smoking smoking~7 cessation Oral contraceptives Current use Current use No increases risks2 increases risksa association54 Past use~little Past use---little association relation Postmenopause hormones Current use for Current use reduces Suggestive >5 years risk of CHD57 decrease in increases risk31 risk of colon cancers4 associated with modest weight gain of about 6 pounds51 No relation with total mortalitya6 No relation with rheumatiod arthritiss6 Decreased risk of ovarian cancer26 No relation with rheumatoid arthritis Progestins added to estrogen therapy do not reduce risk31 Obesity Weak positive relation with incidence among postmenopausal women61 Strong relation, even average weight women at increased risk of CI-ID~2 Weight gain after age 18 associated with increased risk27 Increased risk63 Not examined Reduces risk of hip fracture Strong protection against hip fracture No associationss Not related to risk of NIDDMsa Strong dose- response relation; average weight women at significantly increased risk6~ Increased risk of endometrial cancer Increases risk of systemic lupus erythematosus5~ Increasing risk of cholecystectomy with increasing duration of uses9 Strong relation with gall stones~ and total mortality29
Page 172: 2063633657 Log in for more options!
Alcohol Increasing risk Strong inverse Moderate with increasing relation for CHD; intake drinks per positive relation for increases risk day66 subarachnoid of polyps68 hemorrhage67 Diet Low vitamin A Vitamin E protects Red meat intake associated against CHD73 intake with increased increases risk risk7° but no Trans-fatty acids of cancer7s relation for increase risk of CHD74 vitamin C or E Folate intake associated No relation for Coffee consumption with reduced total fat not related to risk risk of polyps68 intake7~ of CHD34 Monounsaturated Calcium intake fat intake not related to inversely related risk of polyps76 or to colon to risk of breast cancer24 cancer No relation with selenium72 Other exposures Atypical 1-6 aspirin per Aspirin use (>-20 hyperplasia week reduces risk years) associated with of CHEPa reduces risk33 increased risk82 Family history accounts for 6% of breast cancer~3 Use of hair dyes not related to risks4 First pregnancy increases risk of breast cancer in short term but decreases risk long term; closer spacing of births associated with lower riskss History of adult- onset diabetes increases risk of CHD and strokes7 Taller women have lower riskss Rotating shift work increases risk of CHIY9 L~98~9890G ,Family history increases risk up to 4-fold among women <509o Leisure time physical activity reduces risk of colon cancer91 Increased risk of hip fracture with moderate intake6~ No reduction in risk with higher dietary calcium intake~V; dietary protein associated with increased risk78 Caffeine intake positively related to risk of hip and forearm fracture~9 Taller women more likely to have hip fractures92 Weight gain after age 18 significantly increases risk2~ Strong inverse dose-resj~onse relation°~ Magnesium intake inversely related to risk79 No relation with fat intake or total carbohydrate Vigorous activity at least once per week reduces risk93 Reduced risk of total mortality among older women~8 Dietary vitamin A intake associated with reduced risk of cataractsso Antioxidant supplements-- no important relation to asthma81 Coffee intake inversely related to suicide35 Tubal ligation halves risk of ovarian cancer93 Number of blistering sun- burns before age 20 positively related to risk of melanoma9s Breast implants not related to risk of connective tissue disease Use of hair dyes not related to risk of hematopoietic cancerssl ~CHD, coronary heart disease; NIDDM, noninsulin-dependent diabetes mellitus.
Page 173: 2063633658 Log in for more options!
consuming more than a drink per day, and death from cardiovascular disease was reduced among women with this level of intake. The contribution of genetics to most major chronic diseases remains small. For breast can- cer, for example, perhaps 6%-10% can be at- tributed to inherited genetic factors.39 A simi- lar estimate may prevail for colon cancer and for heart disease. Thus, the study of lifestyle factors acting in the broader population is more useful in identifying areas for prevention in the general population than merely focusing on the high-risk subgroups for specific diseases. With additional follow-up, the numbers of cases available for study has increased, allow- ing application of new biomathematical mod- els to the analysis of breast and lung cancer. These analyses allow us to better understand the interrelationships between particular life- st3fle habits or exposures, the timing of these exposures, and the subsequent risk of cancer.4° Among the methodologic advances made in the Nurses" Health Study, the repeated mea- sures of diet, hormone use, physical activity, body weight, and cigarette smoking have be- come the standard for modern studies among women. Of particular note is the need for re- peated measures when studying behaviors, such as postmenopausal hormone use, with changing products and patterns of use that pre- clude the application of more controlled re- search designs to address risks associated with current prescribing patterns. One concern when interpreting the results from the Nurses' Health Study is their internal validity. This point has been addressed, as noted, through extensive validation of reported lifestyle measures and careful documentation of disease outcomes. Once internal validity is established, issues of generalizability must be considered. The participants are predomi- nantly white women, reflecting the ethnic back- ground of women who trained as registered nurses through the 1960s.41 At entry, their level of cigarette smoking was comparable to U.S. national data for women, and their use of OCs is comparable to that of their birth cohorts.23 Their experiences (and age distribution) of menopause could not conceivably be altered by their training, as registered nurses. Further, their reproductive histories are similar to na- COLDITZ ET AL. tional census data, and correspondingly, their rates of breast cancer are very close to those ex- pected based on the national Surveillance, Epidemiology, and End Results age-specific rates. Data on occupational work stress is com- parable to that of other studies, and the qual- ity of life measures reported in 1992 reflect the patterns observed in the national reference study. Based on data such as these, we con- clude that the cohort reflects the relations be- tween lifestyle and health of white women in general. Thus, although they come from a pro- fessional group, their training in large part serves as an advantage, in all likelihood re- moving socioeconomic and other barriers to ac- cess to health care. If such barriers existed, it would be possible that women with specific lifestyle characteristics may be less likely to be diagnosed with d.isease, not because of the lifestyle but because of their access to care. This factor could then substantially distort relations, giving biased results. Women from ethnic groups other than Caucasian are not well rep- resented in this cohort. Thus, when findings are expected to vary due to some underlying bio- logic difference among ethnic groups, which will be rare, those women will need to be specifically studied. The Nurses' Health Study, the largest and longest ongoing cohort study of lifestyle and health that is focused on women, is a tribute to the commitment of its participants over the 20 years of the study to date and the foresight of Frank Speizer, M.D., who initiated pilot stud- ies for the cohort >24 years ago. Components of the study, such as the collection of blood samples, have been possible only because of the education and professional experience of its participants, in addition to their willingness to give of their time to the research effort. (As a token of appreciation and in recognition of their excellent record of participation, Harvard Medical School and the Brigham and Women's Hospital jointly awarded to each participant a 20th Anniversary Certificate of Appreciation in June 1996.) Long-term follow-up with high participa- tion, as exemplified by the Nurses' Health Study, is essential to providing valid estimates of the relations between lifestyle and. risk of chronic diseases. For cancer, behaviors may act
Page 174: 2063633659 Log in for more options!
NURSES' HEALTH STUDY as initiators (cigarette smoking and colon can- cer risk),42 promoters (red meat for colon can- cer), or proliferators (estrogens for breast can- cer). Repeated measures and long-term follow-up permit a detailed understandin~ of these relations. The detailed history of use of vitamin supplements, at different doses and over varying durations, adds a richness to the data that cannot be obtained through a ran- domized study in which the dose and duration are predetermined (and are perhaps more or less than ideal). This unique feature will allow the identification of the dietary and other lifestyle factors that are most beneficial to women in terms of morbidity, mortality, and quality of life as the study continues through the coming years. Through the Nurses' Health Study, many im- portant advances have been made in under- standing the etiology and prevention of major illnesses among women. Before the Women's Health Initiative began, the Nurses" Health Study study was the largest and most compre- hensive study of health among women. It re- mains the most detailed study of diet and ma- jor illnesses, providing details on many components of lifestyle updated over the years. This unique study will continue to shed light on the causes and prevention of disease and the fea- tures of healthy aging over the coming years. Needless to say, this all reflects the enormous contribution made by over 120,000 registered nurses who entered the study 20 years ago. ACKNOWLEDGMENTS The continuing commitment of the study participants is g(atefully acknowledged. The investigators on the Nurses' Health Study have made major contributions over the years. Gur- rent members of the study team include Cath- erine Berkey, Celia Byrne, Carlos Camargo, Vincent Carey, Gary Chase, Graham Colditz, Karen Corsano, Gary Curhan, Barbara Egan, Diane Feskanich, Lindsay Frazier, Charles Fuchs, Edward Giovannucci, Francine Grodstein, Susan Hankinson, Charles Hennekens, David Hunter, JoAnn Manson, Stefanie Parker, Cathy Rexrode, Janet Rich-Edwards, Bernard Rosner, Caren Solomon, Meir Stampfer, Harry Taplin, 59 Waiter Willett, and Frank E. Speizer (principal investigator). REFERENCES 1. Barton J, Bain C, Hennekens CH, et al. Characteristics of respondents and non-respondents to a mailed questionnaire. Am J Public Health 1980;70:823. 2. Stampfer M-J, Willett WC, FE, et al. Test of the National Death Index. Am J Epidemiol 1984;119:837. 3. Rimm EB, Stampfer MJ, Colditz G, Giovannucci E, Willett WC. Effectiveness of various marling strate- gies among nonrespondents in a prospective cohort study. Am J Epidemiol 1990;131:1068. 4. Rose GA, Blackburn H. Cardiovascular survey meth- ods. WHO Monograph Series No. 58. Geneva: World Health Organization, 1982. 5. Walker AE, Robins M, Weinfeld FD. The National Survey of Stroke. Clinical findings. Stroke 1981;12(2 Part 2 Suppl 1):I13. 6. Doll R, Hill A. Lung cancer and other causes of death in relation to smoking. A second report on the mor- tality of British doctors. Br Med J 1956 (November 10):1071. 7. Colditz GA, Martin P, Stampfer MJ, et al. Validation of questionnaire information on risk factors and dis- ease outcomes in a prospective cohort study of women. Am J Epidemiol 1986;123:894. 8. Giovannucci E, Tosteson T, Speizer F, Vessey M, Colditz G. A long-term study of mortality in men who have undergone vasectomy. N Engl J Med 1992;326: 1392. 9. Willett WC, Sampson L, Stampfer MJ, et al. Reproducibility and validity of a semiquantitative food frequency questionnaire. Am J Epidemiol 1985; 122:51. 10. Hunter DJ, Sampson L, Stampfer M~, Colditz GA, Rosner B, Willett WC. Variability in portion sizes of commonly consumed foods among a population of women in the United States. Am J Epidemio11988;127: 1240. 11. Salvini S, Hunter DJ, Sampson L, et al. Food-based validation of a dietary questionnaire: The effects of week-to-week variation in food consumption. Int J Epidemiol 1989;18:858. 12. Wiliett WC, Stampfer MJ, Underwood BA, Speizer FE, .Rosner B, Hennekens CH. Validation of a dietary questionnaire with plasma carotenoid and alpha-to- copherol levels. Am J Clin Nutr 1983;38:631. 13. Willett WC. Nutritional epidemiology. New York: Oxford University Press, 1990. 14. Colditz GA, Willett WC, Stampfer MJ, et al. The in- fluence of age, relative weight, smoking, and alcohol intake on the reproducibility of a dietary question- naire. Int J Epidemiol 1987;16:392. 15. Ullrey DE. Selenium in the soil-plant-food chain. In: Spallhotz JE, et al., eds. Selenium in biology and med- icine. Westport, CT: AVI Publishing, 1981:176.
Page 175: 2063633660 Log in for more options!
6O 16. Morris JS, Stampfer MJ, Willett WC. Dietary selenium in humans: Toenails as an indicator. Boil Trace Ele- ment Res 1983;5:529. 17. Hankinson S, Manson J, Speigelman D, Willett W, Longcope C, Speizer F. Reproduci.bility of plasma hormone levels in postmenopausal women over a 2-3 year period. Cancer Epidemiol Biol Prey 1995;4:649. 18. Hankinson SE, Willett WC, Manson JE, et al. Alcohol, height, and adiposity in relation to estrogen and pro- lactin levels in postmenopausal women. J Nat Cancer Inst 1995:1297. 19. Ware J, Snow K, Kosinski M, Gandek B. SF-36. Manual and interpretation guide. Boston: The Health Institute, New England Medical Center, 1993. 20. Karasek R, Theorell T. Health work: Stress, produc- tivity, and the reconstruction of working life. New York: Basic Books, 1990. 21. Berkman LF, Syme SL. Social networks, host resis- tance and mortality: A nine-year follow-up study of Alameda County residents. Am J Epidemio11979;109: 186. 22. Thalji L, Haggerty CC, Rubin R, Berckmans TR, .Pardee BL. National survey of junctional health sta- tus: Final report. Chicago: National Opinion Research Center, 1991. 23. Colditz GA. The Nurses' Health Study: Findings dur- ing 10 years of follow-up of a cohort of US women. Curt Probl Obstet Gynecol Fertil 1990;13:129. 24. Martinez M, Giovannucci E, Colditz G, et al. Calcium, vitamin D, and the occurrence of colorectal cancer among women. J Natl Cancer Inst 1996;88:1375. 25. Fuchs C, Colditz G, Stampfer M, et al. A prospective study of cigarette smoking and the risk of pancreatic cancer. Arch Intern Med 1996;156:2255. 26. Hankinson S, Colditz G, Hunter D, et al. A prospec- tive study of reproductive factors and risk of epithe- lial ovarian cancer. Cancer 1995;76:284. 27. Willett WC, Manson JE, Stampfer MJ, et al. Weight, weight change, and coronary heart disease in women: Risk within the "normal" weight range. JAMA 1995; 273:461. 28. Colditz GA, Willett WC, Rotnitzky A, Manson JE. Weight gain as a risk factor for clinical diabetes in women. Ann Intern Med 1995;122:481. 29. Manson JE, Willett WC, Stampfer MJ, et al. Body weight and mortality among women. N Engl J Med 1995;333:677. 30. U.S. Department of Agriculture. Repo.rt of the dietary guidelines advisory committee on the dietary guide- lines for Americans, 1995. To the Secretary of Health and Human Services and the Secretary of Agriculture. Washington, DC: U.S. Department of Agriculture, 1995. 31. Colditz GA, Hankinson SE, Hunter DJ, et al. The use of estrogens and progestins and the risk of breast can- cer in postmenopausal women. N Engl J Med t995; 332:1589. 32. Grodstein F, Stampfer M, Manson J, et al. Post- menopausal estrogen and progestin use and the risk of cardiovascular disease. N Engl J Med 1996;335:453. COLDITZ ET AL. 33. Giovannucci E, Egan KM, Hunter DJ, et al. Aspirin and the risk of colorectal cancer in women. N Engi J Med 1995;333:609. 34. Willett W, Stampfer M, Manson J, et al. Coffee con- sumption and coronary heart disease in women: A ten-year follow-up. JAMA 1996;275:458. 35. Kawachi I, Willett W; Colditz G, Stampfer M, Speizer F. A prospective study of coffee drinking and suicide in women. Arch Intern Med 1996;156:521. 36. Colditz G, for the NHS Research Group. Oral contra- ceptive use and mortality during twelve years of fol- low-up: The Nurses' Health Study. Ann Intern Med 1994;120:821. 37. Kawachi I, Colditz GA, Stampfer MJ, et al. Smoking cessation in relation to total mortality rates in women: A prospective cohort study. Ann Intern Med 1993; 119:992. 38. Fuchs CS, Stampfer M-J, Colditz GA, et al. Alcohol consumption and mortality among women. N Engl J Med 1995;332:1245. 39. King M-C, Rowell S, Love SM. Inherited breast and ovarian cancer. What are the risks? What are the choices? JAMA 1993;269:1975. 40. Rosner B, Colditz G. Extended mathematical model of breast cancer inddence 'in the Nurses" Health Study. J Natl Cancer Inst 1996;88:359. 41. Roth A, Graham D, Schmittling G. National sample survey of registered nurses (1977). A report on the nurse population and factors affecting their supply. Hyattsville: Public Health Service, 1977. 42. Giovannucd E, Colditz GA, Stampfer MJ, et al. A prospective study of cigarette smoking and risk of col- orectal adenoma and colorectal cancer in U.S. women. J Natl Cancer Inst 1994;86:192. 43. London SJ, Colditz GA, Stampfer MJ, Willett WC, Rosner BA, Speizer FE. Prospective study of smoking and the risk of breast cancer. J Natl Cancer Inst 1989; 81:1625. 44. Willett WC, Green A, Stampfer MJ, et al. Relative and absolute excess risks of coronary heart disease among women who smoke cigarettes. N Engl J Med 1987;317: 1303. 45. Kawachi I, Colditz G, Stampfer M, et al. Smoking ces- sation and time course of decreased risk of coronary heart disease in women. Arch Intern Med 1993; 154:169. 46. Colditz GA, Bonita R, Stampfer MJ, et al. Cigarette smoking and risk of stroke in middle-aged women. N Engl J Med 1988;318:937. 47. Kawachi I, Colditz G, Stampfer M, et al. Smoking ces- sation and decreased risk of stroke in women. JAMA 1993;269:232. 48. Rimm EB, Manson JE, Stampfer MJ, et al. Cigarette smoking and the risk of diabetes in wombn. Am J Public Health 1993;83:211. 49. Hemenway D, Sondick S, Colditz G. Smoking, sui- cide, and nurses. Am J Public Health 1993;83:249. 50. Hankinson SE, Willett WC, Colditz GA, et al. A prospective study of smoking and risk of. cataract surgery in women. JAMA 1992;268:994. cO O~ 0
Page 176: 2063633661 Log in for more options!
NURSES' HEALTH STUDY 51. Kawachi I, Troisi R, Rotnitzky A, Coakley E, Speizer F, Colditz G. A prospective study of smoking cessa- tion and weight change in women. J Smoking Rel Dis 1994;5(Suppl 1):91. 52. Romieu L Willett WC, Colditz GA, et al. A prospec- tive study of oral contraceptive use and the risk of breast cancer in women. J Natl Cancer Inst 1989;81: 1313. 53. Stampfer MJ, Willett WC, Colditz GA, Speizer ICE, Hennekens CH. A prospective study of past use of oral contraceptive agents and risk of cardiovascular diseases. N Engl J Med 1988;319:1313. 54. Chute CG, Willett WC, Colditz GA, Stampfer MJ, Rosner B, Speizer IrE. A prospective study of repro- ductive history and exogenous estrogens on the risk of colorectal cancer in women. Epidemiology 1991;2: 201. 55. Rimm E, Manson J, Stampfer M, et al. Oral contra- ceptive use and the risk of non-insulin-dependent di- abetes mellitus in a large prospective study of women. Diabetologia 1992;35:967. 56. Hernandez-Avfla M, Liang MH, Willett WC, et al. Exogenous sex hormones and the risk of rheumatoid arthritis. Arthritis Rheum 1990;33:947. 57. Stampfer MJ, Colditz GA, Willett WC, et al. Postmenopausal estrogen therapy and cardiovascular disease. N Engl J Med 1991;325:756. 58. Manson J, Rimm E, Colditz G, et al. A prospective study of postmenopausal estrogen therapy and sub- sequent incidence of noninsulin-dependent diabetes mellitus. Ann Epidemiol 1992;2:665. 59. Sanchez-Guerrero J, Liang M, Karlson E, Hunter D, Colditz G. Postmenopausal estrogen therapy and risk of developing systemic lupus erythematosus. Ann Intern Med 1995;122:430. 60. Grodstein F, Colditz G, Stampfer M. Postmenopausal hormone use and cholecystectomy in a large prospec- tive study. Obstet Gynecol 1994;83:5. 61. London SJ, Colditz GA, Stampfer MJ, Willett WC, Rosner B, Speizer FE. Prospective study of relative weight, height and the risk of breast cancer. JAMA 1989;262:2853. 62. Manson JE, Colditz GA, Stampfer MJ, et al. A prospec- tive study of obesity and risk of coronary heart dis- ease in women. N Engl J Med 1990;332:882. 63. Chute C, Willett W, Colditz G, et al. A prospective study of body mass, height, and smoking on the risk of colorectal cancer in women. Cancer Causes Control 1991;2:117. 64. Colditz Ga, Willett WC, Stampfer MJ, et al. Weight as a risk factor for clinical diabetes in women. Am J Epidemiol 1990;132:501. 65. Maclure KM,-Hayes KC, Colditz GA, Stampfer MJ, Speizer FE, Willett WC. Weight, diet and risk of symp- tomatic gallstones in middle-aged women. N Engl J Med 1989;321:563. 66. Willett WC, Stampfer MJ, Colditz GA, Rosner BA, Hennekens CH, Speizer FE. Moderate alcohol con- sumption and the risk of breast cancer. N Engl J Med 1987;316:I174. 61 67. Stampfer MJ, Colditz GA, Willett WC, et al. A prospective study of moderate alcohol drinking and risk of diabetes in women. Am J Epidemiol 1988; 128:549. 68. Giovannucci E, Stampfer MJ, Colditz GA, et al. Folate, methionine and alcohol intake and risk of colorectal adenoma. J Natl Cancer Inst 1993;85:875. 69. Hernandez-Avila M, Colditz GA, Stampfer MJ, Rosner B, Speizer FE, Willett WC. Caffeine, moderate alcohol intake and risk of fractures of the hip and fore- arm among middle-aged women. Am J Clin Nutr 1991;54:157. 70. Hunter DJ, Manson JE, Colditz GA, et al. A prospec- tive study of intake of vitamins C, E and A and risk of breast cancer. N Engl J Med 1993;329:234. 71. Willett WC, Hunter DJ, Stampfer MJ, et al. Dietary fat and fiber in relation to risk of breast cancer. An eight- year follow-up. JAMA 1992;268:2037. 72. Hunter DJ, Morris JS, Stampfer MJ, Colditz GA, Speizer FE, Willett WC. A prospective study of sele- nium status and breast cancer risk. JAMA 1990; 264:1128. 73. Stampfer MJ, Hennekens CH, Manson JE, Colditz GA, Rosner B, Willett WC. A prospective study of vitamin E consumption and risk of coronary disease in women. N Engl J Med 1993;328:1444. 74. Willett WC, Stampfer MJ, Manson JE, et al. Trans-fatty acid intake in relation to risk of coronary heart dis- ease among women. Lancet 1993;341:581. 75. Willett WC, Stampfer MJ, Colditz GA, Rosner BA, Speizer irE. Relation of meat, fat and fiber intake to colon cancer risk in a prospective study among women. N Engl J Med 1990;323;1664. 76. Kampman E, Giovannucci E, van't Veer P, et al. Calcium, vitamin D, dairy foods and the occurrence of colorectal adenomas among men and women in two prospective studies. Am J Epidemiol 1994;139:16. 77. Feskanich D, Colditz G, Stampfer M, Willett W. Dietary calcium and bone fractures in middle-aged women. [Abstract] Am J Epidemiol 1994;139:$35. 78. Feskanich D, Willett W, Stampfer M, Colditz G. Protein consumption and bone fractures in women. Am J Epidemiol 1996:143:472. 79. Colditz G, Manson J, Stampfer M, Rosner B, Willett W, Speizer F. Diet and risk of clinical diabetes in women. Am J Clin Nutr 1992;55:1018. 80. Hankinson SE, Stampfer MJ, Seddon JM, et al. Nutrient intake and cataract extraction in women: A prospective study. Br Med J 1992:305:335. 81. Troisi R, Willett W, Weiss S, Trichopoulos D, Rosner B, Speizer F. A prospective study of diet and adult- onset asthma. Am J Respir Crit Care Med 1995;151: 1401. 82. London SJ, Connolly JL, Schnitt SJ, Colditz GA. A prospective study of benign breast disease and the risk of breast cancer. JAMA 1992:267:91. 83. Colditz GA, Willett WC, Hunter DJ, et al. Family his- tory, age and risk of breast cancer: Prospective data from the Nurses' Health Study. JAMA 1993;270:338. " 84. Green A, Willett WC, Colditz GA, et al. Use of per-
Page 177: 2063633662 Log in for more options!
62 manent hair dyes and risk of breast cancer. J Natl Cancer Inst 1987;79:253. 85. Rosner B, Colditz GA, Willett WC. Reproductive risk factors in a prospective study of breast cancer: The Nurses" Health Study. Am ] Epidemiol 1994;139:819. 86. Manson J, Stampfer M, Colditz G, et al. A prospec- tive study of aspirin use and primary prevention of cardiovascular disease in women. JAMA 1991;266: 521. 87. Manson JE, Colditz GA, Stampfer MJ, et al. A prospec- tive study of maturity-onset diabetes mellitus and risk of coronary heart disease and stroke in women. Arch Intern Med 1991;151:1141. 88. Rich-Edwards J, Manson J, Stampfer M, et al. Height and the risk of cardiovascular disease in women. Am ] Epidemiol 1995;142:909. 89. Kawachi I, Colditz G, Stampfer M, et al. Prospective study of shift work and risk of coronary heart disease in women. Circulation 1995;92:3178. 90. Fuchs CS, Giovannucci EL, Colditz GA, Hunter DJ, Speizer FE, Willett WC. A prospective study of fam- ily history, age, and diet and colorectal cancer. N Engl J Med 1994;331:1669. 9~. Martinez ME, Giovannucci E, Spiegelman D, et al. COLDITZ ET AL. Physical activity, body size, and colorectal cancer in women. Am J Epidemiol 1996;143:$73. 92. Hemenway D, Feskanich D, Colditz G. Body height and hip fracture: A cohort of 90,000 women. Int J Epidemiol 1995;24:783. 93. Manson JE, Rimm EB, Stampfer MJ, et al. A prospec- tive study of physical activity and the incidence of non-insulin-dependent diabetes mellitus in women. Lancet 1991;338:774. 94. Hankinson SE, Hunter DJ, Colditz GA, et al. Tubal ligation, hysterectomy and risk of ovarian cancer: A prospective study. JAMA 1993;270:2813. 95. Weinstock MA, Colditz GA, Willett WC, et al. Non- familial cutaneous melanoma incidence in women is associated with sun exposure before 20 years of age. Pediatrics 1989;84:199. Address reprint requests to: Graham A. Colditz, M.D. Nurses" Health Study Channing Laboratory 181 Longwood Avenue Boston, MA 02115
Page 178: 2063633663 Log in for more options!
206~6~66~
Page 179: 2063633664 Log in for more options!
HUTAT RE$-FUND MOL tq 97 ~- tO~ELSEVZF..~ SCZENCE 8V NE ~ Fundamental and Molecular Mechanisms of Mutagenesis ELSEVIER Mutation Research 376 (1997) 135-142 Polymorphisms of CYP1A1 and GSTM1 influence the in vivo function of CYPIA2 Stewart MacLeod a, Rashmi Sinha b, Fred F. Kadlubar c, Nicholas P. Lang d,* University of Arkansas for Medical Sciences. Little Rock, AR 72205, USA b National Cancer Institute, NIH, Bethesda, MD, USA = National Center for Toxicological Research, Jefferson, AR, USA a JLM Veterans Affairs Medical Center and Unicersity of Arkansas for Medical Sciences, Little Rock, AR 72205, USA Accepted 18 June 1996 Abstract - Differences in human cancer susceptibility have been attributed to polymorphisms of carcinogen metabolizing enzymes. Our efforts have focused on the systems responsible for metabolism of aromatic and heterocyclic amines found in cigarette smoke and in cooked foods. Cytochrome P4501A2 (CYP1A2), which catalyzes aromatic and heterocyclic amine N-oxida- tion, has been implicated as a risk factor in both urinary bladder and colorectal cancer. In the present study we used the results of caffeine to the effects of cigarette smoke and in meat phenotyping experiments measure compounds present cooked at high temperature on CYP1A2 activity. Subjects in the smoking cessation study had mean CYP1A2 activity of 17.8 (expressed as the urinary molar ratio of [17X + 17U]/137X) while smoking; however, this activity decreased to 10.9 three weeks after cessation of smoking. Subjects in the cooked meat feeding study had mean CYP1A2 activity of 9.01 after 1 week of consuming meat cooked at low temperature, but this value increased to 12.7 after I week of consuming meat cooked at high temperature. Because no association has been identified between differences in CYP1A2 activity and variations in the CYP1A2 structural gene, we sought to determine whether the activities of other carcinogen metabolizing enzymes are involved in the regulation of CYP1A2 activity. CYP1A2 activity was higher in individuals who express the GSTM 1 null allele compared to those expressing the GSTMI*A,B allele, 10.2 vs. 8.5 for unexposed conditions and 15.0 vs. 12.3 for exposed conditions. CYPIA1 genotyping demonstrated that individuals possessing the Ile/Ile CYP1A1 genotype had greater mean CYP1A2 activity than those who had the heterozygous Ile/Val alletic variant of the CYP1A1 However, to gene. upon exposure cigarette smgke or high-temperature cooked meat, individuals possessing the heterozygous form of the CYPIA1 gene had significantly increased CYP1A2 activity (18.1) compared to those with the more common Ile/Ile CYP1A1 genotype (I 3.3). These results indicate that CYPIA2, CYP1A1, and GSTMI gene-gene interactions could be important confounders in the interpretation of molecular epidemiology studies. Keywords: Cytochrome P4501A1; Cytochrome P4501A2; Glutathione S-transferase M1; Polymorphism Abbreviations: CYP1A2: Cytochrome P4501A2; CYPIAI: Cytocbxome P4501A1; NAT2: N-acetyltransferase-2; 17X: 1,7-dimethyl xanthine; 17U: 1,7-dimethyl uracil; 137X: caffeine; GSTMI: Glutathione S-tr~nsferase M1; Ile/Val: Isoleucine/Valine; Ile/Ile: Isoleucine/Isoleucine; GSH: glutathione • Corresponding author. Tel.: + I 501-660-2038; Fax: + 1 501-671-2523; E-mail: smacleod@acre.uams.edu 0027-5107/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved. PII S0097-5107(97)00036-5 THIS ARTICLE IS ~=OR IN - DIVIDUAL USE ONLY AND MAY NOT BE FURTHER REPRODUCED OR STORED ELECTRONICALLY NITHOUT I~R~'TTEN PERNISSION FROH THE COPYRIGHT HOLDER. • UNAUTHORIZED REPRODUCTION HAY RESULT IN FINANCIAL AND OTHER PENALTIES.
Page 180: 2063633665 Log in for more options!
136 S. MacLeod et al. / Mutation Research 376 (1997) 135-142 1. Introduction Current evidence makes clear the inaccuracies of risk assessment following exposure to a chemical carcinogen without a concomitant evaluation of the metabolic pathways of activation and detoxification. These pathways exhibit both species and tissue specificity that may seriously weaken the role of extrapolation of data in one system to risk projec- tions in another tissue or species. There may also be interactions among these pathways that further com- plicate interpretation of risk data. Enzymes involved in the metabolism of carcinogens have been shown to exhibit a number of different polymorphisms that can affect their expression levels or catalytic activity. Nucleotide variations in the coding regiorr of a gene that lead to an amino acid substitution in the protein can alter enzymatic activity or substrate binding in a positive or negative manner (Gonzalez, 1989). Dele- tion of all or part of the coding region can lead to the production of an inactive enzyme (Blum et al., 1989) or can result in a total lack of protein synthesis (Seidegard et al., 1988). Polymorphisms in the non- coding region can affect transcriptional control ele- ments involved not only in basal enzyme expression (Nakachi et al., 1991) but can also disrupt the mech- anism of induction observed for many of these en- zymes (Gonzalez and Gelboin, 1993). Additionally, variations in the polyadenylation signal of a gene can result in changes in transcript polyadenylation thus affecting transcript half-life and indirectly affecting the quantity of enzyme produced (Bell et al., 1995). In this study we have focused on the enzymes which metabolize aromatic and heterocyclic amines found in cigarette smoke and in meat cooked at high temperatures.. Human exposure to these compounds has been implicated as a risk factor for colorectal cancer (Lang et al., 1994). Heterocyclic and aromatic amines are initially N-oxidized by the action of cytochrome P4501A2 (CYP1A2) in the liver (Ture- sky et al., 1991). As shown in Fig. 1, the resulting N-hydroxy heterocyclic amine can be O-acetylated in the liver, then detoxified by conjugation with glutathione (GSH) by the action of GSH transferases (GSTs) or glucuronidated by the action of UDP- glucuronosyltransferases. Alternatively, the N-hy- droxy heterocyclic amines can enter the bloodstream and be transported to target organs, where they can be O-acetylated in tissues containing N-acetyltrans- ferase-2 (NAT2). This N-acetoxy derivative can re- act with DNA to form covalent heterocyclic amine- DNA adducts (Flammang et al., 1987). The forma- tion of DNA adducts and the extent of tumor induc- tion is dependent on the amount of aromatic or heterocyclic amines which are converted to the reac- tive metabolite. The amount produced depends on Fig. I. Proposed metabolic pathway for metabolism of heterocyclic amines by humans. I--I
Page 181: 2063633666 Log in for more options!
S. MacLeod et al. / M,~tation Research 376 (1997) 135-142 137 the quantity and activity of the enzymes involved in its formation, CYPIA2 and NAT2, and also the involved in detoxification, such as GSTs enzymes and UDP-glucuronosyltransferases. The activities of CYP1A2 and NAT2 both exhibit polymorphic distributions in human populations. These polymorphisms can be detected by phenotyp- ing assays that measure the ratio of caffeine metabo- lites and reflect the activities of CYP1A2 and NAT2 (Grant et al., 1984; Butler et al., 1992). Individuals are classified as slow or rapid N-acetylators or N- oxidizers, depending on their activity levels of NAT2 or CYP1A2, respectively. These assays have allowed the assessment of colorectal cancer risk by the deter- mination of NAT2/CYP1A2 phenotype in relation to dietary, exposure to heterocyclic amines from well-done cooked meat. The odds ratio for colorectal cancer ranges from 1.0 for slow metabolizers who eat rare or medium-cooked meat, to 6.5 for rapid metabolizers who eat well-done meat, These results support the hypothesis that an individual's cancer risk is related to individual carcinogen exposure and to polymorphisms in levels of carcinogen metaboliz- ing enzymes (Lang et al., 1994). Although differences in both constitutive and in- duced CYP1A2 function have been reported, no association has been identified between CYP1A2 activity and variations in the structural gene. Early evidence for CYPIA2 polymorphism involved inter- individual differences in the metabolism of phenacetin, an analgesic drug (Shahidi, 1968; AI- varez et al., 1979; Devonshire et al., 1983). Later studies using caffeine metabolizing phenotype assays demonstrated 40-60 fold variations in CYP1A2 ac- tivity between individuals (reviewed in Butler et al., 1989). Family studies of CYP1A2 activity indicate that variations in individual CYP1A2 activity appear to be under genetic control (Kadlubar, 1994). A number of studies have also demonstrated indi- vidual differences in the inducible component of CYP1A2 activity. Components of cigarette smoke (probably polycyclic aromatic hydrocarbons) induce CYP1A2 activity to a different extent in various smokers (Butler et a1., 1992). Consumption of pan- fried meat containing high levels of heterocyclic aromatic amines also increased CYPIA2 activities by varying degrees in non-smoking individuals (Sinha et al., 1994). A previous study by our laboratory found a marked racial difference in the effect of cigarette smoking on CYPIA2 activity. Caucasian smokers were found to have CYPIA2 levels nearly twice that of non-smokers while African-American smokers had CYP1A2 activity approximating that of African-American or Caucasian non-smokers (Lang et al., 1994). These results suggest genetically based differences in the response of CYPIA2 activity to xenobiotic exposure. Because a link between CYP1A2 activity and CYPIA2 gene variation has not been established (Nakajima et al., 1994), we initiated a study of the relationship between CYP1A2 activity and the activities of other polymorphic en- zymes that are involved in the metabolism of hetero- cyclic aromatic amines and polycyclic aromatic hy- drocarbons. We first examined the effects of cigarette smoking on CYP1A2 activity by measuring CYP1A2 function in smokers before and 3 weeks after cessa- tion of smoking. The second study measured the effects of consumption of well-done pan-fried meat on CYPIA2 activity in non-smokers. In addition, we examined the interaction between the CYP1A2 phe- notype and CYPIA1 genotype in these same individ- uals, since expression of these two enzymes is closely linked in all animal species examined and the Ile/Val CYPIA1 genotype in humans has been shown to result in higher inducibility of CYPIA1 activity (Cosma et al., I993; Crofts et al., I994). The GSTM1 genotype was also examined, since the absence of this gene has been previously associated with higher CYP1A2 activity in smokers, but not in non-smokers (Bartsch et al., 1995) and higher levels of aromatic amine-DNA adducts are found in smokers who pos- sess the GSTM1 null alleles (Yu et al., 1995). The GSTM1 genotype has also been reported to be asso- ciated with high inducibility of CYP1A1 expression in cultured human cells (Vaury et at., 1995). Thus, we evaluated the influence of the recently discovered polymorphisms in the CYPIA1 and GSTM1 genes on CYP1A2 activity in individuals in both the feeding and smoking cessation studies. 2. Materials and methods 2.1. Smoking cessation study Under a protocol approved by the University of Arkansas for Medical Sciences Human Research
Page 182: 2063633667 Log in for more options!
138 S. MacLeod et al. / Mutation Research 376 (1997) 135-142 Committee, subjects were recruited from Stop Smok- ing programs in Little Rock, AR. Caffeine phenotyp- ing was performed at entry into the study while the subject was still actively smoking. After complete smoking cessation for 3 weeks, the subjects were phenotyped again. Ten ml of blood was drawn for genotyping studies at the time of phenotyping. The data in this report comes from the 20% (N = 22) of the entry subjects that were successful in completing the 3 weeks of smoking abstinence. 2.5. GSTM1 genotype GSTMI genotype was determined by the use of a PCR based assay as described by Bell et al. (1993). Since this assay results in the absence of a PCR product in the case of individuals with the GSTMI null phenotype, oligonucleotide primers which am- plify part of the 13-globin gene were employed in a multiplex PCR reaction as a positive control for DNA quality and PCR reaction conditions. 2.2. Pan-fried meat feeding study 2.6. PCR primers Study population and selection criteria were pre- viously described (Sinha et al., 1994). The feeding study consisted of two consecutive 7-day controlled dietary periods which differed only in the method of meat preparation. In the first dietary period, subjects consumed evening meals that included meat cooked at low (I00°C) temperature; while during the 2nd week, evening meals contained pan-fried meat cooked at high (250°C) temperature. Breakfast and lunch meals were provided so that the differences between week 1 and week 2 were limited to the consumption of meat cooked at low or high tempera- tures, respectively. 2.3. Phenotype determination The CYP1A2 phenotype of dietary study subjects was determined at the end of week I and again at the end of week 2 as described by Sinha et al. (1994). Subjects were administered 114 mg of caffeine in 3.6 g of instant coffee in 266 ml of water. Subjects voided after 4 h and urine was collected at 5 h. Caffeine and its metabolites were analyzed by the method described by Butler et al. (1992). CYP1A2 phenotype was calculated by comparing the ratio of (1,7-dimethylxanthine (17X) plus 1,7-dimethyluric acid (17U)) to 1,3,7-trimethylxanthine (137X). GSTM1 forward primer 5'GAACTCC- CTGAAAAGCTAAAGC 3', reverse primer 5'GT- TGGGCTCAAATATAGCGTGG 3'. 13-globin for- ward primer 5'CAACTI'CATCCACGTTCACC 3'. 13-globin reverse primer 5'GAAGAGCCAAGGA- CAGGTAC 3'. 2.7. CYP1A1 genotype determination The single base pair A/G polymorphism in exon 7 of the CYPIAI gene, which results in an lle/Val polymorphism in the protein, was detected by a modification of the method described by Hayashi et al. (1991a). Two different downstream primers con- taining the polymorphic A or G at their 3' terminus were used in separate reactions with a common upstream primer. When used in PCR reactions, these primers yield products only when the template DNA is complimentary to the terminal 3' base. Reaction conditions were as described by Hayashi et al. (1991b), except for the addition of TaqStart antibody (Clontech, Palo Alto, CA) to the reaction mix and an increase in annealing temperature to 70°C. These modifications served to eliminate false positive PCR products caused by primer annealing to non-compli- mentary templates. 2.4. DNA isolation from. lymphocytes 3. Statistical analysis Genomic DNA was isolated from lymphocytes by the proteinase K digestion and phenol-chltSroform extraction method described by Blin and Stafford (1976). Statistical calculations were performed using JMP 3.1 (SAS Institute Inc., Cary, NC) for the Macintosh (Apple Computer, Inc., Cupertino, CA). Means, standard deviations, standard error and t-test were
Page 183: 2063633668 Log in for more options!
] i i i i i I i I i i 1 ] ] S. MacLeod et aL/ Mutation Research 376 (1997) 135-142 performed on CYPIA2 activity comparing unex- posed to exposed values for individuals who were GSTMI'A,B vs. GSTMI*0 genotype and individu- als who were CYP1A1 Val/Val versus those who were CYP1A1 Ile/Val genotype. 4. Results Caffeine phenotyping studies using the molar ra- tio of (l,7-dimethyl xanthine + 1,7-dimethyluric acid)/1,3,7-trimethyl xanthine (( 17X + 17 U)/137X) indicated that the average post-smoking CYPIA2 activity decreased to approximately 50% of levels noted during smoking (Fig. 2). In the Pan-Fried Meat feeding study that mea- sured CYP1A2 function (Sinha et al., 1994), it was found that 47 out 65 individuals (72%) had increased CYPIA2 activity after 1 week of consuming meat cooked at high temperatures, as compardd with the previous week of consuming an identical diet except that the meat was cooked at low temperatures (week 2 vs. week 1). However, 18 subjects or 28% of the test population did not exhibit increased CYP1A2 activity after the week of consumption of high-tem- perature cooked meat. The mean CYP1A2 activities were unchanged between those measured upon entry into the study (week 0, data not shown), and after 1 week of consuming low-temperature cooked meat (week 1 or unexposed). After 1 week of consuming Smoking Cessation Study (N-~) Post-Smoking Smoking Fig. 2. The influence of cigarette smoking on CYP1A2 activity. Mean (~--), median (~), 10th, 25th, 75th, 90th per- centile CYP1A2 activity as measured upon entry into the study (smoking) and after 3 weeks of smoking cessation (post-smoking). 35- 30- 2o~ .to- Pen-Fried Meat Feeding Study (N--66) ~ p---o.OOOl ~ 139 Low-Temp. High-Temp. Cooked Meat Cooked Meat Fig. 3. The influence of the consumption of meat cooked at high temperature on CYPIA2 activity. Mean (----), median (~), 10th, 25th. 75th, 90th percentile CYP1A2 activity as measured at the end of week 1 (low-temp. cooked meat) and at the end of week 2 (high-temp. cooked meat) of the pan-fried meat feeding study. high-temperature cooked meat (week 2 or exposed), mean CYP1A2 activity was increased to levels 50% higher than in the previous 2 weeks (Fig. 3). Fig. 4 shows that CYP1A2 activity was somewhat lower in the unexposed stages of the combined feed- ing study and smoking cessation study when the heterozygous Ile/Val form of CYP1A1 was present. Unexposed (Combined Groups) Exposed (Combined Groups Fig. 4. The influence of CYP1AI genotype on CYP1A2 activity. Since the Pan-Fried Meat feeding study results and the smoking cessation study results showed similar influences of CYP1A1, the two groups were analyzed together. Mean (~), median (.~), 10th, 25th, 75th, 90th percentile CYP1A2 activity is plotted. Exposed represents meat cooked at high temperature or cigarette smoke exposure, while unexposed represents meat cooked at low temperature or smoking cessation.
Page 184: 2063633669 Log in for more options!
140 S. MacLeod et al. / Mutation Research 376 (1997) 135-142 However, when CYPIA2 activity was influenced by either cigarette smoke or high-temperature cooked meat, the presence of the heterozygous Ile/Val form of the CYP1A1 gene resulted in increased levels of CYPIA2 activity of 18.1 compared to 13.5 for indi- viduals possessing the lle/Ile form of the gene. The glutathione S-transferase I~ (GSTMI) gene is deleted in a homozygous manner in approximately 50% of the human population (GSTMI* 0). A ge- netic polymorphism in individuals expressing this gene consists of a single base change in codon 173 which produces two variant alleles designated GSTMI*A and GSTMI* B. Because there seems to be little difference between the activity of GSTM1 *A line periods of the studies (low-temperature cooked meat and non-smoking), mean CYPIA2 activity was 8.9 in individuals expressing GSTMI*A,B, while those expressing the null allele showed an increase in CYP1A2 activity to 10.5. When individuals were exposed to cigarette smoke or high-temperature cooked me~t, mean CYPIA2 activity for the group expressing GSTMI*A,B was 12.6. The lack of ex- pression of functional GSTMI resulted in an in- crease in CYP1A2 activity to 16.2. Gene-gene inter- actions were further evaluated by determining the CYPIA2 values of individuals with combinations of GSTM1 and CYPIA1 genotypes. Those individual.~ genotyped GSTMI*A,B and CYP1AI, Ile/Ile (N = and GSTMI*B alleles and between the levels of 35) had the lowest mean value at 11.8 while those GSTM 1 activity expressed whether one or two copies genotyped GSTMI" 0 and CYPIA1, Ile/Val ( N = of the gene are present (Bell et al., 1993), we have had the. highest value at 15.7. The genotype combined those individuals having one or two ,c,opies GSTM1 0 and CYP1A1, Ile/Ile (N = 40) had a of the gene into on~ group, designated GSTM1 A,B, value of. 14.8. Only 2 participants had the genotvpe for purposes of analysis. To determine whether the GSTM1 A,B and CYP1AI,Ile/Val. presence or absence of the GSTM1 gene product influenced CYP1A2 activity, individuals from the feeding study and the smoking cessation study were 5. Discuss|on genotyped for the GSTMI gene using a PCR-based assay. Fig. 5 show~ that CYP1A2 activity was higher In this study, we sought to identify factors that when the GSTMI gene was absent. During the base might influence both constitutive and induced levels of CYP1A2 expression. Wide variations in human CYP1A2 activity have been reported; however." the '~~ variant alleles identified in the structt~ral gene do not ~ ~l un~xpo~a [ F~pn,,a I explain the activity range reported to date (Nakajima ~ t (com~) ~ (com~,~a~ro.~)-[- [ et at., 1994). By studying a group of volunteers at ~ "] I [ I two levels of exposure (high- or low-temperature ~'*t [ --V ~"* [ [ cooked meat and cigarette smoking or non-smoking). ~ t ~- [ [ [---] [ it was possible to evaluate the interactions among ~" "] -I- ~o~, I I ~ I--I I CYP1A1, GSTMI and CYP1A2. ~, t lean ~ [ ~ I [ [ CYP1A1 has been shown to be genetically po.'- , '*] ~_~ ~ [ ~ t_~ [ morphic with an adenine to guanine mutation in ~ 't ~ ~-~ ] __[_ --~ ] exon 7 that results in an amino acid change from t -- I I isoleucine to valine in the protein. This amino acid °1 a~r~, '~ ] ~.~.~ ' ~r~,.~ ] substitution results in 2-4 times greater inducibility ................... of the enzyme than the more common Ile/Ile allele t'lg. 3. Ire inuuence or tJblNll genotype on UIt'taZ activity, z Since the Pan-Fried Meat feeding study results and the smoking t~osma et al., 1993; Idrotts et al., 1~94; vaury et al.. cessation study results showed similar influences of GSTMI, the 1995). CYP1A1 and CYP1A2 metabolize different two groups were analyzed together. Mean (~), median compounds in different organs: CYPIAI in lung. (~), 10th, 25th, 75th, 90th percentile CYP1A2 activity nlne~ntn nncl lvrnnhcw',uto~" nnrt ˘~ngDl~9 in tho llt, or- is plotted. Exposed represents consumption of meat ~ooked at ~.-,;-~-~']'-,~:'- ""'"~"'~.'~'~' ~".'~ ~----:" ": ...... ~ ""~"" . , . " t.iI"l/-kl IS responslote for tne actlvauon ol potv- h~gh temperature or mgarette smoke exposure, while unexposed ." represents consumption of meat cooked at low temperature or cyclic aromatic hydrocarbons while CYPIA2 is m- smoking cessation, volved in the activation of carcinogenic heterocyclic
Page 185: 2063633670 Log in for more options!
S. MacLeod et al. / Mutation Research 376 (1997) 135-142 and aromatic amines. However, we reasoned that the action of CYPIA1 could potentially increase or de- crease circulating levels of compounds which influ- ence CYPIA2 activity. To test this hypothesis, we 141 highest CYPIA2 activity in univariate analysis (CYP1A1 Ile/Val and GSTMI'0) produced an in- termediate value when the two occurred together. This supports the hypothesis ~hat interaction between determined the CYP1AI genotype of the individuals the genes for activation and detoxification are com- in the pan-fried meat and the smoking cessation plex. studies and asked whether or not the polymorphic These results suggest that evaluating individual forms of CYP1A1 gene affected CYP1A2 pheno- cancer risk must take into account not only carcino- type. We found a correlation between the presence of gen exposure but also the activities of a complex the CYP1AI Ile/Val genotype and increased system of carcinogen metabolizing enzymes whose CYPIA2 activity levels under conditions of exposure catalytic products may influence the expression or to meat cooked at high temperature or cigarette induction of other enzymes which can either detoxify Since the CYP1A1 Ile/Val genotype results or activate potentially carcinogenic compounds. We smoke. in increased CYP1A1 activity, these results suggest have also shown that the levels of enzymes involved that a product of CYP1AI metabolism may act to in carcinogen metabolism can be manipulated in increase CYP1A2 activity. Alternatively, the human populations by dietary modification or by CYP1A1 and CYP1A2 genes may have been subject smoking cessation and that these changes in enzyme to evolutionary determinants that provided an advan- activity could potentially change the risk of environ- tage for gene-gene co-inducibility, mentally induced cancer. The quantity of carcinogenic metabolites formed in vivo are determined by levels of phase 1 enzymes responsible for the activation of procarcinogens as Acknowledgements well as the levels of phase 2 enzymes involved in the conjugation and detoxification. For this reason, we This work was supported in part by NCI grant examined whether or not the presence or absence of RO1 CA55751-03 and EPA grant R825280-01-0. expression of the GSTM1 gene affected CYP1A2 levels. Individuals in the feeding study and in the smoking cessation study were genotyped at the GSTM1 locus, and the results were used to evaluate References the influence of this genotype on the levels of Alvarez, A.P., A. Kappas, J.l_, Eisenman, K.E. Anderson, C.B. CYP1A2determined in caffeine phenotyping assays. Pantuck, E.J. Pantuck, K.C. Hsiao, W.A. Garland and A.H. Our study showed that exposure to meat cooked at high temperature and to cigarette smoke increased the activity of CYP1A2. However, expression of the null GSTM1 genotype also resulted in increased CYP1A2 levels at base line and with either exposure. Similar results have been reported for a GSTM1 effect on smoking induction of CYP1A2 activity by Bartsch et al. (1995). This data suggests that individ- uals who lack GSTM1 retain activity may higher levels of a compound which affects the activity of CYP1A2. This compound could be an inducer which is conjugated to GSH in the GSTMI*A,B individu- als, and is thereby not available to regulate CYPIA2 activity. Finally, the influence of combinations of CYP1A1 and GSTM1 were examined to determine whether the two pathways would have a synergistic effect on CYP1A2 activity. The genotypes giving the Conney (1979) Interindividual variation in drug metabolism, Clin. Pharmacol. Ther., 26, 407-419. Bartsch, H., M. Rojas, K. Alexander, A.-M. Camus, M. Casteg- naro, C. Malaveille, S. Antilla, A. Hirvonen, K. Husgafvel- Pursiainen, E. Hietanen and H. Vainio (1995) Metabolic poly- morphism affecting DNA binding and excretion of carcino- gens in humans, Pharmacogenetics, 5, $84-$90. Bell, D.A., J.A. Taylor, D.F. Paulson, C.N. Robertson, J.L. Mohler and G.W. Lucier (1993) Genetic risk and carcinogen exposure: a common inherited defect, of the carcinogen-metabolism gene glutathione S-transferase M1 (GST M1) that increases suscep- tibility to bladder cancer, J. Natl. Cancer Inst., 85, 1159-1164. Bell, D.A., A.F. Badawi, N.P. Lang, K.F. Ilett, F.F. Kadlubar and A. Hirvonen (1995) Polymorphism in the NAT1 polyadenyla- tion signal: association of NAT1* 10 allele with higher N- acetylation activity in bladder and colon tissue samples, Can- cer Res.,._55, 5226-5229. Blin, N. and D.W. Stafford (1976) Isolation of high-molecular weight DNA, Nucleic Acids Res., 3, 2303. Blum, M., D.M. Grant, A. Demierre and U.A. Meyer (1989)
Page 186: 2063633671 Log in for more options!
142 S. MacLeod et al. / Mutation Research 376 (1997) 135-142 N-Acetylation pharmacogenetics: a gene deletion causes ab- sence of arylamine N-acetyltransferase in liver of slow acety- lator rabbits, Proc. Natl. Acad. Sci., USA, 86, 9554-9557. Butler, M.A., M. lwasaki, F.P. Guengerich and F.F. Kadlubar (1989) Human cytochrome P-450~,A (P-450IA2), the phenacetin O-deethylase, is primarily responsible for the hep- atic 3-demethylation of caffeine and N-oxidation of carcino- genic arylamines, Proc. Natl. Acad. Sci., USA, 86, 7696-7700. Butler, M., N. Lang, J. Young, N. Caporaso, P. Vineis, R. Hayes, C. Teitel, J. Massengill, M. Lawsen and F. Kadlubar (1992) Determination of CYP1A2 and acetylator phenotypes in sev- eral human populations by analysis of caffeine urinary metabolites, Pharmacogenetics, 2, 116-127. Cosma, G., F. Crofts, E. Taioli, P. Toniolo and S. Garte (1993) Relationship between genotype and function of the human CYP1AI gene, J. Toxicol. Environ. Health, 40, 309-319. Crofts, F., E. Taioli, J. Trachman, G.N. Cosma, D. Currie, P. Toniolo and S.J. Garte (I994) Functional significance of dif- ferent human CYP1AI genotypes, Carcinogenesis, 15, 2961- 2963. Devonshire, H.W., I. Kong, M. Cooper, T.P. Sloan, J.R. Idle and R.L. Smith (1983) The contribution of genetically determined oxidation status to intedndividual variation in phenacetin dis- position, Br. J. Clin. Pharmacol., 16, 157-166. Flammang, T.J., Y. Yamazoe, F.P. Guengerich and F.F. Kadlubar (1987) The S-acetyl coenzyme A-dependent metabolic activa- tion of the carcinogen N-hydroxy-2-aminofluorene by human liver cytosol and its relationship to the aromatic amine N- acetyltransferase phenotype, Carcinogenesis, 8, 1967-1970. Gonzalez, F.J. (1989) The molecular biology of cytochrome P450's, Pharmacol. Rev., 40, 244-288. Gonzalez, F.J. and H.V. Gelboin (1993) Role of human cy- tochrome P-450s in risk assessment and susceptibility to envi- ronmentally based disease, J. Toxicol. Environ. Health, 40, 289-308. Grant, D.M., B.K. Tang and W. Kalow (1984) A simple test for acetylator phenotype using caffeine, Br. J. Clin. Pharmacol., 17, 459-64. Hayashi, S.-I., J. Watanabe, K. Nakachi and K. Kawajiri (1991a) Genetic linkage of lung cancer-associated Msp I polymor- phism with amino acid replacement in the heine binding region of the human cytochrome P4501A1 gene, J. Biochem., 110, 407-411. Hayashi, S.-I., J. Watanabe, K. Nakachi and K. Kawajid (1991b) PCR detection of an A/G polymorphism within exon 7 of the CYP1A1 gene, Nucleic Acids Res., 18, 7194. Kadlubar, F.F. (1994) Biochemical individuality and its implica- tions for drug and carcinogen metabolism: recent insights from acetyltransferase and cytochrome P4501A2 phenotyping and genotyping in humans, Drug Metab. Rev., 26, 37-46. Lang, N.P., M.A. Butler, J. Massengill, M. Lawson, R.C. Stotts. M. Hauer-Jensen and F.F. Kadlubar (1994) Rapid metabolic phenotypes for acetyltransferase and cytochrome P4501A2 and putative exposure to food-borne heterocyclic amines in- crease the risk for colorectal cancer or polyps, Cancer Epi- demiol., Biomarkers Prey., 3, 675-682. Nakachi˘ K., K. lmai, S. Hayashi, J. Watanabe and K. Kawajiri (1991) Genetic susceptibility to squamous cell carcinoma of the lung in relation to cigarette smoking dose, Cancer Res., 5 l. 5177-5180. Nakajima, M., T. Yokoi, M. Mizutani, S. Shin, F.F. Kadlubar and T. Kamataki (1994) Phenotyping of CYPIA2 in Japane.~e populations by analysis of caffeine urinary metabolites: ab- sence of mutation prescribing the phenotype in the CYPIA2 gene, Cancer Epidemiol., Biomarkers Prey., 3, 413-421. Seidegard, J., W.R. Vosachek, R.W. Pero and W.R. Pearson (1988) Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion, Proc. Natl. Acad., Sci. USA, 85, 7293- 7297. Shahidi, N.T. (1968) Acetophenetidin-induced methemoglobine- mia, Ann. N.Y. Acad. Sci., 151,822-832. Sinha, R., N. Rothman, E.D. Brown, S.D. Mark. R.N. Hoover. N.E. Caporaso, O.A. Lavender, M.G. Knize, N.P. Lang and F.F. Kadlubar (1994) Pan-fried meat containing high levels of heterocyclic aromatic amines but low levels of polycyclic aromatic hydrocarbons induces cytochrome P450IA2 activity, in humans, Cancer Res., 54, 6154-6159. Turesky, R.J., N.P. Lang, M.A. Butler, C.H. Teitel and F.F. Kadlubar (1991) Metabolic activation of carcinogenic hetero- cyclic aromatic amines by human liver and colon, Carcinogen- esis, 12, 1839-1845. Vaury, C., R. Laine', P. Noguiez, P. De Copper, C. Jaulin. F. Praz, D. Pompon and M. Amor-Gu6ret (1995) Human glu- tathione S-transferase M1 null genotype is associated with a high inducibility of cytochrome P450 1A1 gene transcription. Cancer Res., 55, 5520-5523. Yu, M.C., R.K. Ross, K.K. Chan, B.E. Henderson, P.L. Skippper. S.R. Tannenbaum and G.A. Coetzee (1995) Glutathione S- transferase M1 genotype affects aminobiphenyl-hemoglobin adduct Ievels in White, Black, and Asian smokers and non- smokers, Cancer Epidemiol., Biomarkers Prey., 4, 861-864.
Page 187: 2063633672 Log in for more options!
2063633672
Page 188: 2063633673 Log in for more options!
Volume 147 Number 7 April 1, 1998 ORIGINAL CONTRIBUTIONS American Journal of f EPIDEMIOLOGY Copyright 0 1998 by The Johns Hopkins Un/versfty School of Hygiene and Public Health Sponsored by the Society for Epidemiologic Research A BRIEF ORIGINAL CONTRIBUTION Quantitative Evaluation of Multiplicity in Epidemiology and Public Health Research Kenneth J. Ottenbacher Epidemiologic and public health researchers frequently include several dependent variables, repeated assessments, or subgroup analyses in their investigations. These factors result in multiple tests of statistical significance and may produce type 1 experimental errors. This study examined the type 1 error rate in a sampl~ of public health and epidemiologic research. A total of 173 articles chosen at random from 1996 issues of the Amefcan Journal of Public Health and the American Journal of Epidemiology were examined to determine the in.c, idenc,,e of type 1 en'ors. Three different methods of computing type 1 error rates were used: expedment- w=se error rate, error rate per experiment, and percent error rate. The results indicate a type 1 error rate substantially higher than the traditionally assumed level of 5% (p < 0.05). No practical or statistically significant difference was found between type 1 error rates across the two journals. Methods to determine and correct type I errors should be reported in epidemiotogic and public health research investigations that include multiple statistical tests. Am J Epidemiol 1998;147:615-19. bias (epidemiology}; probability; research design; significance tests Levin noted recendy, "Multiple comparisons are a very common feature--and, indeed, very often a ne- cessity-in epidemiologic and public health research'" (1, p. 628). He went on to discuss various procedures used to protect against type 1 errors, including the commonly used Bonferronl method and a procedure developed by Hol~kin and G-ensler (3) argue that the Holm-adjusted p value should be routinely used to reduce the type 1 error rate in studies involving multiple statistical tests. Received for publication February 10, 1997, and accepted for publication October 10, 1997. Abbreviations: EP, error rate per experiment; EW, experiment- wise error rate; PE, percent error rate. From the University of Texas Medical Branch at Galveston, Galveston, TX. Reprint requests to Dr. Kenneth J. Ottenbacher, SAHS, Rm. 4.202, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77755-1028. Problems involving multiple statistical-testing of hypotheses in health care and medical research arise for the following reasons: 1) the repeated analysis of accumulating data; 2) the use of multiple dependent measures; and 3) the analysis of data from subgroups (4). All three of these practices are common in public health and epidemiologic research. For example, Godfrey (5) demonstrated that researchers frequendy present and analyze means from several groups within the same study. She found that the most common method of statistically comparing several means in- volved the use of multiple t tests. Godfrey correctly argued that the use of urtivariate statistical procedures to analyze the results of studies containing multiple contrasts was inappropriate. Her analysis revealed that of 50 articles examined from the New England Journal of Medicine, a majority (54 percent) used improper univariate statistical procedures to analyze differences between sub~'oup means. 615
Page 189: 2063633674 Log in for more options!
616 Ottenbacher The use of several dependent variables in the anal- ysis of data from a single sample also results in mul- tiple statistical tests being reported. The complex na- ture of epidemiologic and public health research has led investigators to routinely include multiple depen- dent variables in their investigations (6). An epidemi- ologic researcher may be interested in the effect of a particular intervention on dependent variables such as weight, blood pressure, hematocrit, and serum cho- lesterol values in a sample of patients. As the number of dependent variables increases, so does the number of statistical tests. When this occurs, the researcher may obtain positive results on the basis of sampling error (7). hlumerous clinical researchers have suggested that multiple hypothesis testing without adjusting for inflated type 1 error rates is a common problem in medical and public health research (8-10). The purposes of this investigation were: 1) to examine the extent of the multiple testing in epidemiologic and public health research, and 2) to determine the prevalence of type 1 errors in a sample of pub- lished research. ME'FHODS Five issues of both the American Journal of Public Health and the American Journal of Epidemiology were randomly selected from the journal issues pub- lished in 1996. Each individual article was examined to determine the experiment-wise error rate, the error rate per experiment, and the percent error rate (see descriptions of error rates below). All articles that reported tests of statistical significance were included in the investigation. Articles that summarized the re- suits of previously published research and articles that did not report statistical significance tests were not included in the analysis. Experiment-wise error The overall experiment-wise error rate (EW) is the probability of making at least one type 1 error for the collection of tests performed in the investigation. The experLment-wise error rate can never be smaller than the error rate per comparison. The relatidn of per-comparison and experiment-wise error rates de- pends on the degree of statistical dependence of the tests. For totally independent tests, the experiment- wise error rate is equal to 1 - (1 - a)c, where c is the number of independent tests and a is the error rate per test (traditionally 0.05 or 0.01). From this equation, it is apparent that experiment-wise error rate increases rapidly with the number of h.ypotheses statistically examined. For example, in a study for which five statistical tests are conducted at the 0.05 level of significance, the EW is I - (I - 0.05)5 or 0.23. Error rate per experiment The error rate per experiment (EP).is the expected number of type 1 errors in a particular group of sta- tistical significance tests and is computed using the formula EP "= c(˘~), where c represents the number of comparisons, and ˘~ is the significance level and remains constant across all tests. For example, given 20 independent statistical comparisons at the p = 0.05 confidence level, EP = 20(0.05) = 1. This means that at the 0.05 level we would expect one type 1 error in 20 tests of statistical significance. It is important to note that the error rate per experiment (EP) is an expected value, while the experiment-wise error rate (EW), as defined above, is a probability. The experi- ment-wise error rate for 20 comparisons at the 0.05 significance level is I - (1 - 0.05)-'0 or 0.64. indicating that the probability of at least one type 1 error occurring among these tests reported as s, ignifi- cant at the 0.05 level is 0.64. Percent error rate The formula for computing the percent error rate (PE) is PE = lOOccdM, where c is the total number of comparisons, ~ is the alpha level for a set of comparisons, and M is the number of statistical tests less than the designated alpha level The percent error rate reflects the proportion of results labeled as statis- tically significant that are likely to be chance results. As the ratio approaches 1.00 (100 percent), it indicates that the number of tests found to be statistically significant approximates-the number of tests one would expect to find to be significant purely by chance. As the ratio decreases and approaches the individual alpha level for a set of comparisons, it reflects the percent of results that are attributable to chance. The percent of results Iikely to be caused by non-chance factors is equal to 100 - PE. For example, if 1 out of 20 comparisons evaluated at the 0.05 level is statistically significant, the PE = 100(20)(0.05)/1 = 100 percent, suggesting that the number of tests found to be significant, that is 1, is the number expected by chance. On the other hand, if 4 out of 20 comparisons conducted at the 0.05 significance level are found to be statistically significant, then PE = 100(20)(0.05)/4 = 25 percent, indicating that about 25 percent of the results are expected as the result of chance, while the remaining 75 percent (three tests) are likely to be due to non-chance factors. Am J Epidemiol Vol. 147, No. 7, 1998
Page 190: 2063633675 Log in for more options!
Quantitative Evaluation of Multiplicity 617 Rating process The reporting style in some of the articles made the determination of the exact number of statistical tests conducted and the number found statistically sigrtifi- cant a difficult task. Two independent raters with research degrees (PhDs) reviewed all articles and identified both the total number of tests conducted and the number reported as statistically significant. When the two raters did not agree, a third rater reviewed the article in question and the value agreed upon by at least two raters was used in the analysis. In spite of the high agreement between the raters (see below), the results reported in this investigation should be viewed as approximations of the various error rates rather than as exact values. A post hoc analysis is necessarily somewhat arbitrary in determining the number of tests conducted because the actual number cannot be pre- cisely determined without direct access to the original The relation between error rates per comparison and error rates per experiment is complex with dependent tests, a condition which may be assumed to always hold to some degree when multiple statistical tests are conducted using subjects from the same sample. Stra- han (11) has argued that, although it may be difficult to estimate the exact experiment-wise error rate due to correlation among the variables, it should be clear that it is greater than 5 percent. When discussing the im- pact of non-independence on error rates, it is important to distinguish types of non-independence that may exist. Ryan (12) originally identified the following four instances where non-independence may occur. The first includes all those situations where several groups or subgroups are statistically compared within the context of one study. The second case is referred to as "multiple tests with intercorrelated variables." This most commonly occurs when researchers compute multiple correlation coefficients for a single sample. The third instance of multiple testing is the use of multiple factors in the analysis of variance. The F ratios obtained from a factorial analysis of variance may not be independent if a common error estimate is used across the tests. Similar problems arise if other statistical procedures such as multiple t tests are used to analyze data in what is essentially a factorial design. The final type of multiple testing situation is what Ryan (12) referred to as "replicated tests of a single hypothesis.'" This classification includes studies for which several different methods of assessing the same dependent variable are employed, The situations described by Ryan (12) are not mu- tually exclusive. They do serve, however, to make it clear that interdependence between multiple statistical tests is complex and produced by numerous factors. Although the lack of independence may influence error rates, Ryan argues that it is not the main problem in interpreting error rates. He states that "~'he error rate per comparison and per experiment are com- pletely unaffected by independence or lack of it. The only important factor in these rates is th~ number of comparisons to be made. Only the experiment-wise error rate is affected by lack of independence" (12, p. 34). In the case of the experiment-wise error rate, the more highly related the tests, the closer the experi- ment-wise error rate is to the error rate specified for an individual comparison. In this examination, multivariate statistical tests that included procedures to control for type 1 error rates were considered as a single statistical test. This in- cluded analysis of variance (ANOVA) involving tests of interaction and accompanying post-hoc procedures using Scheffe, Tukey, Duncfin, Newman-Keuls, or other appropriate methods of post-hoe analysis. Each ANOVA, including the post hoe analysis, was counted as one statistical procedure. RESULTS The 71 articles in five issues of volume 86 of the American Journal of Public Health and the 102 arti- cles in five issues of volume 141 of the American Journal of Epidemiology contained sufficient statisti- cal information to be included in the analysis. The interrater agreement for all information coded from each of the articles was examined using the intraclass correlation coefficient (ICC) (13). The ICCvalues for all recorded information ranged from 0.91 to 1.00. Descriptive information for the experiment-wise error rate, the error rate per experiment, and the percent error rate for the articles published in the two journals appear in table 1. A comparison of the values for different error rates illustrates that experiment-wise error rate (EW) and the percent error rate (PE) have an easier interpretation than the error rate per experiment (EP), since EW and PE are essei~tially bounded while EP has no upper limit. The tabled values indicate that the EW in many articles is high, revealing a likelihood of type I errors in the reports, This is not surprising given the stochas- tic nature of the quantitative analysis of public health research. The prospect that many articles which report large numbers of statistical significance tests also re- port occasional type 1 errors does not seem alarming. What is of more concern is the percent error rate. The average individual alpha, level used in a ~ven study provides a lower bound for the percent error rate. Thus, for most of the investigations included in the ao.alysis, 5 percent is the lowest value PE can achieve given the 0.05 significance level. Yet. in many of the .4m J E,~idemiol Vol. 1.4-47, No. 7, 1998
Page 191: 2063633676 Log in for more options!
618 Ottenbacher TABLE 1. Type 1 error rates for random articles published in the American JoumalofPub#c Health and the American Joun~l of Epldemtotogy, 1996 No. Expedmem.,..,~˘~ Enor rate Pement Journal of ~ rate per expe~mem enor rate a~ Mean SO" IVkmn SO Meen SO Am J Public Health, Vol. 86 (nos. 3, 4, 7, g, 12) 71 0.68 0.24 0..90 0.57 19.16 9.01 Am J Epiderniol, Vol. 141 (nos. 2, 5, 6, 9, 10) 102 0.70 0.29 0.87 0.51 18.73 9.32 "SD, standard deviation. studies, the PE indicated that approximately 20 per- cent or more of the findings may be erroneous. The average PE for the studies in the American Journal of Public Health was I9.16 percent, while the average mean PE for articles in the American Journal of Epi- demiology was 18.73 percent (table 1). In a majority of the 173 articles (n = 156), the error rate per experiment (EP) was greater than 5 percent. The analysis also suggests that the percent error rate provides information not specifically contained in the EW and EP. The correlation between EW and EP rates for the articles included in table 1 was r = 0.47. The correlation of PE with EP was r = 0.41 and the correlation of PE with EW was r = 0.32. DISCUSSION AND CONCLUSIONS The problem of multiple hypothesis testing has im- plications regarding the interpretation and implemen- tation of epidemiologic research. For example, more than a decade ago the Food and Drug Administration refused to approve sulfinpyrazone (Anturane®, CIBA, Summit, New Jersey) as a medication to reduce mor- tality in the fast 6 months following myocardial in- farction (14). The refusal was based in part on the results of a clinical trial that included the repeated analysis of accumulated data. No procedure was used to control for the effect of multiplicity and the validity of the results was open to question. The probability of obtaining statistically significant results from two independent tests that address the same research question can be obtained by multiplying the individual probabilities that each test will produce a significant result. For p = 0.05, the probability that both tests will be statistically significant is 0.05 x 0.05 = 0.0025. The probability that neither result will be significant is 0.95 × 0.95 = 0.9025. The probabil- ity that at least one of the two test results will be statistically significant is 1 - 0.9025, or 0.0975. Thus, the probability of incorrectly deciding that the mem- bers of either one or both pairs of means are unequal using just two tests is nearly twice the probability of making the same error for a single test (0.0975 vs. 0.05). If we add a third comparison, the probability that none of the three tests will be significant is 0.95 × 0.95 X 0.95 = 0.8574, so the probability that at least one test will be significant is about 14 percent or nearly three times the 0.05 level. As the number of independent statistical tests increases, the probability becomes much larger than 0.05, the original alpha (see table 1). In trials wh~re multiple dependent variables are used, the obvious soludon to control or reduce experiment- wise error is to use some form of multivariate analysis, Multivariate procedures such as Hotelling's T2, ,disclqA'rli- nant function analysis, and logistic regression offer via- ble alternatives to traditional tmivariate approaches when multiple dependent variables are present. These proce- dures have been described by public health and epide- miologic reseamhers and are beyond the scope of this paper (15, 16). In some instances, the best solution may be to re- duce the per comparison significance level to a more stringent criterion. The Bonferroni adjustment pro- vides a widely advocated procedure to achieve this goal. The Bonferroni inequality involves dividing the alpha level desired for the overall family of statistical tests (usually 0.05) by the number of statistical com- parisons to be conducted. If two groups are compared on five separate dependent measures, each statistical comparison would be evaluated at 0.05/5 = 0.01. The Bonferroni method controls the type 1 error rate for each decision and maintains the selected alpha level (e.g., 0.05). for all the tests conducted in the investi- gation. The limitation of the Bonferroni method is that as the probability of making a type 1 error is de-. creased, the chance of committing a type 2 error is increased. Silverstein (17) demonstrated that when more than a small number of comparisons (say, five to eight) are included in a study, the Bonferroni proce- dure results in a dramatic loss in statistical power. Benjamini and Hochberg (18) have recendy described alternatives to the Bonferroni adjustment that do not result iri substantial reduction in statistical sensitivity.. The Bonferroni and other p value adjustment methods, however, are viewed as too conservative by some Am J EDiderniol Vol. t47, No. 7, 1998
Page 192: 2063633677 Log in for more options!
Quantitative Evaluation of Multiplicity 619 investigators (17). Levin noted that researchers who ar~ reluctant to use conservative correction methods such as the Bonferroni adjustment "will want to ex= plore some newer techniques.., in which less strin= gent but still interesting criteria replace the familywise error rate criterion" (1, p. 629). Procedures such as the percent error rate do not directly control type I error, but they do provide the investigator (and reader) with valuable information concerning the possible presence of a type 1 error in a family of statistical tests. Determining the experiment-wise error rate for a "family" of statistical procedures can be a complex task. In this study, the statistical test was the unit of analysis and no distinction was made among statistical procedures within a study versus those between stud- ies. Statistical tests conducted within a study generally use data from the same sample and are, therefore, assumed to be more related than statistical tests from different investigations (or samples). It is possible, however, that two different samples may be included in one research report, or that a single research article might include the results of more than one investiga- tion. An argument could be made that the family-wise error rate should be determined based on statistical tests that address the same research question across multiple investigations, or even across the lifetime of an investigator working in a particular area (12). The individual statistical test was the unit for determining the experiment-wise error rate in this study. Other units are possible, for example, the study sample, the research report, the research question, or even the investigator. How the different units of analysis effect the experiment-wise error rate for a "family" of sta- tistical tests is a question that can only be answered by additional research. Technical or statistical solutions to the problem of multiplicity in cpidemiologic research should not ob- scure a more fundamental scientific principle. There is a continuing need in health-related research to formu- late concise research questions and hypotheses before the collection and analysis of data. Stati.stical hypoth- esis testing is necessarily an empirical compromise between claiming too much and suggesting too little. Public health and epidemiologic researchers must pro- spectively define research questions and hypotheses as succinctly as possible and interpret the results using an alpha level appropriate to the extent of multiple test- ing. Knowledge of experiment-wise err6r procedures can help achieve this goal. ACKNOWLEDGMENTS This research was partially supported by grant no. MCJ- 360646-010 from the US Department of Health and Human Services, Bureau of Maternal and Child Health. REFERENCES I. Levin B. Annotation: on Holm. Simes, and Hochberg multiple test procedures. (Comment). Am J Public Health I996;86: 628-9. 2. Holm S. A simple sequentially rejective multiple test proce- dure. Scand J Star 1979;6:65-70. 3. Aickin M, Gensler H. Adjusting for muldple testing when repotting research results: the Bonferroni vs. HoLm methods. Am J Public Health 1996;86:726-8. 4. Wa~ JI-L Most~ll~r F. Ingelfinger JA. P-values. In: Bailar JC RI. Mostcllex F, cots. Medical uses of statistics. Waltham. MA: NEJM Books, 1986:179-~77. 5. Godfrey K. Statistics in practice. Comparing the means of several groups. N Engl J Med 1985;313:1450-6. 6. Tuk~y JW. Some thoughts on clinical trials, especially prob- lems of multiplicity. Science 1977:198:679-84. 7. Savitz DA. Oishan AF. Muldpte comparisons and related issues in the interpretation of epidemiologic data. Am J Epi- demiol 1995:142:904-8.. 8. Abt K. Problems of repeated significance tesdng. Control Clin Trials 1981:1:377-81. 9. Cupples LA, Heeren T, Schatzldn A. et al. Multiple testing of hypotheses in comparing two groups. Ann Intern Med 1984; 100:122-9. Thomas DC, Siemiatycki J. Dewar R. et al. The problem of muldple inference in studies designed to generate hypotheses. Am J Epidemiol 1985;122:1080-95. Strahan Pal:. Multivariate analysis and problems of type I error..I Court Psych 1982:29:1"~5-9. Ryan TA. Muldple comparisons in psychological research. Psych Bull 1959:56:26-47. - Shrout PE, Fleiss JL Intraclass correlations: us~'s in assessing rater reliability. Psych Bull 1979;86:420-8. Anonymous. Sulfinpyrazone in the prevention of sudden death after myocardial infar