Philip Morris
Polymorphisms of Cyp1a1 and Gstm1 Influence the in Vivo Function of Cyp1a2
Fields
- Author
- Kadlubar, F.F.
- Lang, N.P.
- Macleod, S.
- Sinha, R.
- Type
- PSCI, PUBLICATION SCIENTIFIC
- BIBL, BIBLIOGRAPHY
- Master ID
- 2063633486/4072
- 2063633486-4072 Book 7 Tabs 1-68
- 2063633488-3498 Predicting Rodent Carcinogenicity From Mutagenic Potency Measured in the Ames Salmonella Assay
- 2063633500-3505 Workplace Conditions, Socioeconomic Status, and the Risk of Mortality and Acute Myocardial Infarction: the Kuopio Ischaemic Heart Disease Risk Factor Study
- 2063633507-3510 Environmental Exposure to Gasoline and Leukemia in Children and Young Adults - An Ecology Study
- 2063633512-3530 Behavioral Functions of Nucleus Accumbens Dopamine: Empirical and Conceptual Problems with the Anhedonia Hypothesis
- 2063633532-3543 the Use of A Urine Mutagenicity Assay in the Monitoring of Environmental Exposure to Genotoxins
- 2063633545-3553 Smoking and Relative Body Weight: An International Perspective From the Who Monica Project
- 2063633555-3562 Aromatic Amine Dna Adduct Formation in Chronically-Exposed Mice: Considerations for Human Comparison
- 2063633564-3570 Life-Style Factors and Female Infertility
- 2063633571 Sensitivity of the Relation Between Cumulative Magnetic Field Exposure and Brain Cancer Mortality to Choice of Monitoring Data Grouping Scheme
- 2063633573-3584 Genetic Risk Factors for Chronic Obstructive Pulmonary Disease
- 2063633586-3593 Risk Factors Associated with the Development of Peripheral Arterial Disease in Smokers: A Case-Control Study
- 2063633595-3609 Self-Regulation and Mortality From Cancer, Coronary Heart Disease, and Other Causes: A Prospective Study
- 2063633611-3620 Dna Damage in Nasal Respiratory Epithelium From Children Exposed to Urban Pollution
- 2063633622-3630 Co-Carcinogenic Effects of Various Agents in Rats Following Exposure to Radon and Radon Daughters
- 2063633632-3638 Genetics and the Origin of Species: An Introduction
- 2063633640-3647 Subjective Indoor Air Quality in Schools in Relation to Exposure
- 2063633649-3662 the Nurses' Health Study: 20-Year Contribution to the Understanding of Health Among Women
- 2063633673-3677 Quantitative Evaluation of Multiplicity in Epidemiology and Public Health Research
- 2063633679-3681 Abc of Allergies Asthma and Allergy
- 2063633683-3684 Inflammatory Responses and Coronary Heart Disease the 'dirty Chicken' Hypothesis of Cardiovascular Risk Factors
- 2063633685 Consultant Suspended for Not Getting Consent for Cardiac Procedure. Mmr Vaccine Policy Is Backed
- 2063633687-3690 When Can Odds Ratios Mislead?
- 2063633692-3699 Increased Responsiveness of Ventral Tegmental Area Dopamine Neurons to Glutamate After Repeated Administration of Cocaine or Amphetamine Is Transient and Selectively Involves Ampa Receptors
- 2063633701-3703 Association Between Cigarette Smoking and Fhit Gene Alterations in Lung Cancer
- 2063633705-3712 Genetic Testing for Susceptibility to Adult - Onset Cancer the Process and Content of Informed Consent
- 2063633714-3721 Release of Carbon Granules From Cigarettes with Charcoal Filters
- 2063633723-3731 Detection of Low - Fraction K-Ras Mutations in Primary Lung Tumors Using A Sensitive Method
- 2063633733-3740 Socioeconomic Level, Sedentary Lifestyle, and Wine Consumption As Possible Explanations for Geographic Distribution of Cerebrovascular Disease Mortality in Spain
- 2063633742-3750 Air Pollution and Daily Admissions for Chronic Obstructive Pulmonary Disease in 6 European Cities: Results From the Aphea Project
- 2063633751 Airway Obstruction and Rheumatoid Arthritis
- 2063633753-3756 Relationship Between Acetylator Status, Smoking, Diet and Colorectal Cancer Risk in the North-East of England
- 2063633758-3763 Cardiovascular Risk Factor Profile in Subjects with Familial Predisposition to Myocardial Infarction in Denmark
- 2063633765-3770 Effect of Fresh Fruit Consumption on Lung Function and Wheeze in Children
- 2063633772-3777 Interactive Effect of the P53 Gene and Cigarette Smoking on Coronary Artery Disease
- 2063633779-3784 P53 Gene Aberrations in Non-Small-Cell Lung Carcinomas From A Smoking Population
- 2063633786-3794 Interlaboratory Comparison of Pm10 and Black Smoke Measurements in the Peace Study
- 2063633796-3799 Statistical Significance - A Misconstrued Notion in Medical Research
- 2063633801-3808 Urinary 1-Hydroxypyrene As A Marker of Exposure to Pyrene: An Epidemiological Survey on A General Population Group
- 2063633810-3813 Genetic Polymorphism of Cytochrome P450 As A Biomarker of Susceptibility to Environmental Toxicity
- 2063633815-3824 Smoking Among Psychiatric Patients
- 2063633826-3831 Evaluation of Certain Risk Factors for Lung Cancer in Cracow (Poland)
- 2063633833-3840 Prevalence and Predictive Value of P53 Mutation in Patients with Oesophageal Squamous Cell Carcinomas: A Prospective Clinico-Pathological Study and Survival Analysis of 70 Patients
- 2063633842-3848 Ki-Ras Mutations in Exocrine Pancreatic Cancer: Association with Clinico-Pathological Characteristics and with Tobacco and Alcohol Consumption
- 2063633850-3859 Risk Factors for Raynaud's Phenomenon Among Workers in Poultry Slaughterhouses and Canning Factories
- 2063633861-3880 Molecular Events in Lung Carcinogenesis
- 2063633882-3885 Cyp1a1, Cyp2e1 and Gstm Polymorphisms Are Not Associated with Susceptibility to Squamous - Cell Carcinoma of the Esophagus
- 2063633887-3891 the P53 Tumor Suppressor Targets A Novel Regulator of G Protein Signaling
- 2063633893-3896 New Tumor Suppressor Found - Twice. Prepaper Publicity Ignites Race to Publish. Shape- Changing Crystals Get Shiftier
- 2063633898-3899 Who Reform and Global Health
- 2063633901-3903 Showdown Over Clear Air Science. Puzzling Over A Potential Killer's Modus Operandi
- 2063633905-3910 Polymorphisms in the Glutathione S-Transferase Class Mu and Theta Genes Interact and Increase Susceptibility to Lung Cancer in Minority Populations (Texas, United States)
- 2063633912-3927 Plant Foods and Colon Cancer: An Assessment of Specific Foods and Their Related Nutrients (United States)
- 2063633929 Smoking, Alcohol and Coffee Consumption, and H Pylori Infection
- 2063633931-3934 Grand Rounds at the Clinical Center of the National Institutes of Health Evaluating Coronary Heart Disease Risk Tiles in the Mosaic
- 2063633936-3939 New Clues to Asthma Therapies. Why the Rise in Asthma Cases? New Lead to Safer Marrow Transplants
- 2063633941-3946 Cancer Undefeated
- 2063633948-3964 Lung Tissue Responses and Sites of Particle Retention Differ Between Rats and Cyanomolgus Monkeys Exposed Chronically to Diesel Exhaust and Coal Dust
- 2063633966-3986 Implementation on Epa Revised Cancer Assessment Guidelines: Incorporation of Mechanistic and Pharmacokinetic Data
- 2063633988-3999 Particle Pollution and Sudden Infant Death Syndrome in the United States Policy Memorandum
- 2063634001-4007 Neighborhood Social Environments and the Distribution of Low Birthweight in Chicago
- 2063634009-4014 the Effects of Cigarette Smoking and Gestational Weight Change on Birth Outcomes in Obese and Normal-Weight Women
- 2063634016-4017 Annotation: Cigarette Smoking, Nutrition, and Birthweight
- 2063634019-4020 Helicobacter Pylori Infection and Coagulation in Healthy People
- 2063634022-4023 Prospective Study of Helicobacter Pylori Seropositivity and Cardiovascular Diseases in A General Elderly Population
- 2063634025-4027 Age Specific Trends in Asthma Mortality in England and Wales, 830000 - 950000: Results of An Observational Study
- 2063634029-4036 Childhood Leukemia and Electromagnetic Fields: Results of A Population - Based Case - Control Study in Germany
- 2063634038-4047 Association of Smoking, Body Mass, and Physical Activity with Risk of Prostate Cancer in the Iowa 65+ Rural Health Study (United States)
- 2063634049-4056 Tobacco and Non-Hodgkin's Lymphoma: Combined Analysis of Three Case-Control Studies (United States)
- 2063634058-4063 How Much Pain for Cardiac Gain?
- 2063634065-4071 A Prospective Study of Body Mass Index, Weight Change, and Risk of Stroke in Women
Related Documents:
Document Images
HUTAT RE$-FUND MOL tq 97 ~-
tO~ELSEVZF..~ SCZENCE 8V NE
~
Fundamental and Molecular
Mechanisms of Mutagenesis
ELSEVIER Mutation Research 376 (1997) 135-142
Polymorphisms of CYP1A1 and GSTM1 influence the in vivo
function of CYPIA2
Stewart MacLeod a, Rashmi Sinha b, Fred F. Kadlubar c, Nicholas P. Lang d,*
University of Arkansas for Medical Sciences. Little Rock, AR 72205, USA
b National Cancer Institute, NIH, Bethesda, MD, USA
= National Center for Toxicological Research, Jefferson, AR, USA
a JLM Veterans Affairs Medical Center and Unicersity of Arkansas for Medical Sciences, Little
Rock, AR 72205, USA
Accepted 18 June 1996
Abstract -
Differences in human cancer susceptibility have been attributed to polymorphisms of carcinogen
metabolizing enzymes.
Our efforts have focused on the systems responsible for metabolism of aromatic and heterocyclic
amines found in cigarette
smoke and in cooked foods. Cytochrome P4501A2 (CYP1A2), which catalyzes aromatic and heterocyclic
amine N-oxida-
tion, has been implicated as a risk factor in both urinary bladder and colorectal cancer. In the
present study we used the
results of caffeine to the effects of cigarette smoke
and in meat
phenotyping
experiments
measure
compounds
present
cooked at high temperature on CYP1A2 activity. Subjects in the smoking cessation study had mean
CYP1A2 activity of 17.8
(expressed as the urinary molar ratio of [17X + 17U]/137X) while smoking; however, this activity
decreased to 10.9 three
weeks after cessation of smoking. Subjects in the cooked meat feeding study had mean CYP1A2 activity
of 9.01 after 1
week of consuming meat cooked at low temperature, but this value increased to 12.7 after I week of
consuming meat
cooked at high temperature.
Because no association has been identified between differences in CYP1A2 activity and variations
in the CYP1A2
structural gene, we sought to determine whether the activities of other carcinogen metabolizing
enzymes are involved in the
regulation of CYP1A2 activity. CYP1A2 activity was higher in individuals who express the GSTM 1 null
allele compared to
those expressing the GSTMI*A,B allele, 10.2 vs. 8.5 for unexposed conditions and 15.0 vs. 12.3 for
exposed conditions.
CYPIA1 genotyping demonstrated that individuals possessing the Ile/Ile CYP1A1 genotype had greater
mean CYP1A2
activity than those who had the heterozygous Ile/Val alletic variant of the CYP1A1
However, to
gene.
upon
exposure
cigarette smgke or high-temperature cooked meat, individuals possessing the heterozygous form of the
CYPIA1 gene had
significantly increased CYP1A2 activity (18.1) compared to those with the more common Ile/Ile CYP1A1
genotype (I 3.3).
These results indicate that CYPIA2, CYP1A1, and GSTMI gene-gene interactions could be important
confounders in the
interpretation of molecular epidemiology studies.
Keywords: Cytochrome P4501A1; Cytochrome P4501A2; Glutathione S-transferase M1; Polymorphism
Abbreviations: CYP1A2: Cytochrome P4501A2; CYPIAI: Cytocbxome P4501A1; NAT2:
N-acetyltransferase-2; 17X: 1,7-dimethyl
xanthine; 17U: 1,7-dimethyl uracil; 137X: caffeine; GSTMI: Glutathione S-tr~nsferase M1; Ile/Val:
Isoleucine/Valine; Ile/Ile:
Isoleucine/Isoleucine; GSH: glutathione
• Corresponding author. Tel.: + I 501-660-2038; Fax: + 1 501-671-2523; E-mail:
smacleod@acre.uams.edu
0027-5107/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved.
PII S0097-5107(97)00036-5 THIS ARTICLE IS ~=OR IN
- DIVIDUAL USE
ONLY
AND MAY NOT BE FURTHER REPRODUCED OR
STORED ELECTRONICALLY NITHOUT I~R~'TTEN
PERNISSION FROH THE COPYRIGHT HOLDER.
• UNAUTHORIZED REPRODUCTION HAY RESULT
IN FINANCIAL AND OTHER PENALTIES.

136
S. MacLeod et al. / Mutation Research 376 (1997) 135-142
1. Introduction
Current evidence makes clear the inaccuracies of
risk assessment following exposure to a chemical
carcinogen without a concomitant evaluation of the
metabolic pathways of activation and detoxification.
These pathways exhibit both species and tissue
specificity that may seriously weaken the role of
extrapolation of data in one system to risk projec-
tions in another tissue or species. There may also be
interactions among these pathways that further com-
plicate interpretation of risk data. Enzymes involved
in the metabolism of carcinogens have been shown
to exhibit a number of different polymorphisms that
can affect their expression levels or catalytic activity.
Nucleotide variations in the coding regiorr of a gene
that lead to an amino acid substitution in the protein
can alter enzymatic activity or substrate binding in a
positive or negative manner (Gonzalez, 1989). Dele-
tion of all or part of the coding region can lead to the
production of an inactive enzyme (Blum et al., 1989)
or can result in a total lack of protein synthesis
(Seidegard et al., 1988). Polymorphisms in the non-
coding region can affect transcriptional control ele-
ments involved not only in basal enzyme expression
(Nakachi et al., 1991) but can also disrupt the mech-
anism of induction observed for many of these en-
zymes (Gonzalez and Gelboin, 1993). Additionally,
variations in the polyadenylation signal of a gene can
result in changes in transcript polyadenylation thus
affecting transcript half-life and indirectly affecting
the quantity of enzyme produced (Bell et al., 1995).
In this study we have focused on the enzymes
which metabolize aromatic and heterocyclic amines
found in cigarette smoke and in meat cooked at high
temperatures.. Human exposure to these compounds
has been implicated as a risk factor for colorectal
cancer (Lang et al., 1994). Heterocyclic and aromatic
amines are initially N-oxidized by the action of
cytochrome P4501A2 (CYP1A2) in the liver (Ture-
sky et al., 1991). As shown in Fig. 1, the resulting
N-hydroxy heterocyclic amine can be O-acetylated
in the liver, then detoxified by conjugation with
glutathione (GSH) by the action of GSH transferases
(GSTs) or glucuronidated by the action of UDP-
glucuronosyltransferases. Alternatively, the N-hy-
droxy heterocyclic amines can enter the bloodstream
and be transported to target organs, where they can
be O-acetylated in tissues containing N-acetyltrans-
ferase-2 (NAT2). This N-acetoxy derivative can re-
act with DNA to form covalent heterocyclic amine-
DNA adducts (Flammang et al., 1987). The forma-
tion of DNA adducts and the extent of tumor induc-
tion is dependent on the amount of aromatic or
heterocyclic amines which are converted to the reac-
tive metabolite. The amount produced depends on
Fig. I. Proposed metabolic pathway for metabolism of heterocyclic amines by humans.
I--I

S. MacLeod et al. / M,~tation Research 376 (1997) 135-142
137
the quantity and activity of the enzymes involved in
its formation, CYPIA2 and NAT2, and also the
involved in detoxification, such as GSTs
enzymes
and UDP-glucuronosyltransferases.
The activities of CYP1A2 and NAT2 both exhibit
polymorphic distributions in human populations.
These polymorphisms can be detected by phenotyp-
ing assays that measure the ratio of caffeine metabo-
lites and reflect the activities of CYP1A2 and NAT2
(Grant et al., 1984; Butler et al., 1992). Individuals
are classified as slow or rapid N-acetylators or N-
oxidizers, depending on their activity levels of NAT2
or CYP1A2, respectively. These assays have allowed
the assessment of colorectal cancer risk by the deter-
mination of NAT2/CYP1A2 phenotype in relation
to dietary, exposure to heterocyclic amines from
well-done cooked meat. The odds ratio for colorectal
cancer ranges from 1.0 for slow metabolizers who
eat rare or medium-cooked meat, to 6.5 for rapid
metabolizers who eat well-done meat, These results
support the hypothesis that an individual's cancer
risk is related to individual carcinogen exposure and
to polymorphisms in levels of carcinogen metaboliz-
ing enzymes (Lang et al., 1994).
Although differences in both constitutive and in-
duced CYP1A2 function have been reported, no
association has been identified between CYP1A2
activity and variations in the structural gene. Early
evidence for CYPIA2 polymorphism involved inter-
individual differences in the metabolism of
phenacetin, an analgesic drug (Shahidi, 1968; AI-
varez et al., 1979; Devonshire et al., 1983). Later
studies using caffeine metabolizing phenotype assays
demonstrated 40-60 fold variations in CYP1A2 ac-
tivity between individuals (reviewed in Butler et al.,
1989). Family studies of CYP1A2 activity indicate
that variations in individual CYP1A2 activity appear
to be under genetic control (Kadlubar, 1994).
A number of studies have also demonstrated indi-
vidual differences in the inducible component of
CYP1A2 activity. Components of cigarette smoke
(probably polycyclic aromatic hydrocarbons) induce
CYP1A2 activity to a different extent in various
smokers (Butler et a1., 1992). Consumption of pan-
fried meat containing high levels of heterocyclic
aromatic amines also increased CYPIA2 activities
by varying degrees in non-smoking individuals (Sinha
et al., 1994). A previous study by our laboratory
found a marked racial difference in the effect of
cigarette smoking on CYPIA2 activity. Caucasian
smokers were found to have CYPIA2 levels nearly
twice that of non-smokers while African-American
smokers had CYP1A2 activity approximating that of
African-American or Caucasian non-smokers (Lang
et al., 1994). These results suggest genetically based
differences in the response of CYPIA2 activity to
xenobiotic exposure. Because a link between
CYP1A2 activity and CYPIA2 gene variation has
not been established (Nakajima et al., 1994), we
initiated a study of the relationship between CYP1A2
activity and the activities of other polymorphic en-
zymes that are involved in the metabolism of hetero-
cyclic aromatic amines and polycyclic aromatic hy-
drocarbons. We first examined the effects of cigarette
smoking on CYP1A2 activity by measuring CYP1A2
function in smokers before and 3 weeks after cessa-
tion of smoking. The second study measured the
effects of consumption of well-done pan-fried meat
on CYPIA2 activity in non-smokers. In addition, we
examined the interaction between the CYP1A2 phe-
notype and CYPIA1 genotype in these same individ-
uals, since expression of these two enzymes is closely
linked in all animal species examined and the Ile/Val
CYPIA1 genotype in humans has been shown to
result in higher inducibility of CYPIA1 activity
(Cosma et al., I993; Crofts et al., I994). The GSTM1
genotype was also examined, since the absence of
this gene has been previously associated with higher
CYP1A2 activity in smokers, but not in non-smokers
(Bartsch et al., 1995) and higher levels of aromatic
amine-DNA adducts are found in smokers who pos-
sess the GSTM1 null alleles (Yu et al., 1995). The
GSTM1 genotype has also been reported to be asso-
ciated with high inducibility of CYP1A1 expression
in cultured human cells (Vaury et at., 1995). Thus,
we evaluated the influence of the recently discovered
polymorphisms in the CYPIA1 and GSTM1 genes on
CYP1A2 activity in individuals in both the feeding
and smoking cessation studies.
2. Materials and methods
2.1. Smoking cessation study
Under a protocol approved by the University of
Arkansas for Medical Sciences Human Research

138
S. MacLeod et al. / Mutation Research 376 (1997) 135-142
Committee, subjects were recruited from Stop Smok-
ing programs in Little Rock, AR. Caffeine phenotyp-
ing was performed at entry into the study while the
subject was still actively smoking. After complete
smoking cessation for 3 weeks, the subjects were
phenotyped again. Ten ml of blood was drawn for
genotyping studies at the time of phenotyping. The
data in this report comes from the 20% (N = 22) of
the entry subjects that were successful in completing
the 3 weeks of smoking abstinence.
2.5. GSTM1 genotype
GSTMI genotype was determined by the use of a
PCR based assay as described by Bell et al. (1993).
Since this assay results in the absence of a PCR
product in the case of individuals with the GSTMI
null phenotype, oligonucleotide primers which am-
plify part of the 13-globin gene were employed in a
multiplex PCR reaction as a positive control for
DNA quality and PCR reaction conditions.
2.2. Pan-fried meat feeding study
2.6. PCR primers
Study population and selection criteria were pre-
viously described (Sinha et al., 1994). The feeding
study consisted of two consecutive 7-day controlled
dietary periods which differed only in the method of
meat preparation. In the first dietary period, subjects
consumed evening meals that included meat cooked
at low (I00°C) temperature; while during the 2nd
week, evening meals contained pan-fried meat
cooked at high (250°C) temperature. Breakfast and
lunch meals were provided so that the differences
between week 1 and week 2 were limited to the
consumption of meat cooked at low or high tempera-
tures, respectively.
2.3. Phenotype determination
The CYP1A2 phenotype of dietary study subjects
was determined at the end of week I and again at the
end of week 2 as described by Sinha et al. (1994).
Subjects were administered 114 mg of caffeine in 3.6
g of instant coffee in 266 ml of water. Subjects
voided after 4 h and urine was collected at 5 h.
Caffeine and its metabolites were analyzed by the
method described by Butler et al. (1992). CYP1A2
phenotype was calculated by comparing the ratio of
(1,7-dimethylxanthine (17X) plus 1,7-dimethyluric
acid (17U)) to 1,3,7-trimethylxanthine (137X).
GSTM1 forward primer 5'GAACTCC-
CTGAAAAGCTAAAGC 3', reverse primer 5'GT-
TGGGCTCAAATATAGCGTGG 3'. 13-globin for-
ward primer 5'CAACTI'CATCCACGTTCACC 3'.
13-globin reverse primer 5'GAAGAGCCAAGGA-
CAGGTAC 3'.
2.7. CYP1A1 genotype determination
The single base pair A/G polymorphism in exon
7 of the CYPIAI gene, which results in an lle/Val
polymorphism in the protein, was detected by a
modification of the method described by Hayashi et
al. (1991a). Two different downstream primers con-
taining the polymorphic A or G at their 3' terminus
were used in separate reactions with a common
upstream primer. When used in PCR reactions, these
primers yield products only when the template DNA
is complimentary to the terminal 3' base. Reaction
conditions were as described by Hayashi et al.
(1991b), except for the addition of TaqStart antibody
(Clontech, Palo Alto, CA) to the reaction mix and an
increase in annealing temperature to 70°C. These
modifications served to eliminate false positive PCR
products caused by primer annealing to non-compli-
mentary templates.
2.4. DNA isolation from. lymphocytes
3. Statistical analysis
Genomic DNA was isolated from lymphocytes by
the proteinase K digestion and phenol-chltSroform
extraction method described by Blin and Stafford
(1976).
Statistical calculations were performed using JMP
3.1 (SAS Institute Inc., Cary, NC) for the Macintosh
(Apple Computer, Inc., Cupertino, CA). Means,
standard deviations, standard error and t-test were

]
i
i
i
i
i
I
i
I
i
i
1
]
]
S. MacLeod et aL/ Mutation Research 376 (1997) 135-142
performed on CYPIA2 activity comparing unex-
posed to exposed values for individuals who were
GSTMI'A,B vs. GSTMI*0 genotype and individu-
als who were CYP1A1 Val/Val versus those who
were CYP1A1 Ile/Val genotype.
4. Results
Caffeine phenotyping studies using the molar ra-
tio of (l,7-dimethyl xanthine + 1,7-dimethyluric
acid)/1,3,7-trimethyl xanthine (( 17X + 17 U)/137X)
indicated that the average post-smoking CYPIA2
activity decreased to approximately 50% of levels
noted during smoking (Fig. 2).
In the Pan-Fried Meat feeding study that mea-
sured CYP1A2 function (Sinha et al., 1994), it was
found that 47 out 65 individuals (72%) had increased
CYPIA2 activity after 1 week of consuming meat
cooked at high temperatures, as compardd with the
previous week of consuming an identical diet except
that the meat was cooked at low temperatures (week
2 vs. week 1). However, 18 subjects or 28% of the
test population did not exhibit increased CYP1A2
activity after the week of consumption of high-tem-
perature cooked meat. The mean CYP1A2 activities
were unchanged between those measured upon entry
into the study (week 0, data not shown), and after 1
week of consuming low-temperature cooked meat
(week 1 or unexposed). After 1 week of consuming
Smoking Cessation Study
(N-~)
Post-Smoking Smoking
Fig. 2. The influence of cigarette smoking on CYP1A2 activity.
Mean (~--), median (~), 10th, 25th, 75th, 90th per-
centile CYP1A2 activity as measured upon entry into the study
(smoking) and after 3 weeks of smoking cessation (post-smoking).
35-
30-
2o~
.to-
Pen-Fried Meat Feeding Study
(N--66)
~ p---o.OOOl ~
139
Low-Temp. High-Temp.
Cooked Meat Cooked Meat
Fig. 3. The influence of the consumption of meat cooked at high
temperature on CYPIA2 activity. Mean (----), median
(~), 10th, 25th. 75th, 90th percentile CYP1A2 activity
as measured at the end of week 1 (low-temp. cooked meat) and at
the end of week 2 (high-temp. cooked meat) of the pan-fried meat
feeding study.
high-temperature cooked meat (week 2 or exposed),
mean CYP1A2 activity was increased to levels 50%
higher than in the previous 2 weeks (Fig. 3).
Fig. 4 shows that CYP1A2 activity was somewhat
lower in the unexposed stages of the combined feed-
ing study and smoking cessation study when the
heterozygous Ile/Val form of CYP1A1 was present.
Unexposed
(Combined Groups)
Exposed
(Combined Groups
Fig. 4. The influence of CYP1AI genotype on CYP1A2 activity.
Since the Pan-Fried Meat feeding study results and the smoking
cessation study results showed similar influences of CYP1A1, the
two groups were analyzed together. Mean (~), median
(.~), 10th, 25th, 75th, 90th percentile CYP1A2 activity
is plotted. Exposed represents meat cooked at high temperature or
cigarette smoke exposure, while unexposed represents meat cooked
at low temperature or smoking cessation.

140
S. MacLeod et al. / Mutation Research 376 (1997) 135-142
However, when CYPIA2 activity was influenced by
either cigarette smoke or high-temperature cooked
meat, the presence of the heterozygous Ile/Val form
of the CYP1A1 gene resulted in increased levels of
CYPIA2 activity of 18.1 compared to 13.5 for indi-
viduals possessing the lle/Ile form of the gene.
The glutathione S-transferase I~ (GSTMI) gene is
deleted in a homozygous manner in approximately
50% of the human population (GSTMI* 0). A ge-
netic polymorphism in individuals expressing this
gene consists of a single base change in codon 173
which produces two variant alleles designated
GSTMI*A and GSTMI* B. Because there seems to
be little difference between the activity of GSTM1 *A
line periods of the studies (low-temperature cooked
meat and non-smoking), mean CYPIA2 activity was
8.9 in individuals expressing GSTMI*A,B, while
those expressing the null allele showed an increase
in CYP1A2 activity to 10.5. When individuals were
exposed to cigarette smoke or high-temperature
cooked me~t, mean CYPIA2 activity for the group
expressing GSTMI*A,B was 12.6. The lack of ex-
pression of functional GSTMI resulted in an in-
crease in CYP1A2 activity to 16.2. Gene-gene inter-
actions were further evaluated by determining the
CYPIA2 values of individuals with combinations of
GSTM1 and CYPIA1 genotypes. Those individual.~
genotyped GSTMI*A,B and CYP1AI, Ile/Ile (N =
and GSTMI*B alleles and between the levels of 35) had the lowest mean value
at 11.8 while those
GSTM 1 activity expressed whether one or two copies genotyped GSTMI" 0 and CYPIA1,
Ile/Val ( N =
of the gene are present (Bell et al., 1993), we have had the. highest value at 15.7.
The genotype
combined those individuals having one or two ,c,opies GSTM1 0 and CYP1A1, Ile/Ile (N
= 40) had a
of the gene into on~ group, designated GSTM1 A,B, value of. 14.8. Only 2
participants had the genotvpe
for purposes of analysis. To determine whether the GSTM1 A,B and CYP1AI,Ile/Val.
presence or absence of the GSTM1 gene product
influenced CYP1A2 activity, individuals from the
feeding study and the smoking cessation study were 5. Discuss|on
genotyped for the GSTMI gene using a PCR-based
assay. Fig. 5 show~ that CYP1A2 activity was higher In this study, we sought to
identify factors that
when the GSTMI gene was absent. During the base might influence both
constitutive and induced levels
of CYP1A2 expression. Wide
variations in human
CYP1A2 activity have been
reported; however." the
'~~ variant alleles identified in
the structt~ral gene do not
~ ~l un~xpo~a [ F~pn,,a I explain the activity range
reported to date (Nakajima
~ t (com~) ~ (com~,~a~ro.~)-[- [ et at., 1994). By studying a
group of volunteers at
~ "] I [ I two levels of exposure (high- or
low-temperature
~'*t [ --V ~"* [ [ cooked meat and cigarette smoking
or non-smoking).
~ t ~- [ [ [---] [ it was possible to evaluate the
interactions among
~" "] -I- ~o~, I I ~ I--I I CYP1A1, GSTMI and CYP1A2.
~, t lean ~ [ ~ I [ [ CYP1A1 has been shown to be
genetically po.'-
, '*] ~_~ ~ [ ~ t_~ [ morphic with an adenine to
guanine mutation in
~ 't ~ ~-~ ] __[_ --~ ] exon 7 that results in an amino
acid change from
t -- I I isoleucine to valine in the
protein. This amino acid
°1 a~r~, '~ ] ~.~.~ ' ~r~,.~ ] substitution results in 2-4
times greater inducibility
................... of the enzyme than the more
common Ile/Ile allele
t'lg. 3. Ire inuuence or tJblNll genotype on UIt'taZ activity, z
Since the Pan-Fried Meat feeding study results and the smoking t~osma et al., 1993; Idrotts et al.,
1~94; vaury et al..
cessation study results showed similar influences of GSTMI, the 1995). CYP1A1 and CYP1A2 metabolize
different
two groups were analyzed together. Mean (~), median compounds in different organs: CYPIAI in lung.
(~), 10th, 25th, 75th, 90th percentile CYP1A2 activity nlne~ntn nncl lvrnnhcw',uto~" nnrt ¢~ngDl~9
in tho llt, or-
is plotted. Exposed represents consumption of meat ~ooked at ~.-,;-~-~']'-,~:'-
""'"~"'~.'~'~' ~".'~ ~----:" ": ...... ~ ""~""
. , . " t.iI"l/-kl IS responslote for
tne actlvauon ol potv-
h~gh temperature or mgarette smoke exposure, while unexposed
."
represents consumption of meat cooked at low temperature or cyclic aromatic hydrocarbons while
CYPIA2 is m-
smoking cessation, volved in the activation of carcinogenic heterocyclic

S. MacLeod et al. / Mutation Research 376 (1997) 135-142
and aromatic amines. However, we reasoned that the
action of CYPIA1 could potentially increase or de-
crease circulating levels of compounds which influ-
ence CYPIA2 activity. To test this hypothesis, we
141
highest CYPIA2 activity in univariate analysis
(CYP1A1 Ile/Val and GSTMI'0) produced an in-
termediate value when the two occurred together.
This supports the hypothesis ~hat interaction between
determined the CYP1AI genotype of the individuals the genes for activation and
detoxification are com-
in the pan-fried meat and the smoking cessation plex.
studies and asked whether or not the polymorphic These results suggest that
evaluating individual
forms of CYP1A1 gene affected CYP1A2 pheno- cancer risk must take into
account not only carcino-
type. We found a correlation between the presence of gen exposure but also the
activities of a complex
the CYP1AI Ile/Val genotype and increased system of carcinogen
metabolizing enzymes whose
CYPIA2 activity levels under conditions of exposure catalytic products may
influence the expression or
to meat cooked at high temperature or cigarette induction of other enzymes
which can either detoxify
Since the CYP1A1 Ile/Val genotype results or activate potentially
carcinogenic compounds. We
smoke.
in increased CYP1A1 activity, these results suggest have also shown that the levels
of enzymes involved
that a product of CYP1AI metabolism may act to in carcinogen metabolism can be
manipulated in
increase CYP1A2 activity. Alternatively, the human populations by dietary
modification or by
CYP1A1 and CYP1A2 genes may have been subject smoking cessation and that
these changes in enzyme
to evolutionary determinants that provided an advan- activity could potentially
change the risk of environ-
tage for gene-gene co-inducibility, mentally induced cancer.
The quantity of carcinogenic metabolites formed
in vivo are determined by levels of phase 1 enzymes
responsible for the activation of procarcinogens as Acknowledgements
well as the levels of phase 2 enzymes involved in the
conjugation and detoxification. For this reason, we This work was supported in part
by NCI grant
examined whether or not the presence or absence of RO1 CA55751-03 and EPA grant
R825280-01-0.
expression of the GSTM1 gene affected CYP1A2
levels. Individuals in the feeding study and in the
smoking cessation study were genotyped at the
GSTM1 locus, and the results were used to evaluate References
the influence of this genotype on the levels of Alvarez, A.P., A. Kappas, J.l_,
Eisenman, K.E. Anderson, C.B.
CYP1A2determined in caffeine phenotyping assays. Pantuck, E.J. Pantuck, K.C.
Hsiao, W.A. Garland and A.H.
Our study showed that exposure to meat cooked at
high temperature and to cigarette smoke increased
the activity of CYP1A2. However, expression of the
null GSTM1 genotype also resulted in increased
CYP1A2 levels at base line and with either exposure.
Similar results have been reported for a GSTM1
effect on smoking induction of CYP1A2 activity by
Bartsch et al. (1995). This data suggests that individ-
uals who lack GSTM1 retain
activity
may
higher
levels of a compound which affects the activity of
CYP1A2. This compound could be an inducer which
is conjugated to GSH in the GSTMI*A,B individu-
als, and is thereby not available to regulate CYPIA2
activity. Finally, the influence of combinations of
CYP1A1 and GSTM1 were examined to determine
whether the two pathways would have a synergistic
effect on CYP1A2 activity. The genotypes giving the
Conney (1979) Interindividual variation in drug metabolism,
Clin. Pharmacol. Ther., 26, 407-419.
Bartsch, H., M. Rojas, K. Alexander, A.-M. Camus, M. Casteg-
naro, C. Malaveille, S. Antilla, A. Hirvonen, K. Husgafvel-
Pursiainen, E. Hietanen and H. Vainio (1995) Metabolic poly-
morphism affecting DNA binding and excretion of carcino-
gens in humans, Pharmacogenetics, 5, $84-$90.
Bell, D.A., J.A. Taylor, D.F. Paulson, C.N. Robertson, J.L. Mohler
and G.W. Lucier (1993) Genetic risk and carcinogen exposure:
a common inherited defect, of the carcinogen-metabolism gene
glutathione S-transferase M1 (GST M1) that increases suscep-
tibility to bladder cancer, J. Natl. Cancer Inst., 85, 1159-1164.
Bell, D.A., A.F. Badawi, N.P. Lang, K.F. Ilett, F.F. Kadlubar and
A. Hirvonen (1995) Polymorphism in the NAT1 polyadenyla-
tion signal: association of NAT1* 10 allele with higher N-
acetylation activity in bladder and colon tissue samples, Can-
cer Res.,._55, 5226-5229.
Blin, N. and D.W. Stafford (1976) Isolation of high-molecular
weight DNA, Nucleic Acids Res., 3, 2303.
Blum, M., D.M. Grant, A. Demierre and U.A. Meyer (1989)

142
S. MacLeod et al. / Mutation Research 376 (1997) 135-142
N-Acetylation pharmacogenetics: a gene deletion causes ab-
sence of arylamine N-acetyltransferase in liver of slow acety-
lator rabbits, Proc. Natl. Acad. Sci., USA, 86, 9554-9557.
Butler, M.A., M. lwasaki, F.P. Guengerich and F.F. Kadlubar
(1989) Human cytochrome P-450~,A (P-450IA2), the
phenacetin O-deethylase, is primarily responsible for the hep-
atic 3-demethylation of caffeine and N-oxidation of carcino-
genic arylamines, Proc. Natl. Acad. Sci., USA, 86, 7696-7700.
Butler, M., N. Lang, J. Young, N. Caporaso, P. Vineis, R. Hayes,
C. Teitel, J. Massengill, M. Lawsen and F. Kadlubar (1992)
Determination of CYP1A2 and acetylator phenotypes in sev-
eral human populations by analysis of caffeine urinary
metabolites, Pharmacogenetics, 2, 116-127.
Cosma, G., F. Crofts, E. Taioli, P. Toniolo and S. Garte (1993)
Relationship between genotype and function of the human
CYP1AI gene, J. Toxicol. Environ. Health, 40, 309-319.
Crofts, F., E. Taioli, J. Trachman, G.N. Cosma, D. Currie, P.
Toniolo and S.J. Garte (I994) Functional significance of dif-
ferent human CYP1AI genotypes, Carcinogenesis, 15, 2961-
2963.
Devonshire, H.W., I. Kong, M. Cooper, T.P. Sloan, J.R. Idle and
R.L. Smith (1983) The contribution of genetically determined
oxidation status to intedndividual variation in phenacetin dis-
position, Br. J. Clin. Pharmacol., 16, 157-166.
Flammang, T.J., Y. Yamazoe, F.P. Guengerich and F.F. Kadlubar
(1987) The S-acetyl coenzyme A-dependent metabolic activa-
tion of the carcinogen N-hydroxy-2-aminofluorene by human
liver cytosol and its relationship to the aromatic amine N-
acetyltransferase phenotype, Carcinogenesis, 8, 1967-1970.
Gonzalez, F.J. (1989) The molecular biology of cytochrome
P450's, Pharmacol. Rev., 40, 244-288.
Gonzalez, F.J. and H.V. Gelboin (1993) Role of human cy-
tochrome P-450s in risk assessment and susceptibility to envi-
ronmentally based disease, J. Toxicol. Environ. Health, 40,
289-308.
Grant, D.M., B.K. Tang and W. Kalow (1984) A simple test for
acetylator phenotype using caffeine, Br. J. Clin. Pharmacol.,
17, 459-64.
Hayashi, S.-I., J. Watanabe, K. Nakachi and K. Kawajiri (1991a)
Genetic linkage of lung cancer-associated Msp I polymor-
phism with amino acid replacement in the heine binding
region of the human cytochrome P4501A1 gene, J. Biochem.,
110, 407-411.
Hayashi, S.-I., J. Watanabe, K. Nakachi and K. Kawajid (1991b)
PCR detection of an A/G polymorphism within exon 7 of the
CYP1A1 gene, Nucleic Acids Res., 18, 7194.
Kadlubar, F.F. (1994) Biochemical individuality and its implica-
tions for drug and carcinogen metabolism: recent insights from
acetyltransferase and cytochrome P4501A2 phenotyping and
genotyping in humans, Drug Metab. Rev., 26, 37-46.
Lang, N.P., M.A. Butler, J. Massengill, M. Lawson, R.C. Stotts.
M. Hauer-Jensen and F.F. Kadlubar (1994) Rapid metabolic
phenotypes for acetyltransferase and cytochrome P4501A2
and putative exposure to food-borne heterocyclic amines in-
crease the risk for colorectal cancer or polyps, Cancer Epi-
demiol., Biomarkers Prey., 3, 675-682.
Nakachi¢ K., K. lmai, S. Hayashi, J. Watanabe and K. Kawajiri
(1991) Genetic susceptibility to squamous cell carcinoma of
the lung in relation to cigarette smoking dose, Cancer Res., 5 l.
5177-5180.
Nakajima, M., T. Yokoi, M. Mizutani, S. Shin, F.F. Kadlubar and
T. Kamataki (1994) Phenotyping of CYPIA2 in Japane.~e
populations by analysis of caffeine urinary metabolites: ab-
sence of mutation prescribing the phenotype in the CYPIA2
gene, Cancer Epidemiol., Biomarkers Prey., 3, 413-421.
Seidegard, J., W.R. Vosachek, R.W. Pero and W.R. Pearson
(1988) Hereditary differences in the expression of the human
glutathione transferase active on trans-stilbene oxide are due
to a gene deletion, Proc. Natl. Acad., Sci. USA, 85, 7293-
7297.
Shahidi, N.T. (1968) Acetophenetidin-induced methemoglobine-
mia, Ann. N.Y. Acad. Sci., 151,822-832.
Sinha, R., N. Rothman, E.D. Brown, S.D. Mark. R.N. Hoover.
N.E. Caporaso, O.A. Lavender, M.G. Knize, N.P. Lang and
F.F. Kadlubar (1994) Pan-fried meat containing high levels of
heterocyclic aromatic amines but low levels of polycyclic
aromatic hydrocarbons induces cytochrome P450IA2 activity,
in humans, Cancer Res., 54, 6154-6159.
Turesky, R.J., N.P. Lang, M.A. Butler, C.H. Teitel and F.F.
Kadlubar (1991) Metabolic activation of carcinogenic hetero-
cyclic aromatic amines by human liver and colon, Carcinogen-
esis, 12, 1839-1845.
Vaury, C., R. Laine', P. Noguiez, P. De Copper, C. Jaulin. F.
Praz, D. Pompon and M. Amor-Gu6ret (1995) Human glu-
tathione S-transferase M1 null genotype is associated with a
high inducibility of cytochrome P450 1A1 gene transcription.
Cancer Res., 55, 5520-5523.
Yu, M.C., R.K. Ross, K.K. Chan, B.E. Henderson, P.L. Skippper.
S.R. Tannenbaum and G.A. Coetzee (1995) Glutathione S-
transferase M1 genotype affects aminobiphenyl-hemoglobin
adduct Ievels in White, Black, and Asian smokers and non-
smokers, Cancer Epidemiol., Biomarkers Prey., 4, 861-864.
