Jump to:

Philip Morris

Progress Toward Human Gene Therapy

Date: 19890616/P
Length: 188 pages
2047651887-2047652074
Jump To Images
snapshot_pm 2047651887-2047652074

Fields

Author
Friedmann, T.
Area
WALL,CHARLES/SEC'Y FILES
Type
MAGA, MAGAZINE ARTICLE
BIBL, BIBLIOGRAPHY
FOOT, FOOTNOTES
Site
N328
Named Person
Cline
Pope John Paul, I.I.
Williams, D.
Request
Stmn/R1-004
Document File
2047651760/2047652124/San Diego, Ca - 890725 Univ. Of Ca. San Diego
Named Organization
Medical Research Councils of Canada +
Natl Council of Churches
NIH, Natl Inst of Health
Office of Technology Assessment
Parliamentary Assembly of the Council
Presidential Commission for the Study
Recombinant Advisory Comm
Univ of Ca San Diego
World Council of Churches
35th General Assembly of World Medical
FDA, Food and Drug Administration
Government of Denmark
Government of Federal Republic of Germ
Author (Organization)
American Assn for the Advancement of Sci
Science
Univ of Ca San Diego
Litigation
Stmn/Produced
Master ID
2047651885/2074

Related Documents:
Date Loaded
05 Jun 1998
UCSF Legacy ID
brs52e00

Document Images

Text Control

Highlight Text:

OCR Text Alignment:

Image Control

Image Rotation:

Image Size:

Page 1: brs52e00
Molecular Biology pure and simple. Modern molecular biology is both dynamic and demanding. Today's researcher must manage an enormous number of different genomes and enzymes, as well as other biomolecules. Complex protocols can take weeks to perform. Careful attention to thousands of details is essential. Enzymes, nucleotides and other agents must be free of contamination. At Pharmacia LKB, we're committed to taking the risk out of molecular biology. We do this by providing automated procedures and easy-to-use kits containing everything you need for a good result. Nothing more or less. Each kit has been designed to provide an optimum solution to a particular application problem - pure and simple. They take you from precise sample preparation, to secure reaction chemistry, and on to a thorough and accurate analysis.
Page 2: brs52e00
For primers, for thermocyclers and seyuenc ing. nothing heats the low cost and high performance of the new Biotix D\A 200 synthesizer. 3 minute cvcle time. 98-99% efficiencv from phosphoramidite or newly perfected phosphonate chemistry. Guaranteed biuk)l;i- callv active DNA. And backed b% the Biotix Zero Downtime \kwranty. To find out more, call 1-8O0-28$-?468, or write Bic)tit, Inc., Commerce Park. Corporate I)rive, Danburv: CT 0G81Q--L 13t1. Rrter.r Phau 11PLt; nt an unpurified LS mer .cnthr.ized cia the phn.phoramidiir chE•mi.trc. ~ll}U,. e-i ridumn. d.5mm i-acm. Gradient: B in S/) minutew. Snkrnt.1- Q.I in TIiA. Snhrnt B: acetonitrile Circle No. 35 on Readers' Service Card
Page 3: brs52e00
two sifipl¢ instfumd One pipettes... The Brinkmann Transferpette" 8/12 fits comfortably in your hand while you are performing 8- and 12-channel sample transfers and serial dilutions. The other repeats... The Eppendorf Repeater Plus/8T"reduces the fatigue of routinely filling 96-well plates by rapidly dispensing up to 48 times without refilling. And Brinkmann has both. Both instruments have unique features to help you master your laboratory procedures. Traw Call 800-645-3050; in New York, 516-334-7500. Or write Brinkmann Instruments, Inc., Cantiague Road, Westbury, NY 11590. (In Canada: 416-675-7911; 50 Galaxy Blvd., Rexdale, Ont. M9W 4Y5) BRK 55e8 For information circle reader service number 199 For demonstration circle reader service number 200
Page 4: brs52e00
~~ 16 JUNE 1989 $$3.50
Page 5: brs52e00
How toproject your findir T here's no faster, easier and more accurate way to present your work than on Polaroid instant films and imaging systems. Whether your presentation is the next day or the next hour, Polaroid can help you project your findings without darkrooms or expensive photo- graphic facilities. The images on the left show just a few of the many presentation films availa- ble from Polaroid that can help you project a better image. Instantly. To capture the subtle color differentiations in the CAD/CAM image of a ball bearing (Fig. 1), new High Contrast PolaChrome Instant 35mm Slide Film was used. PolaChrome HC provides bright, high quality color in minutes. The fish fossil on limestone (Fig. 2) was taken on PolaPan 35mm Instant Slide Film. The images were developed in daylight in minutes using the portable Polaroid PowerProcessor. The instant color overhead transparency of a cost analysis graph (Fig. 3) was made using Colorgraph Type 691 film. This continuous tone, full color film creates easy-to-handle small format overhead projection transparencies so the latest findings can be presented instantly. The actual graph was generated on a PC using the Polaroid PalettePlus Computer Slide Maker. This white-on-blue slide of the molecu- lar structure of galactosamine (Fig. 4) was made with new PolaBlue Instant 35mm Slide Film. PolaBlue provides bright, high quality, white-on-blue slides in minutes, at a much lower cost than traditional blue slides. "Polaroid.' "Polapan'; "Polachrome "PolaBlue"° © Polaroid 1988 The surface structure of a fern under a scanning electron microscope (Fig. 5) was taken with PolaPan 35mm Instant Slide Film. No matter what you're presenting, or how you're presenting it, Polaroid has a film that can help you do it faster and easier. In color, black and white or white-on-blue. In 35mm slides, prints or overhead transparencies. In seconds, Polaroid has a complete line of instant films and imaging equipment to help bring your findings to light. And you get it all A.S.A.P.-As Soon As Polaroid instant images. For a complete brochure (please specify whether you want information about the Quality Assurance Field or the Research Field) about Polaroid instant imaging solutions for the profes- sional scientific community, or for a free con- sultation, call 1-800-343-5000. Or write, Polaroid Corporation, Dept. 695, P.O. Box 5011, Clifton, N.J. 07015. 16 JUNE 1989 Circle No. 54 on Readers' Service Card 1235
Page 6: brs52e00
I Compare the Better Micro- pipette Better Performance Swiss precision tolerances - accuracy and CV guaranteed to better than f1 %. Better Quality Individually tested and ins ected - supplied with verified caPbration certificate. Better Design Comfortable to operate, easy to read precision setting - internal detipping mechanism maintains narrow profile. Better Selection Variable and fixed volume, air and positive displacement, single and multi-channel - in a wide range of sizes. Better Value Wheaton high quality, Swiss precision micropipettes provide better performance, better features at a better price than the better known competition. Call Wheaton today 1-800-225-1437 and compare the better micropipette. WHEATON 1501 North Tenth Street Millville, NJ 08332, USA Call Toll-Free: 1-800-225-1437 Ext. 2527 TLX: 55-1295 (WHEATON US) FAX: 1-609-825-1368 Circle No, 223 on Readers' Service Card
Page 7: brs52e00
M A N A~~ EM EN At the same time, the kits themselves are structured to fit logically together. The result is an integrated, systems approach that improves efficiency as well as convenience. Our high-quality products are backed by know how built upon decades of experience in managing biomolecules. Particular expertise in protein separation technology provides researchers with the highest possible purity in restriction and modifying enzymes, cloning vectors, nucleotides, and other chemicals and reagents used in molecular biology. If you use molecular biologist techniques, and don't have time to waste, the solution is pure and simple. We hel p you manage biomolecules. ~ O ~ C71 el Pharmacia ~7,&c Oo Pharmacla LKB Biotechnology CC Head ottke Sweden Tel 46 (018) 163000. Australia Tel (02) 8883622. Auatrta Tel (0222) 6866250. BMWum Tel (M 2424660. BnzY Tel 55-11 2845815/2898987. Canada Tel (514) 4578661. Oenmark Tel (02) 265200. East Europe Tel 43 (0222) 921607. Federal RepubBc of Germany Tel (0761) 49030. FlMand Tel (90) 5021077. France Tel (01) 30643400. Oroat Brkain Tel (0908) 681101. HoUand Tel (031) 348077911. Ind(a Tel (0812) 29634. Italy Tel (02) 2532844l28700475. Japan Tel (03) 4929181. Nonvay Tel (02) 549095. SovNt Union Tel 48 (08) 7998000. Sp.in Tel (34)36754411. Sweden Tel (08) 7998000. Swiueriand Tel (01) B21 1818. United Statea Tel (201) 4578000. Far East Tel 852 (5) 8148421. Middb Eaat Tel 30 (1) 8847398. OBror coauMrka Tei 48 (08) 7998000. (8904) Circle No, 207 on Readers' Service Card
Page 8: brs52e00
Of Course, There Are Some Growth Factors Even We Don't Offer... Yet. Wherever there's a growing research need, we do every- thing in our power to meet it. And when it comes to high- purity growth factors, we offer an extensive selection, including IGF-1, IGF-2, TGFa, EGF, FGF acidic and basic, PDGF... Like all our products, BACHEM growth factors are produced using the lat- est in rDNA and solid-phase technologies. You can be sure of immediate delivery, the highest possible purity, and availability. As new growth factors are discovered, BACHEM will develop procedures to pro- duce them in quantity, too. Grow with us. For more information on BACHEM growth factors and other high-quality peptides and proteins, call or write. THE BACHEM GROUP - FOR BETTER SERVICE, WORLDWIDE BAaH~~~~ F serving you worldwide except areas mentioned Hauptstrasse 144 CH-4416 Bubendorf Phone:061/93123 33 Fax: 061 /93125 49 Telex: 966 081 - B «iEm ~- B c~ ~1O5~~Q1~a 1~1C ~ioc~amic~ GmuH subsidiary of BACHFJM Switzerland serving the American continents 3700 Market Street Philadelphia, PA 19104 Phone: 215/387 0011 Fax: 215 /3871170 Telex: 910 250 2352 Circle No. 238 on Readers' Service Card subsidiary of BACHEM Switzerland serving FRG, GDR and CCCP Lessingstrasse 26 D-6900 Heidelberg Phone: 0 62 21/16 30 91 Fax: 0 62 21/21442 Telex: 461352 !
Page 9: brs52e00
NO POSTAGE NECESSARY IF MAILED IN THE UNITED STATES BUSINESS REPLY MAIL FIRST CLASS PERMIT NO. 372 RIVERTON, NJ, USA POSTAGE WILL BE PAID BY ADDRESSEE American Association for the Advancement of Science P.O. Box 1724 Riverton, NJ 08077-7324 NO POSTAGE NECESSARY IF MAILED IN THE UNITED STATES BUSINESS REPLY MAIL FIRST CLASS PERMIT NO. 372 RIVERTON, NJ, USA POSTAGE WILL BE PAID BY ADDRESSEE American Association for the Advancement of Science P.O. Box 1724 Riverton, NJ 08077-7324
Page 10: brs52e00
How can this exciting new system help protect both your laboratory animals and personnel from contamination? The dumping of cage bedding and animal waste can create-and then lead to-the inhalation of aerosolized contaminants by animals and lab personnel. Such animal exposure can interfere with-or even jeopardize -research studies. And inhalation of contaminants by personnel can result in serious health consequences. Up until now, this has been the weak link in the animal facility contamination-containment chain. Now this new Lab Products partial containment system substantially reduces the level of airborne contaminants by restricting all cage dumping to the inside of a negative air flow cabinet; that is, with air flowing from the room and into the cabinet. The aerosolized particulates are washed out of the airstream by a remarkably effective three-stage filter system and so clean HEPA-filtered air circulates back into the room. In addition to designing a system that would be effective in scrubbing the air, there were two other major objectives: • to design a"human-engineered" system that would be comfortable to use and easy to clean • to design a system that would be easy to maintain; that is, one in which filter or other maintenance was simple and straightforward. These goals, too, have been achieved. There are otherfeatures/advantages/benefits of the system described in detail in our brochure. To request a copy, please use the coupon, or drop us a line, or call us at 201/843-4600 or 800/526-0469. Fax: 201/843-6040. ts pndLK_Inc Dumping animal bedding waste from cage. Removing optional paper bag. Removing optional burn box with polyvinyl liner. a 0 0 •~ company 255 West Spring Valley Avenue Maywood, New Jersey 07607 201/843-4600 Fax: 201/843-6040 Circle No. 184 on Readers' Service Card r------------------------------------ i Lab Products, Inc. t 255 West Spring Valley Avenue i Maywood, NJ 07607 I I i 0 1 would appreciate a copy of your Waste Management System brochure. I [I I'd like to know more about your videotape on this system. i O I'd like to speak directly to a technical sales representative. I i O I'd welcome your comprehensive catalog on animal care products. Name Title Dept. Organization Address - Phone Patents applied for. Copynght © Bio Medic Corporation, 1988.
Page 11: brs52e00
' t wait ~-- If your research can for weeks whi(e you wait for DNA, take a look at the Cyclone'" Plus DNA Synthesizer from MilliGen/ Biosearch. Convenient prepack- aged chemistries and proven protocols allow you to produce probes, primers, even long (> 100-mer) frag- mentsquicklyand effortfessly, Just load the reagents, key in your sequence, and press "Run." Cyclone Plus handles everything else- automatically. In half the bench space, Cydone Plus outperforms instrumenfis costing iwice as much. Preprogrammed soft- ware cartridges make it easy to change protocols or synthesis scales. You can even create your own methods to customize a synthesis. Cyclone Plus is availa- ble in either one-column or two-column configurations. And since it's priced within reach of any lab, there's no reason to wait another day. For more information, call 800-872-0071; in MA, 617-229-2870. MilliGen/Biosearch Division of MILLIPORE France 30.45.70.00 Japan 471-7191 U.K.923 816375 W. Germany (06196) 494-0 a 1989 Milllpore Corporation 'rc(e No. 39 on Readers' Service Card
Page 12: brs52e00
AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE Editorial Letters News & COIIllIleIIt Research News Articles Reports SCIENCE 1231 This Week in Science 1233 The Engineering of Species ISSN 0036-8076 16 JUNE 1989 VOLUME 2,¢q. NUMBER 49I0 1245 The Dingell Investigation: M. O' TooLE; DON S. DOERING  Responsibility: C. H. Fox 1248 Bringing NASA Down to Earth  Low-Tech Earth Observation  Early Data: Losing Our Memory? 1251 German Biotech Firms Flee Regulatory Climate 1253 EPA Drafts New Research Agenda Cambridge to Oversee Animal Research 1254 New Hope on the AIDS Vaccine Front  Hecklers and Protesters Liven up a Dull Meeting 1256 Illuminating Jet Lag 1257 New Machine Sparks Rivalries at CERN  Acronyms in Search of Particles 1260 Another Piece of 3.14159 ...? The New Harvest: Genetically Engineered Species 1275 Progress Toward Human Gene Therapy: T. FRIEDMANN 1281 Genetic Engineering of Livestock: V. G. PvRSEL, C. A. PINKERT, K. F. MILLER, D. J. BOLT, R. G. CAMPBELL, R. D. P?.LMITER, R. L. BRINSTER, R. E. HAMMER 1288 Altering the Genome by Homologous Recombination: M. R. CnPECCHi 1293 Genetically Engineering Plants for Crop Improvement: C. S. GASSER AND R. T. FRALEY 1300 Genetic Engineering of Bacteria from Managed and Natural Habitats: S. E. LINDOw, N. J. PANorouLos, B. L. McFARIaND 1307 Construction of Large DNA Segments in Escherichia coli: M. O'CONNOR, M. PEIFER, W. BENDER ~ ~ 1313 Genetic Engineering of Filamentous Fungi: W. E. TIMBERLAKE AND M. A. MARsH.aLL ~ ~ 1326 Availabilit,v of Metabolic Fuels Controls Estrous Cyclicity of Syrian Hamsters: ~ J. E. SCHNEIDER AND G. N. WADE ~ ~ C  SCIENCE is published weekly on Friday. except the last week In Decernber, and with an extra issue in February by the American Association for the Advancement of Science, 1333 H Street, NW, Washington, DC 20005. Sec- ond-class postage (publication No. 484460) paid at Washington, DC, and at an additional entry. Now combined with The Scientific MbnthlyZ Copyright ® 1989 by the American Association for the Advancement of Science. The tiUe SCI- ENCE is a registered trademark of the AAAS. Domestic individual membership and subscription (51 issues): $75. Do- rnestic institutional subscription (51 issues): $120. Foreign postage extre: Canada $46, other (surface mail) $46, air mail via Amsterdam $85. First class, airmail, school-year, and student rates on request. Single copy sales: Current is- sue, $3.50; back issues, $5-00; Biotechnology issue, $6.00 (for postage and handling, add per copy $0.50 U.S., $1.00 all foreign); Guide to Biotechnology Products and Instruments, $18 (for postage and handling add per copy $1.00 U.S., $1.50 Canada, $2.00 other foreign). Bulk rates on request. Change of address: allow 6 weeks, giving old and new ad- dresses and 11-digit account number. Authorization to photocopy material for intemal or personal use under c'ucum- stances not fallirg within the fair use provisions of the Copyright Act is granted by AAAS to libraries and other users reg- istered with the Copyright Clearance Center (CCC) Transactional Reporting Service, provided that the base fee of $1 per copy plus $0.10 per page is paid directly to CCC. 21 Congress Street, Salem, Massachusetts 01970. The identification code for Science is 0036-8075l83 $1 + .10. Postmaster: Send Form 3579 to Science, P.O. Box 1722, Riverton, NJ 08077. Science is indexed in the Reader's Guide to Periodical Literature and in several specialized Indexes.  The American Association for the Advancement of Science was founded in 1848 and incorporated in 1874. Its objects are to further the work of scientists, to facilitate cooperation among them, to foster scientific freedom and responsibility, to improve the eTectiveness of science in the promotion of human welfare, and to increase public understanding and ap- preciation of the importance and promise of the methods of science in human progress. I228 SCIENCE, VOL. 2q }.
Page 13: brs52e00
ULTRAMICROTOMY BY REICHERT-JUNG BEING A LEADER IS A MATTER OF CHOICE Reichert-Jung is the world leader in ultramicrotomy. As such, we can offer you more choices of ultramicrotomes than anyone else. Choose the ULTRACUT E, the accepted leader worldwide that easily converts to cryotechnique with the new FC4E sectioning system. Or the SUPERNOVA, our newest addition, which offers the ultimate value in an ultramicrotome. Both feature innovations, proven performance, versatility and more. The choice is yours. Make it Reichert-Jung. Rei~chedJung ~ Cambridge Instruments Inc. 111 Deer Lake Rd., Deerfield, IL 60015 (312) 405-0123 Circle No. 178 on Readers' Service Card
Page 14: brs52e00
W1TEi THE ARiSTQPLM YOU CM START IN A SMALL WAY AND COME OUT REALLY BIG ® Ergonomy tube toom Id switchover !tween methods One set of o tics for all methods . `tmanent ~~ ~ehfer illumination r.. Nigh•contrast sur~eY images Wild Leitz USA. Inc. 24 Link Drive, Rockleigh, NJ 07647 Telephone 1-201-767-1100 Telefax 1-201-767-4196 Circle No. 109 on Readers' Service Card Wild Leitz GmbH • D-6330 Wetzlar Telefon (0 64 41) 29-0 Telefax (0 64 41) ?9 33 99 l~ WILD LEITZ
Page 15: brs52e00
Your choice for PCR products Perkin-Elmer Cetus. The PCR technology leader. Don't settle for products that try to imitate the revolutionary DNA Amplifi- cation System. Ours is the only licensed and approved system designed ex- pressly for the patented GeneAmpr"' PCR process, pioneered and developed by Cetus scientists. UNMATCHED ED TECHNICAL SUPPORT Count on outstanding support for your DNA Amplification System. Like a free instructional video with your DNA Thermal Cycler purchase. Or the toll-free technical support number you 11 f PROVEN PCR P.~RFORMANCE can ca to get expert answers rom our Our DNA Amplification System PCR staff. And we'll keep you up to provides you with performance you date with PCR protocol developments, can depend on. You'll perform the PCR applications information, PCR Bibliog- process quickly and efficiently using raphies and a subscription to our our GeneAmp Reagent Kit with recom- newsletter, Amplifications. binant AmpliTaqrI DNA Polymerase. And for easy-to-use, dependable auto- mation, our DNA Thermal Cycler has no peer. Superior technology and proven performance make it the system-of-choice worldwide. FAST DELIVERY OF TAQ DNA POLYMERASE Ordering is easy. For overnight delivery of the GeneAmp Kit and AmpliTaq DNA Polymerase, call PE XPRESS at 1-800-762-4002. And we're fully stocked and ready for prompt delivery of DNA Thermal Cyclers. For more information, contact your local Perkin-Elmer represen- tative. Or, for literature, please call 1-800-762-4000. Only from Perkin-Elmer Cetus- the PCR Technology Leader. PE?KIN ELMER CETUS Circle No. 235 on Readers' Service Card
Page 16: brs52e00
Lower capital investment Lower operating expense Lower set-up time Lower maintenance Higher efficiency • Direct on-line PTH amino acid analysis • Easy sample loading • No Polybrene* or pre-cycling required • Rapid software editing even during a run Higher productivity • Rapid viewing of sequencing results • Easy operation even for first-time users • Engineered for greater reliability Porton's PI 2020 Protein/Peptide Sequencer and PI 2090 Integrated Micro-Sequencing System are designed to streamline your protein sequencing appli- cations by providing exceptional performance, reliability and sensitivity at a price you can afford. With our sequencer's integrated fluid delivery system,t sample supportt and self sealing reaction cartridge,T we can help simplify your micro• sequencing processes. The precise, customized technology of our Integrated System -featuring a Porton- enhanced Hewlett-Packard 1090 L microbore HPLC - allows direct on-line analysis and quanti. tation of PTH amino acids. And, instal- lation, training and service are handled directly by a Porton Instruments cus- tomer service engineer Formore information about Porton's line of protein sequencing instrumenta. tion, call us toll-free at 1-800-822-6333. o~~ ~49 640SP1 THE PORTON PORrON INSTRUMENTS• ING 18740 Oamoid Street Su f e 303 . Tarzana: Calllomia 91356 USA Integrated Micro-Sequencing System pROTE/N (818)9960220or1-800-822•6333 1 B C S LII= SEQUENCER Cleveland House. Acton Green P ryWene• sa equereduxETarr~~AdootC~oaares London W9bHRUK f Tel: 01•995 „'i625 rax 01-995 8610 t +aerenrs oendmg ILD 1968 Fbron ms!rr wn .< Now Available! The PI 2090 Circle No. 167 on Readers' Service Card 204'765192C
Page 17: brs52e00
This Week in SCiENCE Human gene therapy CCEPTANCE of gene therapy as a reasonable method for treating various human diseases and con- ditions has been growing. Unlike other therapies that treat symptoms, gene therapy would get at the root cause of a disease. Gene therapy includes the re- pair of aberrant genes or their replace- ment with genes that have normal struc- tures or that function properly; in the- ory, it could be used for correcting genetic defects, for treating malignan- cies (diseases in which gene expression appears to be pathologic), and even for altering the genes of infectious agents so as to reduce their pathogenicity. Friedmann describes a number of tech- nical advances that have been made in gene therapy, some immediate goals of gene therapy, and some ethical issues that are surfacing and must be ad- dressed as the vision of gene therapy gets closer to becoming a reality (see pages 1233 and 1275 to 1317). Fuels for fertility ERTILITY problems have been noted among lean female athletes and dancers, women with eating disorders, and food-deprived animals. The problems were thought to be caused simply by individuals' low body weights. However, experiments in ham- sters suggest that it is the availability of metabolic fuels-derived from sugars or fatty acids in the diet or from fatty acids stored in adipose tissues-that deter- mines whether sexual cycling will occur (page 1326). Three measures of sexual readiness were followed-ovulation, vaginal discharge, and lordosis (arching of the back that indicates receptivity). Female hamsters were sexually receptive whenever at least one fuel source was available and were not receptive when inhibitors blocked metabolism of both sugars and fatty acids; a prerequisite to sexual cycling is therefore fuel availabil- ity, not some critical body weight or ratio of fat to lean. Schneider and Wade note that reproduction in many mam- mals can be put on hold when energy is needed for survival, for example, for enduring cold winters. Similarly, monthly cycling may cease in thin wom- en whose limited fuel supplies are being expended for other (for example, athlet- ic) purposes. Resetting human clocks N just 2 to 3 days, it is possible, with bright lights, to reset the hu- man internal circadian pacemaker to a new, desired daily pattern (page 1328). Manipulation and adjustment of the pacemaker could be a great help to travelers who experience jet lag, to shift workers, to people suffering from cer- tain sleep-wake disorders, and to indi- viduals who perhaps experience "sea- sonal depression." In experiments with healthy subjects, Czeisler et al. show that the timing of exposure to bright light, indoor light, and darkness is key to determining how quickly the phase of the rhythm will be shifted and which direction-forward or backward-it will move. Body temperature, which drops to its daily low 2 to 3 hours before normal wake time, was used as a proxy for the internal pacemaker's rhythm; the daily rhythms of two other markers-urine output and plasma cor- tisol levels-shifted coordinately with shifts in body temperature, indicating that all three parameters are driven by the same pacemaker. The extreme light- sensitivity shown by the human pace- maker, a sensitivity that only insects and plants were thought to possess, indi- cates that the pacemaker is quite flexible and has great potential for change un- der the right inducing conditions. (See also page 1256.) Troublesome antibodies oT all antibodies that are pro- duced during viral infections help curb infections; some ac- tually enhance the ability of viruses to enter cells (and then to proliferate and spread). The immune phenomenon of enhancement poses difficult problems for vaccine development because a safe vaccine must elicit only protective anti- bodies; it is necessary to identify viral antigens that elicit enhancing antibod- ies and exclude them from vaccine prep- arations. A case in point is a vaccine for AIDS. Blood from patients with AIDS and from animals infected with the AIDS virus often contains enhancing antibodies. Homsy et a1. found that complexes of enhancing antibodies and viruses attach to FcRIII receptors on the surfaces of macrophages (page 1357); other cells in the immune system also have FcRIII receptors (including lymphocytes, which play several key roles in AIDS). The experiments sug- gest that it may be necessary to block two kinds of receptors in order to pre- vent the AIDS virus from spreading in an infected individual-the FcRIII re- ceptors to which viruses complexed with antibodies bind and a second re- ceptor to which viruses bind when they enter cells on their own. Damage from PCP and MK•801 drug that has been under consid- eration for use in the treatment of neurodegenerative diseases may be too dangerous to use; although MK-801 provides protection to the ner- vous system-it interferes with excitato- ry and toxic actions of certain amino acids-it also produces major (though reversible) morphologic changes in cer- tain brain cells (page 1360). MK-801 binds to the receptor in the brain used by PCP, which is a potent street drug that can induce psychotic behavior. Studies by Olney et al. indicate that MK-801, PCP, and two other com- pounds that have affinity for the "PCP receptor" are all toxic for nerve cells in restricted regions of the rat brain-the posterior cingulate and the retrosplenial cortices. Cells fill with large vacuoles and lose mitochondria (structures that contain metabolic machinery). Because the psychotic behaviors induced by PCP-type drugs resemble behaviors characteristic of schizophrenics, it is conceivable that endogenous substances like PCP induce psychoses in schizo- phrenics by acting on the same cells in the same regions of the brain affected by PCP. 16 JUNE 1989 THIS WEEK IN SCIENCE I23I I~ l+
Page 18: brs52e00
?R1%Ar cet 1.0' FIG.1 1 2 3 14 mer 9 mer 6 mer FIG. 2 1 602 - 2 3 M ~- C03 411111111111I-234 217- 138-{ 11 ~5 (3' Fragmerrt) 90-- 85- (5' Fragmerrt)44-{ 4 5 6 7 8 Mb 404*6.0040*4ft T7 Promoter I Hinc II Major Late t T r ------- ~ CUCU cCUu ppp _ 44 G- G i 217 118 Early Hind III r T ------ SV40 """--- DNA CCCU - 1 00 440~-194 CuCU, RNA Transcript OH Digestion Products r UUCU CuClfl 138 115 FIG. I Demonstration of the Specificity of Cleavage. RNAzymeTM' Tet 1.0 was incubated with seven different oligomeric RNA substrates: lanes 1 and 2, 5'GGGACCUCITAAAAA3'; lane 3, 5'GGGACAUU(jAAAAA3'; lane 4, 5'GGGACGGCLIAAAAA3'; lane 5, 5'GGGACACCLTAAAAA3'; lane 6, 5'GGGACACAIjAAAAA3'; lane 7, 5'GGGACUAAITAAAAA3'; lane 8, 5'GGGACGAALTAAAAA3'. Lane 1 is a no hbozyme control. The reaction contained 0.10µM substrate ([a-32P] ATP labeled), 0.01µM RNAzymer" Tet 1.0, 2.5M urea, 0.5mM GTP, 20mM MgCl2, 50mM Tris-HCI (pH 7.5). Incubation was for 1 hour at 50°C. Samples from each reaction were electro- phoresed on a high percentage acrylamide denaturing gel and the bands of substrate and digestion products were identified by auto- radiography. Only the matched substrate in lane 2 was cleaved. FIG. 2 RNA Fragments of SV40 and Physical Ma . SV40 RNA (610-nt~was glyoxalated and then cleaved with RNAzymeT'" Tet 1.0 at 50°C in a reaction con- taining 1.5M urea. The RNA frag- ments were detected by two dif- ferent labeling schemes which together identify the 5-terminal fragment. The lanes are as follows: lane 1, 32P-labeled RNA transcript uncut; lane 2, unlabeled RNA cut with ribozyme in the presence of [32P]GTP; lane 3, body-labeled RNA cut in the presence of unlabeled GTP: M, glyoxalated Haelll frag- ments of ¢X DNA. The fragments were separated by electrophoresis in a 4% acrylamide gel containing 8M urea and the bands were visualized by autoradiography. The physical map shows the loca- tions and sequences of the RNAzymer"I Tet 1.0 cleavage sites in SV40. 'RNArymeTx" Tet tA (Ribozyme Tet 1.0) cucu specific RNArymep'' is USB's brand of Ribozyme. Ribozymes - Patents pending. The results shown illustrate the site- specific cleavage activity of RNAzymeTM Tet 1.0 on both oligo- meric and larger RNA. They confirm the results originally reported for the Tetrahymena group I intron derived ribozymes (1,2). This work provides the basis for the experimenter to generate digestion patterns of larger RNA and to attempt studies involv- ing the detection of different forms of RNA (e.g., alternatively spliced RNA) in complex populations. Studies involving in vitro transforma- tion of purified RNA fragments could also be possible. The devel- opment of RNAzymeT'" Tet 1.0 to its full potential as a biological tool will depend upon further characterization of its enzymatic activity as well as the development of specific protocols. The RNAzymeT'" Tet 1.0 kit in- cludes sufficient ribozyme and reagents to allow a variety of inves6 gations. The Control Substrate in the kit is provided to allow calibration of the RNAzymeTM Tet 1.0 activity since activity is dependent upon the con- centration of GTP, urea, and cleavage sites as well as the ribozyme con- centration. Selection of various con- ditions for cleavage depends upon the fraction of sites needed to be cleaved; the amount of radiolabel needed to be incorporated into the fragments and the degree of se- quence specificity desired. RNAzymeri Tet 1.0 Product Na 72000 Individual components are available separately For a free copy of our General Biochemicals and/or Molecular Biology catalogs, write USB at P.O. Box 22400, Cleveland, Ohio 44122. Contact USB 24 hours a day: U.S. and Canada 800-321-9322, within Ohio call collect 216-765-5000, TLX: 98071 S, FAX: 216-464-5075. References: 1. Zaug, A.J., Grosshans, C.A., and Cech, T.R., Biochemistry27, 8924-8931 (1988). 2 Zaug, A.J., Been, M.D., and Cech, T.R., Nature 324, 429-433 (1986). ~ United States Biochemical INTERNATIONAL DISTRIBUTORS: BioTrade - Austria • Cambridge BioScience - Cambridge. England • Kebo - Spanga, Sweden; Ballerup, Denmark; Oslo, Norway • Lucerna•Chem AG - Lucerne. Switzerland • Maagar - Rehovot, Israel • Quimigranel•S.A. - Spain • Renner GmbH - Dannstadt, W. Germany • Rijnland - Cape(le aid Ijssel, Hogand • Societa ItaGana Chimiei - Roma, Italy • Sapar•Biochem SA - Benelux • Touzart et Matignon - Paris, France • Toyobo Company, Ltd. - Osaka, Japan • Trace Scientific - Baulkham HiIIs, Australia. i Circle No. 231 on Readers' Service Card
Page 19: brs52e00
ONCOMOUSE7shortens the patli to knowledge in _carcinogenesis ONCOMOUSE TMlras transgenic animal is the first in vivo model to contain an activated oncogene. Each OncoMouse carries the ras oncogene:in all germ and somatic cells. This transgenic model, available commercially for the first time, predictably undergoes carcino- genesis_ OncoMouse reliably develops neo- plasms within months...and offers you a shorter path to new answers about cancer. Available to researchers only from Qu Pont, where better things for better living come to life. For more information about OncoMouse and monoclonal antibodies for specifically detecting the activated ras oncogene pro- tein, call 1-800-551-2121. ZZ ~ ~ ~ ~ ~-- : ~~-Better things for. better living .~ , Circle No. 243 on Readers' Service Card
Page 20: brs52e00
scovenes are waibng to be made R... : _ . .-. _ Again,the NanoScope (l is a partner in dis- covery as it redefines the leading edge of STM performance. Iodine adsorbed on platinum, as shown on the left, has only been imaged using the Nanoscope II. The image of RNA on the right was made by scanning the uncoated sample directly, demonstrating an im- portant new ability. Two hundred NanoScopes are laboratories because re- searchers recognize that images like these are made possible through Digital's commitment to extending the state-of-the-art. ' already in and information about your specific application. Digital Instruments: The Leader in Scanning Tunneling Microscopy ~ 135 Nogal Drive, Santa Barbara, CA 93110 Tel: (805) 967-2309 FAX: (805) 683-4325 Circle No. 253 on Readers' Service Card The NanoScope is constantly being made more powerful and easier to use, opening new doors in such diverse areas as Biology, Chem- istry, Electro-chemistry, Semiconductors, and Materials Science. The discoveries are waiting to be made. The NanoScope II is an easy-to-learn, turn- key laboratory tool that can get you into STM now. A complete system, including everything you need for STM, costs only $69,000. Call Digital Instruments today for a detailed brochure
Page 21: brs52e00
Letters The Dingell Investigation In the 19 May issue of Science, Barbara J. Culliton reports (News & Comment, p. 765) that, while talking to reporters during a break in the congressional hearing, I made new allegations in the Baltimore-Imanishi- Kari affair and cited evidence that had not been made public. This is incorrect. What I said was simply a repetition of my own testimony or that of the Secret Service. Specifically, I was questioned by reporters about whether the authenticity of certain data could ever be determined. I restated mv belief that the question would be answered definitively and that the forensic evidence would show I was telling the truth. Walter Stewart then remi.nded the report- ers about the forensic analysis of gamma counter output tapes described by the Secret Service during the 4 May hearing. When complete, this analysis alone could settle the question of whether or not the data are authentic. However, as stated at the hearing, the Secret Service needs some additional information before issuing a definitive re- port. As Representative John Dingell (D- MI) stated at the hearing, resolution of the issues has been delayed by the authors' decision not to answer questions from the investigating staff of the congressional sub- committee. The same article reports, "As one charge is answered, another is made, leading scientists to charge O'Toole with creating a constant- Iv moving target." My charge is, as it has been from the beginning, that the central claim of a paper by D. Weaver et al. (1) is not supported by the underlying data. I am not the target of the investigation, and the movement of the target is not under my control. The historv is as follows. In Mav 1986, I discovered that there were serious misstatements in the published paper. I brought my concerns in writing to the au- thors. The authors acknowledged some of the misstatements, but refused to submit a correction. Herman Eisen, who was solelv responsible for the Massachusetts Institute of Technology's investigation, has testified that he did not even look at data before reporting to the MIT administration that the paper required no correction. I then dropped the matter, but others pursued it. Two years later I was called to testifv at a congressional hearing. I stated that the au- thors had refused to correct known errors. A panel of the National Institutes of Health then investigated and issued a report con- firming many of my assertions about the published data and stating that the errors were "serious." However, the panel ruled that the central claim of the paper was supported by unpublished June 1985 sub- cloning experiments. The NIH report called for these suhcloning experiments to be pub- lished in "replacement" of the published data. (The authors, however, replied that they have a difference of opinion with the investigative panel. Instead of replacing the published experiments With the unpublished experiments, they simply submitted a small sample of the subcloning data.) When I received the panel's report, I immediately informed NIH that in May 1986 I had been told that no such subclon- ing experiments had ever been done, Thus, I am now raising questions about the authen- ticity of certain data submitted to the NIH panel. Some of this questioned data has recently been published in Cell (2) in the form of a correction required by NIH. As James B. Wvngaarden testified, NIH relied on statements from others involved in the case in concluding that my assertions were not likely to be correct. Since then, however, the Secret Service has determined, and the authors do not dispute, that at least some of the data was entered in the notebooks after I asked to see them. Forensic experts also testified that certain alterations of laboratorv records were probably done with an"attempt to conceal" the changes and that certain experi- ments, not just the recording of data, may not be authentic with respect to time. In light of these and other revelations that Wvngaarden described as "disturbing," the newly reopened NIH investigation will in- clude the complete forensic analysis. The article bv Culliton incorrectly states, "O'Toole called into question the validitv of experiments compiled by coauthor Thereza Imanishi-Karl after she had examined just 17 pages of Imanishi-Kari's raw data." As all involved have acknowledged, this is not what happened. In fact, I met with Imani- shi-Kari and reviewed all data she presented before I reported to Eisen. MARGOT O'TOOLE 44 Clark Road, Brookline, MA 02146 REFERENCES 1. D. Weaver et al., Cell 45, 247 (1986). 2. T. Imanishi-Kari, D. Weaver. D. Baltimore, ibid. 57, 515 (1989). I am concerned that readers of "Dingell v. Baltimore" (News & Comment, 28 Apr., p. 412) will not "see the forest for the trees." We should remember that the central issue of who shall defend ethical science against scientific misconduct far transcends the de- tails of this case, Representative John Din- gell's investigation is a serious encroachment on the free pursuit of science and upon scientists' right for self regulation. Just as all citizens have a right to a jury of peers for civil offenses, so must scientists have a right to be judged by their peers in cases of alleged scientific misconduct. A congres- sional subcommittee hearing is not the fo- rum for judging the validity of complex experimental results. The establishment of infrastructures in research institutions for the investigation of scientific misconduct and unprofessional behavior would better serve science as well as the patrons of sci- ence: Congress and the public. DON S. DOERING Whitehead Institute, and Department of Biology, Massachusetts Institute of Technology Cambridge, MA 02142 Responsibility Most scientists agree that scientific mis- conduct falls into two categories: fraud, a rare event but well publicized when discov- ered, and negligence, w-hich is far more common. The problem of willful fraud in science probably has no simpler solution than that alreadv evident: intellectual curios- ity and open debate. Negligence is a more difficult problem, for which there is also a simple solution: scientific journals should require a "responsible author" (RA) for each manuscript. This person would assume re- sponsibility for the methods and results described in the published article and, should there be misconduct by any of the authors, the RA would be culpable. Correc- tive measures taken by granting agencies would also be the responsibility of the RA. Among the items of particular concern to RAs in biomedical manuscripts would be understandable and reliable descriptions of methods; molecular sequences of macromol- ecules that are correct; and the number and type of controls for such techniques as the polymerase chain reaction and in situ hy- bridization. The proper and humane care of experimental animals and the longevity and health of control animals is fundamental to good science and should be assured by the RA. If cell lines or long-term cultures were used, the RA should determine whether or not the cultures have been recently tested for infection with organisms such as mycoplas- ma. Theoretical and experimental work in chemistry, physics, and earth sciences should share the same general principles. Designating an author to assume respon- sibility for the reliability of methods and data mav seem a part of being the "senior" author of an article. However, since customs E 16 JUNE 1989 LETTERS 1243
Page 22: brs52e00
f NVERTED IVI[CROSCQPE The astonishingly bright, high- contrast image. The wide selection of quality accessories. The large stationary stage for maximum stability. The very modest price. The renowned Diaphot. It's the inverted microscope from Nikon that's designed to meet all the requirements of your research laboratory. The Diaphot utilizes Nikon's exclusive CF optics, famous for their crisp, clear images. These optics deliver the extra edge that's needed in today's research and clinical laboratories. A wide selection of accessories allow you to meet all the docu- mentation requirements of your laboratory-from 35mm to large format and Polaroid,~ CCTV and cinemicrography. With special CF objectives ranging from 4X through 100X, the Diaphot has complete capability in phase contrast, fluorescence and Nomarski DIC. The Nikon Diaphot is engineered for functional performance and reliability. For maximum stability, its solid die-cast body has a very low center of gravity and the fixed stage makes Diaphot ideal for micro- manipulation. And in addition to everything you heard, the Diaphot's striking superiority is available at a very modest price. To learn even more about the renowned Diaphot, contact: Nikon Inc., Instrument Group, 623 Stewart Avenue, Garden City, NY 11530. (516) 222-0200. ils: O ~ -? l1 /ikOr,. Extending Man's Vision CZ, n
Page 23: brs52e00
Early Data: Losing Our Memory? Researchers are of one mind when it comes to judging the accessibility of the most important earth surveillance program to date-Landsat. "A national disgrace," says Francis Bretherton, director of the Space Science and Engineering Center at the University of Wisconsin at Madison. In an attempt to "commercialize" Landsat, the government in 1984 turned over all of the system's data, past and future, to a private firm called EOSAT. As a result, researchers claim, the cost of using the data has risen tenfold and the usage by scientists has plummeted. Richard Williams, a map maker and analyst of global ice patterns at the U.S. Geological Survey (USGS), says, "Most researchers have a very small budget for data acquisition, $1500 to $2000; Landsat images are now priced totally out of the range of an individual scientist.... If you want the scientific community involved, you must make the data available at an affordable price." Because Landsat is subsidized by the government and data are priced at commercial rates, Bretherton concludes, "We have the worst of all possible worlds: we are both spending the money and making sure that we get nothing out of it." Meanwhile, managers of the 17-year-old Landsat archive, an excellent historical record, are struggling to overcome barriers created by obsolete computers and broken tape decks. Allen Watkins, director of the USGS center in Sioux Falls, South Dakota, where Landsat tapes are kept, says, "90% of the data collected before 1979 are now inaccessible." The reason: the data tapes were recorded on old Xerox computers which can no longer be operated. In addition, the satellite location and timing data were recorded on a kind of video tape deck that no longer exists. Tape renewal is another problem that looms in the future. Magnetic images "bleed" through the layers as time passes, and tapes must be recopied at least once every 10 years to make them usable. Watkins says the task is already formidable, and wonders what will happen when the Earth Observing System begins sending back the equivalent of an entire Landsat archive every 2 weeks. Helen Wood, satellite data chief at the National Oceanic and Atmospheric Administration in Washington, D.C., says that NOAA's centers are already "drown- ing in data," and the task of making it usable today "is a challenge to say the least." NOAA's archives are not as well funded as the USGS system, she says, and the cost of storing the new EOS data will be "staggering." The system is so bogged down even now that people call the data centers "data cemeteries." Roy Jenne, a researcher at the National Center for Atmospheric Research in Boulder, Colorado, has made a second career of helping people find their way around the weather archives. His own list includes some low-cost improvements: filling in the gaps of missing ocean and temperature data for the World War I and II periods ($1 million), initiating a comprehensive exchange with the Soviet Union, giving wider distribution to military satellite images of polar ice and snow ($150,000 to start), and preserving 12,000 tapes of older NOAA satellite data, recently stashed in a warehouse where they were exposed to water.  E.M. way toward solving the manpower shortage. These awards would be made specifically for research on global change or EOS-related work. However, Butler says the idea has not been approved by the Office of Management and Budget. As for satellite data management, Butler agrees that the record of the past is "horri- ble" and that the demands of the future will be "a big challenge." Few people realize just how big. Allen Watkins, director of the Earth Remote Observation System data cen- ter in Sioux Falls, South Dakota, keeper of Landsat records for the U.S. Geological Survey, anticipates that NASA's new earth- watching satellites of the 1990s, if launched, will create as much data every 2 weeks as Landsat has created in its entire 17-year lifetime. Butler is full of hope, nevertheless, be- cause he expects the cost of electronic data systems will keep falling and their sophisti- cation will keep growing. "You would not expect a computer of 10 years ago to assimi- late the data from EOS in a reasonable way," says Butler, but "if you look ahead to what you're going to be able to do 10 years from now, you sav, `Hey, the technology is there, the infrastructure is there.... Now it's up to us to get the intellectual wherewithal together to pull it off.' " Already, NASA centers have started publishing large sets of Francis Bretherton: Problems in accessing Landsat data are "a national disgrace." processed earth observation data on CD- ROM disks, the same laser-coded devices used for recording music. "I have a complete set of the Antarctic ozone hole observations on a disk sitting on my file cabinet," says Butler. Hansen is not impressed: "Somebody at the Goddard meeting made the mistake of saving that the data you'd get in 1 year from EOS would fill a building the size of a football field, seven stories high." But, Han- sen notes: "Information is not proportional to the amount of data." It is not enough to turn the data over to computer wizards; the information must be interpreted by special- ists, and these are few in number. The structure of the data system used by EOS will be significantly better than previ- ous ones, according to Butler and Wesley Huntress, Jr., special assistant to the director of NASA's earth sciences division. It has been designed from the outset to be com- prehensive and highly accessible. Research- ers who participate in EOS will be com- pelled to use a common format (with data- processing algorithms submitted before launch), and they will have to pool their data in a common archive for wide distribution. In return, NASA is promising to let investi- gators keep their records confidential for 18 months-at least in the case of one yearly mission, the Upper Atmospheric Research Satellite (1991). But on later projects, after EOS begins in earnest in 1996, researchers will be expected to release data immediately. This approach will require not just the cooperation of individuals, but of competi- tive agencies like NASA, the National Oce- anic and Atmospheric Administration (NOAA-the weather agency), and the U.S. Geological Survey. The agencies have agreed in principle to play the game as NASA directs, and negotiations are going I I2$O 2047651912 SCIENCE, VOL. 2t}.{.
Page 24: brs52e00
Technology Update Latest LSC technology cuts sample and cocktail costs; increases throughput In the past, liquid scintillation counting used traditional technology to overcome background noise. Now, there's a new, more sensitive technology - TR-LSC or Time-Resolved Liquid Scintillation Counting - that reduces background noise by an additional 30%-40%, and more. This new patented technology is available only in Packard's Tri-CarbQ liquid scintillation analyzers. Originally developed for extremely low level counting, TR-LSC tech- nology has now been applied to a broad range of applications. While these don't always require high sensitivitv, additional benefits have been realized. By increasing sensitivity, TR-LSC reduces sample and cocktail consumption while shortening the time required for accurate counts. The benefits? Lower cocktail costs, lower disposal costs, and increased throughput. How TR-LSC is superior to older technology Traditional counters are based on two- dimensional pulse analysis: pulse height and pulse counts. They provide a level of sensitivity that's merely adequate for most applications. Patented TR-LSC adds a third dimension to pulse analysis: a pulse index that measures over time the after- pulses associated with background. In doing so, TR-LSC clearly distinguishes between beta pulses and background pulses. By identifying, and reducing, background noise, TR-LSC provides a great level of sensitivity (see chart comparing E`/B values) and more accurate counts. t ~ 960 Prompt Pulse - - ~ Afterpulses (Pulse lndez=4) A/ AA\_~_~l -Up to 5µs The typical beta scintillation pulse (top) is very fast and may be followed by a delayed component. The typical background pulse is followed by a series of afterpulses. Patented TR-LSC distinguishes between the two. 1200 1000 m e°° ~ 600 400 -no 0 Ja "c Typical EZ/B values for'H and "C using traditional and TR-LSC counting. Achieve accurate counts on samples as small as 25 µL Traditional technology limits sensitivity. The improved sensitivity of TR-LSC, however, allows you to achieve accurate DPM results for single and dual label samples in volumes as small as 25 µL. That can add up to substan- tial savings in sample and cocktail costs. Slash radioactive waste disposal costs Counting smaller samples will also reduce radioactive liquid disposal costs, which can be $500 per drum, or higher. While you may not pay this cost directly, your operating budget could be affected. With TR-LSC you can cut operating costs while reducing environ- mental hazards. Increase sample throughput by over 80% Just as TR-LSC reduces the volume of sample and cocktail required for accurate counting, it also reduces the time required for an accurate count. By cutting background in half, high sensitivity TR-LSC lets you count nearly twice the number of vials of a 250-DPM sample, in the time it would Circle No. 258 on Readers' Service Card take to count a single vial using conven- tional technology. For lower activity samples, the increase in through- put with TR-LSC is even greater. Automatic data interpretation, too Another advanced feature available only with Tri-Carb analyzers is automatic tandem processing. This unique capability processes your counting data automatically using one software program after another - RIA packages, spreadsheets, word process- ing, or custom-written programs - until the results are printed in whatever format you have specified. All this is done automatically, without operator intervention, for up to 30 users. Free Investigator's Guide provides a complete explanation of the benefits of TR-LSC More information on TR-LSC, and other exclusive Packard features, is available in a new publication, the Investigator's Guide to TR-LSC Technology and Tri-Carb Liquid Scintillation Analyzers. For your free copy, mark the reader service number below or call us today. Call toll free 1-800-323-1891 or FAX 203/235- I347. MAcVARD A Canberra Company Sales and Service in over 60 countries throughout the world.
Page 25: brs52e00
1W ',~ in science news and research - over 900 peer 111r /U . Scientists who know, know SCIENCE. Every \ week SCIENCE brings the latest developments reviewed articles each year - to your desk. SCIENCE is part of your membership in the AAAS, the leader in science education, policy and opportunities. You'll stay in the know every week with SCIENCE. AAAS Membership Application 1989 Membership Dues YES. Please begin my membership in AAAS, including my subscription to SCIENCE (51 issues/year) Check one: 0 Regular: $75* El Full-time students: $40' (Payment must accompany order.) 0 Postdoctoral rate: $50' (Payment must accompany order.) Charge my: Name (please print) F7 VISA 1:1 MasterCard Address for SCIENCE Card 0 - Expires- Signature City Date State Zip 'PI~ ~riatW higher. 542.0o allocated for SCIENCE. 89ED246 8-8 weeks for receipt of first issue. ~~~~~rr~~~~~~~~~~~~~~~~ ~~ ~ ~ ~ ~ ~ ~ ~ ~ . Scientists who know, know SCIENCE. Every week SCIENCE brings the latest developments in science news and research - over 900 peer reviewed articles each year - to your desk. SCIENCE is part of your membership in the AAAS, the leader in science education, policy and opportunities. You'll stay in the know every week with SCIENCE. AAAS Membership Application 1989 Membership Dues YES. Please begin my membership in AAAS, including my subscription to SCIENCE (51 issues/year) Name (p ease pnnt) Address for SCIENCE Check one: C] Regular: $75* ~ Full-time students: $40* (Payment must accompany order.) Postdoctoral rate: $50' (Payment must acoompany order.) Charge my: l] VISA 7 MasterCard Card #_ Expires- Signature City Date State Zip 'Foreiqn rates hipher. $42.00 allocated for SCIENCE. Please allow 6 8 weeks for receipt of first issue. B9ED246
Page 26: brs52e00
EPA Drafts New Research Agenda "We must develop the capabilities to antici- pate and prevent pollution, rather than sim- ply controlling and cleaning it up after it has been generated." So writes Erich Bretth- auer, acting chief of research and develop- ment at the Environmental Protection Agency (EPA), in a radical proposal to overhaul environmental science in the U.S. government. Bretthauer describes a plan to boost sup- port for basic science in a 70-page draft paper that has been obtained by Science. Entitled "Protecting the Environment: A Research Strategy for the 1990s," it was prepared this spring in response to recom- mendations made by a group of outside advisers to EPA. EPA Administrator William Reilly has seen this report, and, like his predecessor Lee Thomas who commissioned it, he is said to favor its goals. But he has not endorsed it. Nor has the White House, which would have to defend the increased EPA budget. The outsiders who urged EPA to beef up the research program belong to a subcom- mittee of the agency's Science Advisory Board, a group chaired by Alvin Alm, a former policy-maker at both the Depart- ment of Energy and EPA who was recently made an executive at SAIC Inc., a Washing- ton, D.C., consulting firm. The Alm com- mittee wrote last year that the government ought to double its funding of environmen- tal research in the next 5 years and put more emphasis on investigator-initiated projects (Science 23 September, p. 1596). Alm says the price for increasing funda- mental research, or "core" research as he suggests, would be about S70 million each year, climbing to a level of $400 million 5 years hence: "Not a hell of a lot in the context of the total EPA budget of S5 billion," he claims. The Administration this year proposed increasing EPA's research budget by $33.6 million. According to a congressional staffer, this indicates that Cambridge to Oversee Animal Research The Cambridge, Massachusetts, City Council voted this month to appoint its own commissioner to oversee the treatment of research animals. It is now drafting a detailed ordinance for final approval later this summer. The measure is less Draconian than it may sound for the commissioner will have limited powers. The ordinance will merely add another layer of inspection on top of those already carried out by the Department of Agriculture and the state of Massachusetts, and the new commissioner will have no veto power over research. The measure is a compromise following about 2 years of agitation by an antivivisection group, the Cambridge Committee for Responsible Research, that has been pressing for more extreme measures. The organization wanted the city to have the power to veto research deemed inhumane and sought representation by animal rights activists on all institutional committees that oversee research involving animals. But the rightists failed to get what they wanted from the three-person committee advising the city council, even though that committee included a lawyer for the animal activists. The other two members were a veterinarian and John M. Moses, director of the animal care committee at the Massachusetts Institute of Technology. Jane Corlette, director of government relations at Harvard, says the committee, after a yearlong investigation, found no problems with animal care either at local universities or private research institutions-with the exception of a fight between two mice, and a sick mouse whose care had been delayed because the veterinarian happened to be the same one appointed to the committee and had been simply too busy with committee duties. Following the committee's recommendations, the council approved a measure providing for a part-time commissioner knowledgeable about animal health and psychology who must be neither an activist or researcher. He or she is to conduct annual inspections of facilities to determine compliance to federal regulations and guidelines. Private research outfits are also required to have animal care committees like those required for federal grantees, Corlette says they already have them. Moses says the only departure from federal requirements is that inspections will also cover the care of rats and mice, which are not covered by the federal Animal Welfare Act. He says local universities already conform in this respect, but this may add some paperwork for local biotechnology firms.  CONSTANCE HOLDEN White House budget planners are willing to go along with the increase, although they would stretch the doubling period out to 10 years. EPA has become too inward-looking, the Alm panel found, and needs to liberate itself from its role as a regulator. It must develop a broader perspective and learn to ask ques- tions about the environment that have not been asked before. One way to do this, the Alm panel suggested, would be to create a new institute for environmental research which would focus on novel, preventive, and anticipatory research. The Bretthauer report says that the old approach, which it labels "end-of-the-pipe" cleanup, has improved local conditions in many places but has not helped the nation identify or control the really big problems in advance-the kind that accumulate slowly over the decades and gradually erode the fabric of "ecosystems that form the basis for life on this planet." In this category are such effects as the acidification of freshwater lakes, the slow death of evergreen forests, the depletion of stratospheric ozone, pollu- tion of estuaries leading to massive fish kills and toxic tides, the buildup of greenhouse gases, and the growing threat to marine mammals. To help develop a long-term perspective, the research office proposes a "core" pro- gram with studies in four subdivisions: hu- man health risks, ecological risks, risk reduc- tion methods, and basic research grants. It does not say this work should be managed by a new environmental institute but it does indicate that a goal in the grants program will be to foster "a significantly larger, more stable source of funding for investigator- initiated grants and to expand our support of academic centers." Some priorities are ranked by importance. The report says EPA should:  Create a nationwide Environmental Monitoring and Assessment Program to col- lect baseline and trend data on major ecosys- tems and the deleterious effects of pollution.  Fund long-term research in cooperation with industry aimed not just at preventing pollution through the use of mechanical devices, but also through education.  Develop a national database on the extent and the effects of human exposure to pollutants.  "Substantially increase support for the growth and maintenance of an academic environmental research community." paying for more peer reviewed projects and creating new studvi centers. Make a concerted effort to understand the synergistic and additive effects of pollut- ants, particularly at low levels of exposure.  ELIOT MARSHALL 16 JUIIE 1989 NEWS & COMMENT 1253
Page 27: brs52e00
GIf1i%Yi /, W&Gti Look up from your microscope... I f you're counting on a biological research breakthrough. . . you should be counting on this. COULTERCOUNTERZM Labo-r-saving speed You can free time for valu• able basic research by forgetting the tedious job of manual cell counting through a microsco)e. The COULTER COUVTER ZM automatically counts and sizes up to 5,000 cells per second. Uolumetric sampling accuracy with the ZM is better than 0S°/a using the 500µL sampling mode. ZI gradabilit), future needs For added confidence, use a printer to obtain a hard-copy record of exact data: sample I.D., instrument settin;s, counts and analysis time. Add cell size distribution capability with the CHA,N=Ft,T 256, which includes the ability to differentiate viable vs. nonviable cells. 0~ expand data handling and storage capability with AccuComp's IBM`-compatible software. Only the ZM gives you such broad flexibility in a surprisingly economical package. All the service and support you need For complete information about the COULIER COUNTER ZM, call the toll-free number below and ask for extension 2818. And, like all Coulter instruments, the ZM is backed by the world's most recognized service and support team. In the LS., call The naost accurate technique Using the Coulter Principle, the reference method in cell counting and sizim the ZM pro- vides precise three-dimensional cell analysis from 0.4 to L00µm - uncompromised by human error. COULTER CORPORATION Sc'rentiflc Instruments P.O. Box 2145 HiaLeah, Florida 33012-0145 USA (800) 526-6932 Ouuide the US., conracc your Coulrer ep e enmcive, or call 1(305) 885-7131. ? Requte*ed trademark ~f C=4e* Corpo*a[ion. ?~ Cup.+i¢hc Mav, 1988. All riyhc reerved. (Blvt u a regisrered [rademark of Interna[ianal Bwciness Machines Corp. Circle No. 192 on Readers' Service Card RECOGNIZINGYOIR NEEDS ARE MoRE THAN INSTRUMENTAL
Page 28: brs52e00
Bringing NASA Down to Earth A $15- to $30-billion earth observing program for the 1990s draws fire for spending too much on hardware, too little on science IT WAS NOT A WARM EMBRACE but a cool inquisition that greeted U.S. space officials this spring when they appeared at the God- dard Space Flight Center in Maryland be- fore an audience of 500 scientists. They had come to address an exclusive club, the prin- cipal investigators in a massive new research program that will use satellites to track changes in the earth's environment. Called the "Earth Observing System" or EOS, the project is the brainchild of the National Aeronautics and Space Adminis- tration (NASA) and the outgrowth of more than 5 years of planning by earth and space scientists working under the White House science office and the National Academy of Sciences. In January it got a special nod from the President, who endorsed it in a report he sent to Congress urging more money for global environmental studies. NASA's piece of the action, according to its own plan, would be an unprecedented $15- to $30-billion investment in satellite-based research over the next two decades, starting in 1991. The prospect of sharing in this kind of funding, one might guess, would stir even the chilliest researcher's heart. But at least one skeptic in the audience at Goddard rose to ask whether the plan really represented a commitment to science or rather to satellite building. His challenge was greeted with applause. One NASA scientist who asked not to be named called the meeting at Goddard "a `rah-rah, let's go!' sort of session." What baffled him and other doubters was what they see as a compulsion to spend billions of dollars on new technology, even if it pro- duces "horrendous" floods of digital data, at a time when the information system is al- ready swamped and support for creating new scholars to use the data is "minimal." Before pouring money into flashy new hard- ware, the critics argue, the government should shore up basic research and help the existing earth-monitoring systems, especial- ly those with archives that could be used in climate research. The core of EOS-or the Mission to Planet Earth, as NASA calls the entire port- folio through 2010-is a large polar plat- form to be launched in 1996. It will carry a 1248 medium-resolution spectrometer to observe broad changes in vege- tation and temperature, a high- resolution (30-meter) imager that will examine small features of the landscape with very fine discrimi- nation (196 spectral bands as op- posed to 6 on the existing Land- sat), a laser range finder to track shifts in the earth's tectonic plates, and 16 other instruments. Japan and the European Space Agency are committed to flying similar platforms in the 1990s, and these Nimbus-7 TIROS UARS P_h~E] UL Eos Growing, growing .... Earth-monitoring satellites, from the 1960s Nimbus-7 to the 1990s Earth Observing System, are increasing in size and cost. will include U.S. instruments. If funding allows it, the United States will launch a second polar platform in 1998, and possibly a geostationary platform in 1999. To handle all this, EOS demands a new data manage- ment system costing half a billion dollars. Before the big platform goes up, NASA has tentatively scheduled some smaller earth-watching projects for launch, includ- ing the Upper Atmosphere Research Satel- lite in 1991, a joint NASA-France ocean observing satellite known as TOPEX/Posei- don in 1992 or 1993, and a radar-based "scatterometer" to measure wind stress on the ocean in 1995 or 1996, on a Japanese platform. NASA would also like to fly a series of small earth probes to monitor, among other things, the ozone layer and tropical rain formation. Earth scientists will be delighted to get these new gadgets in the 1990s, but in the meantime they worry that the existing space network will decay. Several key systems are tottering toward extinction, and plans to replace them are in limbo. Best known, perhaps, are the problems of the aging Landsats 4 and 5, the civilian land scanners that were almost turned off this spring for lack of funds (Science, 24 Febru- ary, p. 999). These orphans were rescued in May by the White House, and Landsat 6 has been fullv funded. But the program still has not found a welcoming bureaucratic home. Another space waif is a device called Sea- WIFS, a chlorophyll sensor that tracks plankton in the ocean. The last of these, flying on the aged Nimbus-7 satellite, died in 1985. Its replacement was due to fly on Landsat 6, which itself is late. However, in the brouhaha over funding, Landsat's foster- parent, EOSAT, a company that operates the system for the government, decided to throw Sea-WIFS off Landsat 6. Now NASA is seeking a new home for it. In addition, plans to replace the senescent ozone monitor on Nimbus-7 (the one that picked up the famous view of the ozone hole) are less than firm. NASA is trying to hitch a ride on a Soviet vehicle. The weather service has its own troubles. The two-satellite geostationary system that watches hurricanes has been limping along with just one satellite (called GOES), which must be shifted around with seasonal changes to cover shifting areas of concern. Its life is finite. But the replacement for GOES has run into technical troubles, fallen off schedule, and run up extra development costs. When it is ready for launch-in 1991 at earliest-some scientists fear it may pro- duce less reliable data than the old version. "Everyone will breathe a sigh of relief if we get data of similar quality," says Francis Bretherton of the University of Wisconsin, Madison. So while 21st-century scientists will be endowed with a wealth of detailed informa- tion on tropical rain, ozone in the upper atmosphere, and forest growth, the present cadre may have to make do with static resources. One who has gone public with criticisms of NASA's priorities-and who thinks the agency "is mad at me" for doing so-is James Hansen, director of NASA's Goddard Institute for Space Studies at Co- lumbia University in New York and a some- time maverick (see Science, 2 June, p. 1041). He blasted NASA's plan at the meeting, 2047 G 51g1® SCIENCE, VOL. 2q a
Page 29: brs52e00
These "enhancing" antibodies, as they are called, do not neutralize the virus when they bind to it. Instead, Levy says, they may serve to promote the entry of the virus into cells, including macrophages, that the virus might not otherwise penetrate. There have been no problems with enhancing antibodies in the limited vaccine experiments so far. No one is currently willing to predict how long it will be before an AIDS vaccine will be ready for human use. However, Bolog- nesi in his talk pointed out that when re- searchers were developing a hepatitis B virus vaccine, it took 10 years just to identify the viral antigen to use to stimulate a protective immune response. That is the stage that AIDS vaccine work is at now. With the exception of the vaccine devel- opments, scientific news from the AIDS conference was sparse. Still, there were a few surprises. Even the well-studied AIDS virus, known as HIV-1, has not yielded up all its secrets. William Haseltine's group at Har- vard's Dana-Farber Cancer Center in Boston has found that the genome of HIV-1 has at least one, and perhaps two, previously un- recognized genes. One of the new genes codes for a protein that stimulates the synthesis of HIV-1 pro- teins. "We believe it promotes the growth of the virus," Haseltine says. The Dana-Farber workers consequently call the new gene "rap" for "rapid growth gene." The rap gene may have been missed in previous studies, Haseltine suggests, be- cause the viral isolates used carried subtle mutations that inactivated it. The AIDS virus is notorious for its high mutability. A single infected individual can carry many different genetic variants of the virus. The Dana-Farber workers have also dis- covered a second possible new gene in the HIV-1 genome, but have not yet found a function for it. Simon Wain-Hobson of the Pasteur Insti- tute in Paris also raised a warning flag about the extreme variability of the AIDS virus and what it might mean for attempts to correlate the molecular properties of the virus with its pathogenic effects in patients. Researchers have to grow the virus in cul- tured cells to get enough to study its molec- ular and genetic properties. But Wain-Hobson and his colleagues have now compared gene sequences from cultured isolates with those of viral genes obtained from AIDS patients. "What we see in vivo is not the same as what we see in culture. To culture is to disturb," «'ain- Hobson says. This means that studies of cultured virus isolates may not be relevant to what is happening in the patient. That, in contrast to the vaccine developments, is not good news.  JEaia L. MAxx Illuminating Jet Lag Experiments show that bright light can reset the human internal clock by any desired amount, offering treatment for sleep disorders WANT TO BEAT JET LAG? Spend a day at the beach once you get where you're going. That's the advice of sleep researchers Charles Czeisler and Richard Kronauer. Czeisler and Kronauer headed a team of researchers from Brigham and Women's Hospital, Harvard Medical School, and Harvard University who studied how the human circadian clock responds to bright light. Their results, reported on page 1328 of this issue, indicate that our internal clocks respond to light in a fundamentally different way than previously thought. In particular, these clocks can be set forward or back as much as desired, with only two or three doses of light exposure. The discovery may open the door to treatment of sleep prob- lems in not only international travelers but also shift workers and other people whose inner clocks malfunction for various reasons. The claim of strong light resetting will be "very controversial among some people in our field," Czeisler predicts. Since the mid- seventies, many sleep researchers have held that humans are not sensitive to light reset- ting, and that people's internal clocks are synchronized by social contact. The new results contradict that view. The first evidence that humans' internal clocks are indeed sensitive to light came in 1978, when Czeisler showed that ordinary room light of about 200-lux intensiry is enough to synchronize the human circadian system to a 24-hour day. (Without some clues as to what time it is, a human's sleep/ wake pattern, body temperature, hormone secretion, and various other physiological functions all follow a rhythm of approxi- mately 25 hours.) Then, in 1986, Czeisler began to wonder if he could take people whose circadian clocks were set to the wrong time of day and reset them. He exposed a 66-year-old wom- an with a chronic circadian disorder to 4 hours of bright light (7,000 to 12,000 lux, comparable to outdoor brightness at twi- light) every day for a week, and even he was surprised at the result. Previous studies had shown that exposure to light would reset primate clocks by no more than 1 or 2 hours a day, Czeisler recalls, and "we thought her system would respond no more briskly than other mammals." Instead, within 2 days, the woman's clock was reset by 6 hours, enough to get her back in sync with the world. Working from data obtained in resetting Airline terminal: Circadian clocks awry. the older woman's clock, Kronauer, a math- ematician, produced a theoretical model of how light affects the human circadian clock. Using the model as a guide, Czeisler began a new series of trials. He put subjects through 3 days of treatments, with 5 hours of bright light (about 10,000 lux) each day, timing the light at various points during the sub- jects' internal cycles. The results were dramatic. In subjects who were exposed to light during subjective nighttime, the treatment reset internal clocks by as much as 12 hours, unprecedent- ed in human research. The treatments involve more than simply exposing someone to bright light, Czeisler and Kronauer note. Getting the desired response demands timing the exposures properly. To this end, they have generated a phase response curve-a drawing that indi- cates how much a person's clock will be reset, depending on when the light expo- sures are given. ("Phase" refers to the time on a person's internal clock.) Arthur Winfree, a specialist in circadian rhythms at the University of Arizona, says that as far as he knows this is the first published phase response curve for humans. He adds, however, that for years he himself has been using a "best guess" phase response curve gleaned from the little data available. To overcome jet lag when traveling, he spends a couple of hours in bright sunlight at the time indicated by the response curve-in the late afternoon after flying SCIENCE, VOL. 244 11 1256 2047651918
Page 30: brs52e00
saving more thought should be given to the urdetlying science. "The organizers thought I should make these points in private, not in public, but they are ignored if you make them in private," he says. Afterwards, he wrote a strong letter to Dixon Butler, NASA's program scientist for the Earth Observing System. The letter, dated 27 March, speaks about the need to build up "brain power" before deploying machines. The Mission to Planet Earth, Hansen wrote, "is described in terms of the number of pieces of hardware in the sky." He was concerned that the scientific disciplines will be "squeezed to allow sup- port of EOS research." Available sources of earth science data are now "underutilized" he contended, yet even the winners of the EOS competition have been told they will be funded at just one-third the requested level. This limit cannot be justified on grounds that R&D for equipment will re- quire more funding in the early years, Han- sen wrote, because "development of scientif- ic manpower and understanding will take longer." He said that if science gets the "short end" at the outset, 've can expect that situation to continue as inevitable hard- ware cost overruns occur." Since March, NASA has not responded to the letter, but has adjusted the EOS plan a bit. Butler, an expert on Venus's ionosphere Low-Tech Earth Observation Twice every day-when the sun stands exactly at noon over Greenwich, England, and when it reaches the opposite global position (midnight, Greenwich time)-small balloons climb in unison from more than 700 points over the earth's surface and penetrate the upper atmosphere. They burst at a height of 7 to 8 miles, falling down to the surface again. This carefully orchestrated event, which to an alien eye might look like a bizarre natural phenomenon peculiar to the planet Earth, is part of the daily routine of the world's weather services. The release of these atmospheric "sounding" balloons has been going on for decades (though not in such large numbers). And the information on temperature, pressure, and humidity radioed back from the little balloons has produced a database that is valuable to students of climate change. The little balloons contrast sharply with the multi-hundred-million-dollar satellites that will be used in the Earth Observing System (EOS), if NASA has its way. But some meteorologists worry that in a rush to build new technology we may neglect invaluable-and cheap-sys- tems already in place, like the balloons. Although these and other weather station records are collected for immediate forecasts, they have been gathered in a fairly consistent fashion over the decades and fbrm a good long- term record. However, in recent years, says Thomas Karl of NOAA's National Climatic Data Center in Asheville, North Carolina, con- trol of systematic bias has declined. Karl says that the data could be managed better than at present. It is more important than ever to identifv differences in historic methods of data collection, for the search is on for tiny signals- as small as a 1°C change in a century. Climate watchers have been aided tremen- dously by satellites, but the new gadgets also introduce new problems, Karl says. For one thing, satellites are relatively short-lived and must be replaced after a few years. Changes in sensors may introduce subtle discontinuities in the data, which must be identified and taken into account. In addition, Karl says, no satellite is more accurate than ground-based observa- who says he is now excited by the public service aspects of space science, agrees with Hansen's main point: "I think Jim was right on the mark. I had been so busy worrying about other things that I hadn't backed up from the trees enough to think about [the forest]." In his view, Hansen is saying, "This is a whole new space age, you're about to take us into, and you're not making the community infrastructure investments that are required." As a remedy, Butler has pro- posed that a 0.25% "tax" be imposed on the EOS program and that the funds be set aside for graduate fellowships. He thinks it would pay for about 100 students a year-tuition plus a modest stipend-and would go a long tions because each sensor is calibrated to "ground truth." Errors in ground data will be echoed in the satellite. Karl thinks the government could get an excellent return for its investment in climate research by paying to gather and tidy up the existing data from ground stations. Thus far, for example, the World Meteorological Organization (WMO) has had little suc- cess in a small project aimed at getting nations to record the most basic weather information in digital form on personal computers donated by the WMO. "It's been 4 years since the program started," Karl says, "and we've seen no data yet." He adds that the Soviet Union has data "we would love to get our hands on," but so far there has been no breakthrough. Another field in which federal dollars would make a big difference is ocean research. Information on changes in sea level is critical for studies of global temperature change and ice melting, but little has been spent to extend ocean monitoring to remote areas of the globe. For example, Klaus Wyrtki of the Sea Level Center at the University of Hawaii in Honolulu has been trying to establish a small set of tide gauges in the Pacific and Indian oceans for years. His colleague Gary Mitchum says they are appreciative of every bit of federal support they get but it is hard to maintain a 20- year monitoring project "when you have to worry about funding every 6 months." Using technology from the late 19th century (stilling wells) connected to 20th-century trans- mitters, they maintain a network across a vast expanse of water, contributing to an archive whose longest records go back 150 years. It is important to have broad coverage to be certain that increases in water height are not just local anomalies. Each season they face a dilemma: jI should they push forward and set new gauges or protect the ones in place? "They require continual care and feeding; as soon as you stop, they go away," says Mitchum. The work done at the center "falls between the cracks" of the federal sponsors, he says, because it looks like routine monitoring to research agencies, and like research to opera- tional agencies.  E.M. 16 JUNE 1989 INEWS & COMMENT r2q.9
Page 31: brs52e00
I In an attempt to meet some of industry's concerns, the government of Chancellor Helmut Kohl-who himself represents BASF's home town of Ludwigshafen in the federal Parliament in Bonn-has just pro- duced draft proposals for an umbrella law covering all aspects of genetic engineering. The proposed law would, for example, give the Federal Ministry of Health author- ity to license new facilities (except those using only nonpathogenic organisms, which would continue to be licensed at a local level), based on advice from the Central Commission for Biological Safety. All organisms would be classified according to their degree of potential hazard and only those production facilities involving highly pathogenic organisms would need to be publicly debated. The proposals have met with cautious support from industry, but they face some potentially tough opposition. Many individual states, for example, are expected to resist any reduction in their local licens- ing powers, and environmentalists are likely to criticize the proposed reduction in public involvement in licensing decisions. "The proposed law seems to be aimed at protecting genetic technology from the public, and not the other way round," says Barbel Rust, a parliamentary repre- sentative of the Greens Party. The battle lines, in fact, are al- ready being drawn. Industrialists ducing human insulin that it started devel- oping in the early 1980s. Not all German scientists feel the public is entirely to blame. Says Afting: "We have been living in an ivory tower and have missed the opportunity to tell people what is really going on in science." Other scientists argue that political and scientific leaders should be doing more to promote a positive image of genetic engineering. Says Bujard: "In Bonn, no one now talks of genetic engineering in a positive way, and we do not Acker at BASF says that, because few genetic engineering products have yet reached the production stage, the full impact of the current law is yet to be felt. But, he says, "we are running out of time." Says Afting at Hoechst: "At the moment, we are reluctant to invest more in genetic technolo- gy, at least on the production side, here in Germany." Referring to the difficulties with the insulin plant, he adds: "We must know that if we build a plant, it can be completed and put into use within a specific period of time; at present, we have a legal situation which causes major de- lays, because of the requirement for a public hearing before permission to build and operate a production plant is granted." Is there no way out for Germa- ny? Despite the ferocity of the rhet- oric, compromise may still be possi- ble. Wolfgang Catenhusen, the chairman of a parliamentary com- mission of inquiry that first sug- gested an omnibus genetic engi- neering law 2 years ago and a mem- ber of the opposition Social Demo- cratic Party, says that he does not have any "fundamental opposition" to the draft law being proposed by the government. However, he says that he would like to see retained "perhaps for 2 or 3 years" those parts of the current legislation that allow public participation in the licensing procedures for all genetic engineering facilities. B8rbel Rust: Greens Party mem- ber criticizes proposed new law. Hermann Bujard: Young Ph.D.'s "are voting with their feet." are arguing that, without workable regula- tions, German chemical companies could find themselves cut out of any domestic production using genetic engineering tech- niques. In such circumstances, "any chemi- cal company will have to decide in which country it is going to do its work," says Acker. Rust warns, in contrast, that any reduction in public involvement and discus- sion "could lead to more confrontation and to a situation in which no dialogue is possi- ble." The chasm of distrust between scientists and their critics will be particularly difficult to overcome because the conditions that have created it did not arise overnight. The debate over biotechnology has been influ- enced by a growing public dismay over Chemobvl, the Bhopal accident, and last year's major chemical spill in the Rhine. This has led to public cynicism regarding official statements about the safety of such technol- ogies. "Some people feel that they cannot always trust the scientist," says Ernst-Gunter Afting, head of pharmaceutical research for Hoechst in Frankfurt, which is still trying to get permission to operate a plant for pro- I252 Rolf-Dieter Acker: "We are running out of time. " have a National Academy of Sciences in Germany that might provide a public de- fense." It is no surprise that the supporters of the amendment approved last September argue that members of the public need to be more deeply involved in decisions about new tech- nologies. "If a new laboratory or factory is going to be built, then it must be possible for people to raise questions about safety and other issues, and the people who want to build these factories must be prepared to answer these questions in public debate," says Rust. Industry representatives say they do not challenge the principle of public account- ability, but "the whole situation places Ger- man companies at a clear competitive disad- vantage compared to other nations," says Norbert Rau, a marine biologist turned biotechnology consultant. "If this is not changed, we might see a situation emerging in which both German and foreign compa- nies go 'shopping' for research results in Germany, but these are turned into products outside Germany, which are then brought back to the country for sale." As for the Greens, Rust says that their previous hard-line opposition to all forms of genetic engineering has recently been soft- ening. Officially, the party is still demanding that a moratorium be placed on all industrial uses of genetic engineering until more is known about the potential risks. But, says Rust, "personally I would not be against certain applications, for example research for a vaccine against AIDS or into the treatment of cancer." The parliamentary debate on the govern- ment's proposals, due to take place this fall, is widely expected in Bonn to be both long and heated. But what if, in the end, there is no compromise? What will German compa- nies do? Says Afting of Hoechst: "We are a German company, and, for the time being, we will stay in Germany. But we have to think of the future. Here in Europe we rely on the export of knowledge, since we cur- rently have dying technologies; we have to add new industries in the long run.... We should not have tougher guidelines than other countries. After all, neither science nor production should stop at national borders."  DAVID DICKSON 204'7651914 SCIENCE, VOL. 2q-}
Page 32: brs52e00
THIS IMPLANTABLE MICROCHIP HAS JUST TOTALLY RE1/OLUTION IZED LABORATORY ANIMAL IDENTIFICATION. The end of ear punching or tagging, toe clipping, tail tattooing ... and their problems. Conventional animal identification techniques have three familiar problems: Cost-it's expensive to mark the animals initially and to read them subsequently Accuracy-misidentification can occur as a result of the marking process Health-occasional infection can jeopardize animal health or even the research effort itself Bio Medic Data Systems has now developed a practical state-of-the-art electronic system that revolu- tionizes animal identification and that deals effectively with these three problems. An Implantable Micro-Identification Device (IMI'")- actually a microchip transponder-transmits its unique identifying number when energized by a low power radio-frequency source. This IMI (shown actual size above) is hermetically sealed in an inert glass capsule. The animal is identified as it passes near the stationary reader. Circle No. 185 on Readers' Service Card Patents pending, U.S, and International. Copyright 0 Eio Medic Corporation, 1988- Implantation of the IMI in.the animal does nof (ead to migration, physiological or biochemicaf dist rbance ~ mplanta or to infection (given, of cabrse, appropriat tion practices). ~ AMSTM) is noV wor This entire system-that i~ everything required t make it function-called the E~Iectronic,Labotatory Animal Monitoring System ( well in several major laborato more about this exciting devel coupon below requesting a d us a line, or call us at 201/587-8 BioMedic DATA SYSTEMS a IbilMedic European Distributor: UNO bv Phone:08360-24451' Telex' Marconistraat 31, 6942 PX Ze P0. Box 15, 6900 AA Zevenaar-H --------- I Bio Medic Data Systems, Inc. I 255 West Spring Valley Avenue I Maywood, NJ 07607 s. io iearn a t deai - pment, ca_ lete the iled brochure, or drop 00. Fax: 20-fi/843-8816. ~ edic Data Systems, Inc. est Spring Valley Avenue ywood, New Jersey 07607 201/587 8300 Telex: 62985471 Fax: 201/843-8816 ~ Please send me your ELAMS' brdkture describing your net animal identification system. ~~ _ -*C I'd welcome a call from a technical represdI,ative. Address ~rganization Dept. Name_ Title- Zip Code
Page 33: brs52e00
COVER Advances in genetic engineering are bringing new variations of naturally occurring species to the research laboratory and into the field for testing and marketing. This issue of Science focuses on the applications of this technology that are alreadv available and the prospects for the future. See page 1275. [Illustration by Donna Williams] 1328 Bright Light Induction of Strong (Type 0) Resetting of the Human Circadian Pacemaker: C. A. CZEISLER, R. E. KRONAUER, J. S. ALLAN, J. F. DUFFY, M. E. JEWETT, E. N. BROWN, J. M. RONDA 1333 Water-Inserted a-Helical Segments Implicate Reverse Turns as Folding Intermediates: M. SUNDARALINGAM AND Y. C. SEKHARUDU 1337 Global Positioning System Measurements for Crustal Deformation: Precision and Accuracy: W. H. PREsco7r, J. L. DAVIS, J. L. SVARC 1340 Novel Sites of Expression of Functional Angiotensin II Receptors in the Late Gestation Fetus: M. A. MILLAN, P. CARVALLO, S.-I. IzUMI, S. ZEMEL, K. J. CA1T, G. AGUILERA 1342 Recombinant Gene Expression in Vivo Within Endothelial Cells of the Arterial Wall: E. G. NABEL, G. PLAVTz, F. M. BOYCE, J. C. STANLEY, G. J. NABEL 1344 Implantation of Vascular Grafts Lined with Genetically Modified Endothelial Cells: J. M. WILSON, L. K. BIRINYI, R. N. SALOMON, P. LIBBY, A. D. CALLOw, R. C. MULLIGAN 1346 Control of Gene Expression by Artificial Introns in Saccharomyces cerevisiae: T. YOSHIMATSU AND F. NAGAWA 1348 Isolation of Single-Copy Human Genes from a Library of Yeast Artificial Chromosome Clones: B. H. BROWNSTEIN, G. A. SILVERMAN, R. D. LITTLE, D. T. BURKE, S. J. KORSMEYER, D. SCHLESSINGER, M. V. OLSON 1351 Cl- Channels in CF: Lack of Activation by Protein Kinase C and cAMP- Dependent Protein Kinase: T.-C. HwANG, L. Lu, P. L. ZEITLIN, D. C. GRUENERT, R. HUGANIR, W. B. GUGGINO 1353 Regulation of Chloride Channels by Protein Kinase C in Normal and Cystic Fibrosis Airway Epithelia: M. Li, J. D. MCCANN, M. P. ANDERSON, J. P. CLANCY, C. M. LIEDTKE, A. C. NAIRN, P. GREENGARD, M. J. WELSH 1357 The Fc and Not CD4 Receptor Mediates Antibody Enhancement of HIV Infection in Human Cells: J. HoMSY, M. MEYER, M. TATENO, S. CLARxsON, J. A. LEVY 1360 Pathological Changes Induced in Cerebrocortical Neurons by Phencyclidine and Related Drugs: J. W. OLNEY, J. LABRUYERE, M. T. PRICE Book Reviews Products & Materials 1385 In Sickness and in Wealth, reviewed by D. MECHANIC  Mechanical Man, J. REED N Books Received 1388 Solar-Powered pH Meter 0 Software for Mathematical Surfaces, Vector Fields  Densitometry Softzvare 0 Computer Interruption-Protection Hardware 0 IgG Purification Kit  Desktop RISC Workstation 0 Literature Board of Directors Mary Ellen Avery Editorial Board Board of Reviewing Roger I. M. Glass Yeshayau Pocker Francisco J. Ayala Editors Stephen P Goff Michael I Posner Walter E. Massey Floyd E. Bloom Elizabeth E. Bailey . Goldberg Robert B . Dennis A Powers Retiring President. Mary E Clutter David Baltimore John Abelson . Corey S Goodman . Russell Ross Chairman . Eugene H. Cota-Robles William F. Brinkman Gals AI•Awqati . Jack Gorski Rothman James E Richard C. Atkinson Joseph G. Gavin Jr. E. Margaret Burbidge Don L Anderson Stephen J Gould . Erkki Ruoslahti President , John H Gibbons Philip E. Converse Stephen J. Benkovic . Richard M Held Ronald H Schwartz . Beattix A. Hamburg Joseph L. Goldstein Floyd E. Bloom . Gloria Heppner . Vemon L Smith Donald N. Langenberg Mary L Good Henry R. Boume Eric F Johnson Robert T. N. Tjlan President-elect William T. Golden F. Clark Howell James J. Bull . Konrad B Krauskopf Virginia Trimble Treasurer James D. Idol. Jr. Kathryn Celame . Charles S Levings III Unanue Emil R Nicholson Richard S Leon Knopoff Charles R. Cantor . Richard Losick . Vermeij Geerat J . Executive Officer Oliver E. Nelson Ralph J. Cicerone Kari L Magleby . Bert Vogelstein Helen M. Ranney John M. Coffin Phillppa Marrack Harold Weintraub David M. Raup Robert Dorfman Joseph B. Martin Irvin L Weissman Howard A. Schneidemtan Bruce F. Eldridge John C. McGiff George M. Whitesides Larry L. Sman• Paul T. Ern,Ilund Mortimer Mishkin Owen N. Witte Robert M. Solow James D. Watson Fredric S. Fay Theodore H. Geballe Cad 0. Pabo William B. Wood I I ! 16 JUNE 1989 TABLE OF CONTENTS I229
Page 34: brs52e00
f 1-leckiers and Protesters Liven up a Dull Meeting Canadians sometimes have an inferiority complex about their bustling, often contentious, neighbors to the south. But when it comes to throwing an AIDS conference, they have nothing to worry about. Not only was the fifth International Conference on AIDS, which was held in Montreal last week, bigger and even more crowded than the 1987 meeting in Washington, it was also at least as marked by protests and dissent. "There's nothing like it," says Dani Bolognesi of Duke University School of Medicine of the annual AIDS conference. He's right. Some 10,000 participants-up from about 6,000 in 1987- crammed into Montreal's Palais de Congres for this year's event, stretching the convention center to its limits, if not beyond. They were pursued by perhaps 1,000 members of the press. There are bigger meetings. And many have more scientific news to report. Short of some encouraging progress with vaccine work, the Montreal crowd heard little that promised to revolu- tionize the attack on AIDS. But for hecklers and organized demonstrations the AIDS megameetings are hard to beat. On Sunday, the opening ceremonies were delayed nearly 2 hours when a group of Canadian and U.S. AIDS activists took over the stage to declare "Le Manifeste de Montreal." Their demands: among other things, better medical care and civil rights safeguards for AIDS patients. Although few of the conference participants are likely to quarrel with those goals, the protesters' tactics were another matter. After dominating center stage for more than an hour, the activists appropriated the seats reserved for Canadian Prime Minister Brian Mulrooney, Zambian President Kenneth Kaunda, and other dignitaries. One conference participant noted that he did not think that this was a fitting welcome, especially for the African health officials whose seats were usurped. And there was a reason beyond mere good manners to welcome the Africans. In the past, some African governments have been reluctant to concede that they have an AIDS problem. But as shown by the substantial African presence at the Montreal meeting, the continent's officials and researchers are beginning to come to grips with the high infection rates occurring in _ some areas. As to the cadre of AIDS activists at th e as inadequate. But he also floated what may be the single most controversial suggestion to come out of this year's conference- namely that AIDS be made a reportable disease, much as tuberculosis is. This would mean that testing for the AIDS virus would no longer be done anonymously. Instead, the names of those individuals who test positive would be reported to health authorities who could follow up to see that the virus-infected people received treatment. Any contacts to whom a virus- infected individual might transmit AIDS would also be traced. These ideas are anathema both to AIDS activists and to some public health officials because of worries that people will be less likely to be tested and receive treatment if they think that their names will be become known and they will consequently become victims of discrimination. But Joseph thinks that the time has come for a change in AIDS testing policies. As presentations at the conference showed, encouraging results in AIDS therapy and vaccine development are raising hopes of controlling or preventing the disease. If that comes to pass, Joseph maintains, it would warrant reporting persons infected with the AIDS virus, and tracing their contacts, because then these persons could be helped. In the past little could be done. Whether or not mandatory reporting comes to pass, everyone does hope that the new vaccine and drug research will pan out. The need is still great. According to Jonathan Mann, director of the Global Programme on AIDS of the World Health Organiza- tion, the AIDS situation will be even worse in the 1990s than it was in the 1980s. From S to 10 miIIion people worldwide have already been infected by the AIDS virus and may develop the full-blown disease over the next few years. Also disturbing are findings that as the AIDS epidemic progresses, the burden of the disease is falling increasingly on the poorer, less educated members of society, and in particular on drug users. "This is a nearly universal trend," says Peter Piot of the Institute of Tropical Medicine in Antwerp, Belgium. Drug users are more difficult to reach with education campaigns aimed at getting them to change their behavior to prevent the spread of meeting, they didn't stop at taking Cana- than 1'rune Minister Muirooney's chair. k Just as then Vice President George Bush W ~ - hi as ngton was booed at the 1987 meeting, so too was Mulrooney heckled in his homeland. But the most raucous demonstrations were reserved for New York City Health Commissioner Stephen Joseph, who not- ed wryly that he had brought his "cheer- ing section" along with him. Members of the New York activist group, the AIDS Coalition to Unleash Power (ACT UP), booed, chanted, and jeered "Doctor of Death" and "Resign! Resign!" through- out Joseph's talk, often drowning him out. Joseph is generally unpopular with AIDS activists, who view his depart- ment's efforts on behalf of AIDS patients the AIDS virus. On balance, the news about potential new AIDS therapies and vaccines made the Montreal meeting less gloomy than the one in Stockholm. The meeting sur- vivors nevertheless had an exhausting week. They were buffeted by crowds as they tried to sample the 5500 talks, post- ers, round tables, and other presentations offered up there. All too often, they found their way into popular sessions barred by the dreaded "Complet/Full" signs. And even when they did get into the lecture halls, they often could not read the slides because of an apparently unsolvable focusing problem. The annual AIDS jamborees have drawn greater numbers year by year. Will the trend hold for next year's meeting in San Francisco? Everyone is waiting with bated breath.  J.L.M. 16 JUNE 1989 RESEARCH NEWS 1255
Page 35: brs52e00
tive, infectious, or traumatic kinds of dysfunction of the mammalian C'itls. Tfiis approach is less likely to be effective for CNS disorders that reflect more global defects of neuron function, as in Tay-Sachs and other lysosomal storage diseases, some neurotransmitter disor- ders, possibly the Lesch-Nyhan syndrome, and many other disor- ders. For at least some of those defects, it will probably be important to develop neuron-specific gene transfer techniques, including possibly herpes and other "neurotropic" vectors to deliver and express new genetic information in neurons distributed diffusely in CNS. Cancer. Because it is likely that most human cancer is caused by, or is associated with, aberrant gene expression, human cancer should be considered a genetic disease (93). Recent characterization of the role of growth factors and proto-oncogenes in development and cell proliferation has begun to suggest genetic approaches to augment the current chemotherapeutic or irradiation treatments. At the moment, the simplest genetic models involve neoplasia resulting from deficiencies of cancer suppressor genes such as those apparent- ly associated with the development of the human cancers retinoblas- toma (Rb) and Wilms' tumor. These cancers presumably arise from the inactivation of both alleles of a wild-type gene, therefore the cancer phenotype might be suppressed and possibly even reversed by restoring functional expression from a wild-type gene. My colleagues and I have provided support for this approach in a study showing that infection of Rb and osteosarcoma cells with a retrovi- rus vector expressing the wild-type Rb gene led to morphological changes and to a reversion of their anchorage-independent growth properties in vitro and, in the case of the Rb cells, to the suppression of their tumorigenic properties in nude mice (94). Further studies are required to characterize the long-term effects of the restoration of suppressor gene expression on cell properties and the replication and tumorigenicity of cells homozygous or heterozygous for Rb defects and to determine whether it is possible to induce reversion of existing tumors. Similar studies with other suppressor gene defects will be important to establish this general approach to therapy. Inactivation of dominantly acting oncogenes is conceptually more difficult but is suggested by new approaches to site-specific targeted mutagenesis. Several methods are now available for the expression of toxin genes in cells (95, 96). In principle this would permit the targeted destruction of tumor cells if unerringly specific delivery can be accomplished reproducibly. In another approach, targeted intro- duction of a drug sensitivity gene specifically into tumor cells is designed to make them uniquely susceptible to pharmacological treatment, as in the introduction of the HPRT gene into thiogua- nine-resistant human leukemia cells to make them sensitive to purine analog antimetabolites (97). The potential for modulating the expression of oncogenes and other genes through the use of genetic information in the form of antisense oligonucleotides suggests another approach to the sup- pression of the cancer phenotype (98-102). Although the mecha- nisms involved in inactivation of gene expression by antisense sequences are not thoroughly understood, it is probably necessary to deliver high concentrations of antisense information to compete with either efficient gene translation or possibly with the function of transcription factors. Chemical modifications of naked oligonucleo- tides have increased their cellular uptake and stability (103), and considerable efforts are being made to develop more efficient targeted and vector-mediated methods for introduction of the sequences into cells and into whole animals. Other target organs and disease models. Therapeutically useful prod- ucts, including hormones, serum proteins, other humoral or diffus- ible proteins, and even some low molecular weight metabolic products, may be produced in a whole animal by cells other than the normal sources. If suitable gene regulation can be ensured, it should be entirely irrelevant to an organism whether a humoral factor is supplied from its usual cell of origin or from a genetically modified ectopic cell. Skin cells such as fibroblasts and keratinocytes are especially attractive because they are readily available, can be grown in vitro from affected patients, are easily transformed genetically by vectors, and can be reintroduced readily by autografting into donor animals. This in vitro gene transfer and autograft concept has served as the theoretical basis for genetic therapy of the hemophilias and other disorders of the serum proteins, insulin-deficiency forms of diabetes mellitus and other hormone defects, ai-antitrypsin defi- ciency, and other enzyme- or gene product-deficiency diseases (104, 105). When such cells are implanted into animals, the newly synthesized product secreted into the circulation may thereby correct a deficiency and a disease phenotype of a distant cell or organ. Studies in mice have shown effective production and secre- tion into the circulation of functional factor IX for several weeks, at least until the recipient animals mounted an immune response to the foreign protein (106). Implantation into immunologically unrespon- sive animals or the use of species-specific genes are likely to avert adverse immune responses. Infectious diseases. Eventual genetic approaches to the treatment of disease are obviously not limited to genetic diseases. Infectious diseases, including acquired immunodeficiency syndrome, result from the action of the infectious agent's genes, and an understand- ing of those genes and their functions will suggest suitable targets for therapy. Many investigators are studying the feasibility of cell- specific delivery of antisense sequences, toxin genes, or other genes into cells to interfere with expression of the pathogenic genetic functions. Direct Vector Delivery in Vivo In contrast to in vitro gene transfer followed by cell implantation, a theoretically more attractive but less well developed approach would involve direct introduction of a gene transfer vector into a target organ in vivo. This approach would require the preparation of concentrated or very high titer preparations of the transducing viral vector or other physical gene transfer vehicles. Retroviruses may not lend themselves easily to in vivo delivery because virus titers are generally quite low compared with the number of target cells that must be genetically modified and because they are generally not cell tropic. Other physical agents including naked plasmids or cloned genes encapsidated in targetable liposomes or in erythrocyte ghosts have been used to introduce genes, proteins, toxins, and other agents directly into whole animals. In vivo liposome-mediated gene deliv- ery has led to expression of foreign insulin I and preproinsulin genes in recipient rats (107, 108), and several studies have demonstrated that direct injection of naked calcium phosphate-precipitated plas- mid into rat liver and spleen or of protein-coated plasmid into the portal vein resulted in gene expression in the liver (109). These studies have suggested that, under some circumstances, direct organ-specific gene transfer by physical means may be effective. To improve the efficiency of vector delivery, it may be possible to take advantage of tissue or organ tropisms, for example the use of vectors derived from the neurotropic viruses such as rabies or herpesviruses, for gene transfer into CNS. Because most pathogenic animal viruses are not truly tissue tropic for infection but express their cytopathic functions preferentially in one tissue or another, it is more likely that tissue-specific vectors will be produced through the use of these rather more promiscuous vectors containing promoter, enhancer, and other sequences to confer tissue specificity to gene expression. 16 JUNE 1989 ARTICLES I2', 9 2047651943
Page 36: brs52e00
x.,.,o,.,,<;,,g HUMAN GENOME I October 2 - 4, 1989 Town & Country Hotel • San Diego, CA Human Genome I, the conference on the largest biological project ever contemplated, is set for October 2-4, 1989 in San Diego, CA. It is an international conference on the status and future of research on the human genome. Co-chaired By Charles R. Cantor, Ph.D. Daniel E. Koshland Jr., Ph.D. Director, Human Genome Center Editor of SCIE\"CE Lawrence Berkeley Laboratory PARTIAL LIST OF SPEAKERS FOR HUMAN GENOME I Sydney Brenner Director, MRC Molecular Genetics Unit Cambridge, England Eric Lander Fellow of the Whitehead Institute for B bmedkal Research Cambridge, Massachusetts Robert Moyas Gene6cs Group Leader Los Alamos NaGonal Laboratory Chahes Cantor Professorof Molecular Biology University of California, Berkeley Director, Human Genome Center Lawrence Berkeley Laboratory James Watson Director Cold Sphng Harbor Laboratory Associate Director, NIH Human Genome ProJect Victor McKusick University Professor of Med ca/ Genetics Johns Hopkins Unrversity School of Medicine President, Internaitonal Human Genome Organization (HUGO) Francis Collins Associate Investigator, Howard Hughes Medical Institute Chief, Division of Medica/ Genetics University of Michigan Medical Center Tasuku Honjo Professor of Medical Chemistry K}roto University Faculty of Medicine Jean Dausset Professor, College de France President, Human Rolymorphism Study Center (CEPH) Hans Zachau Professor, institute for Physiological Chemistry University of Munich Ronald Davis Professor of Biochemistry Stanford University School of Medicine Peter Pearson Chairman, Department of Human Genetics Sylvius Laboratories, Leiden Allan Wilson Professor of Biochemistry University of California. Berkeley Thomas Caskey Professor and Director, Institute for Molecular Genetics Investigator, Howard Hughes Medical Institute Baylor College of Medicine Russell Doolittle Professor of Chemistry and Biology Center for Molecular Genetics University of California, San Diego Cassandra Smith Associate Professor of Molecular Biology Unriersity of California, Berkeley Peter Dervan Professor of Biochemistry California Institute of Technology David Cox Associate Professor of Psychiatry University of California, San Francisco George Church Assistant Professor of Genetics Harvard Medical School Raymond White Investigator, Howard Hughes Medical Institute University of Utah Norman Amheim Professor of Molecular Biology Ahmanson Center for Biological Research University of Southern California Renato Dulbecco Distinguished Research Professor and Acting President Salk Institute Michio Oishi Professor of Applied Microbiolgy University of Tokyo PARTIAL LIST OF SESSION TOPICS • Organization of the Human Genome Project • Progress in Interesting Regions of the Human • State of our Current Knowledge Genome • Advances in Technology: New Methods for • The Diversity of the Human Genome in Different Mapping and Sequencing . Populations ~ O Sponsored By ~ SCIENCE MAGAZINE ~ A Publication of the American Association for the Advancement of Science ~ ~ and The Human Genome Organization (HUGO) ~= c The conference will be accompanied by an exhibition open to commercial firms offering or planning to offer appro- priate equipment. The magnitude of the project and its requirements forthe latest in scientific laboratory equipment, supplies and services will make the exhibit a significant contribution both to scientists and the companies that serve the scientific community. Organized By SCHERAGO tLSSOCIATES, INC. 1515 Broadway, New York, NY 10036 Tel: (212) 730-1050 • Fax: (212) 382-3725 For Exhibit Prospectus circle reader service number 261 For Registration Information circle reader service number 262
Page 37: brs52e00
LEP: A?7-kilorneter underground ring that looks to the future. among both scientific and technical staff, some experimental apparatus-even that with life left in it-has been closed down, staff numbers have been cut, and administra- tive services have been pared to the bone. The construction of the accelerator, too, which is buried underground at depths ranging from 50 to 170 meters, and extends from the plain next to Lake Geneva right up to the edge of the Jura mountains, has had its headaches. To meet opposition from local residents, all the electric cabling had to be buried in trenches. And digging was halted for several months in late 1986 after construction crews unexpectedly came across an underground river. Then there are the bizarre problems of LEP's location. Although the main CERIN buildings are situated in Switzerland, three quarters of the LEP tunnel-as well as all four experimental areas-are in French ter- ritory. Passing from one to the other re- quires continual customs checks: "It's not easy to get used to having to show your passport the whole time," says University of Wisconsin physicist Bruce Leclair, one of the U.S. scientists participating in LEP ex- periments. But the problems and difficulties are be- ing forgotten as 15 July approaches: the first bunch of electrons, accelerated by CERN's impressive hardware, will bolt entirely round the LEP's ring. Originally, the plan had been to allow a couple of months for fine-tuning the ring's 5000 magnets and checking out the complex vacuum system through which the electrons and the posi- trons will pass. But Carlo Rubbia, the char- ismatic boss of CERN, is not a patient man, and he insisted that this be reduced to 21 days-a time scale that will allow a first run with colliding beams early in August. It also implies, perhaps over-optimistically, that all the equipment will work as it should the first time the switch is thrown. If it does, life at CERN will move rapidly into overdrive. All four experiments will be able to have a first crack at sizing up the Z particle when collisions start in August. The current plan is for an initial pilot run of up to a week with an energy of 45 GeV in each of the two beams, gradually focusing down until the precise energy mass of the Z can be ascertained. Even at an initial lumi- nosity that will be an order of magnitude less than the final design figure, each experi- ment will be able to intercept a few thou- sand Zs a day. This is already much higher than the rate expected at SLAC. "They have not nipped us in the initial steps, as we had feared they might," says Peter Renton of Oxford Uni- versity. "If they had had 10,000 Z particles by this stage, it would have taken us about a year to get into a competitive position as far as producing new physics. But that does not appear to be the case." But with the Califomia physicists keeping up the pressure, no one is being allowed to slip. "It's going to be frantic," says Leclair of Wisconsin. "And there is already tremen- dous pressure to have things frozen by the time we start taking data and are ready to go" Each of the four detectors has been set up as a multinational research project in its own right. Each has been designed to emphasize particular aspects of particle detection (see box). And each has developed a slightly different management style. L3, which involves over 400 scientists from 37 different institutions in 13 coun- 16 JUNE 1989 tries, sets itself apart from the other experiments, not only be- cause it has the largest and most expensive equipment (one-third of which is paid for by U.S. sources, primarily the Depart- ment of Energy) but also by the autocratic single-mindedness with which it is run by MIT's Samuel Ting. Other teams have adopted a different, less autocratic ap- proach. "There are two ways of doing it," says Alasdair Smith of OPAL, the smallest team with about 250 scientists. "You can have the L3 type of operation; or you can do something which is more democratic. We have been lucky in that we have not had any really strong personal- ities and relatively few prickly characters; the more democratic type of organization can be disastrous if people do not get on." Indeed, there has at times been friction between the teams, for example, over access to CERN's limited resources or over the acknowledgment of technical ideas ex- changed between team members. "Relations between us and OPAL have been reasonably good," says Imperial College's Peter poman of the ALEPH team. But he admits that "there have been a few slightly acrimonious moments with DELPHI." And as for L3, "Ting has his own way of running things." Given that, in the initial stages at least, each of the four teams will be trying to be the first to come up with the characteristics of the Z particle, everyone expects the atmo- sphere to remain tense for the first few months. "There's no doubt that it will be a race; there are no two ways about it," says Dorrlan, a member of the team which has been designing experiments for one of the four detectors, ALEPH. "This means you ` have to be fast, but you also have to be right. You do not want to get a reputation for publishing preliminary junk; but neither do you want to be a couple of months behind everyone else." For some, the result is a less-than-wel- come change from the early days at CERN, when the considerable differences benveen experiments being carried out on different accelerators meant that there was wide dis- cussion of even very preliminary results. "With electron machines, most people's ex- perience is that some groups get very para- noid," says Smith of the OPAI, detector. Not everyone, however, sees such compe- tition as necessarily a bad thing. Indeed, scientists involved in the L3 experiments have been organized by Ting in a way that 2047651921 RESE?.RCH NEWS 1259 ~-~~.-.--
Page 38: brs52e00
detectable levels of hGH or bGH in plasma at birth (as measured by immunoassay), which is similar to the frequency of expression in transgenic mice (4, 6). The concentrations of foreign GH in these two groups of pigs ranged from 3 to 949 ng/ml for hGH pigs and 5 to 944 ng/m1 for MTbGH pigs. Mean concentrations of GH in expressing founder animals from 30 to 180 days of age ranged from 14 to 4000 ng/ml for hGH and 23 to 1600 ng/ml for bGH (20). The variability among founder animals is presumably due to the influence of chromosomal position on tissue specificity and to the activity of the MT promoter (21). Another factor may be mosaicism, which occurs in approxi- mately 30% of transgenic mice (22). Individual pigs tended to maintain characteristic levels of expression (20, 23). The presence of either hGH or bGH in the plasma of pigs was accompanied by as much as a three- to fourfold increase in IGF-I concentrations (Table 3), as well as a decrease in the levels of pig GH (pGH) (20). A similar elevation in IGF-I concentrations has been reported for a pig that expressed rGH (19). The increase in endogenous IGF-I proba- bly reflects the activity of transgenic GH on GH hepatocyte Table 1. Production of transgenic farm animals. Listed are genes that have been introduced into six species of animals. The slash separates the promoter or enhancer of one gene from the structural gene. The species is indicated by a lower case letter before the abbreviation of the gene: b, bovine; c, chicken; h, human; m, mouse; o, ovine; p, porcine; r, rat; rb, rabbit. Gene abbreviations: ALV, avian leukosis virus; alAT, al anti-trypsin; BPV, bovine papilloma virus; Eµ, immunoglobulin heavy chain; FIX, factor IX; GH, growth hormone; (3Ga1, galactosidase; hygro, hygromycin; (3LG, 13- lactoglobulin; MT, metallothionein; MLV, Moloney murine leukemia virus; REV, reticuloendotheliosis; PRL, prolactin; SV, SV40; TK, thvmidine kinase. Integration means the gene became part of the DNA complement; expression indicates that the gene was integrated, and either transgene mRNA or protein (or both) was detectable. Gene Results Reference ALV Chicken Integration (48) REV Integration (49) ALV Expression (50) BPV Cow Integration (51) mMT/hGH Fish Expression (52) ca-Crystallin Expression (53) hGH Integration (54) mMT/hGH Integration (55) mMT/hGH Integration (56) mMT/(3Ga1 Expression (57) SV/hygro Integration (58) mMT/hGH Pig Expression (11) mMT/hGH Integration (12) mMT/bGH Expression (14) hMT/pGH Expression (18) MLV/rGH Expression (19) bPRLbGH Expression (59) mMT/hGH Rabbit Expression (11) mMT/hGH Integration (12) hMT/hGH Expression (4) rbEµlrbc-myc Expression (60) mMT/hGH Sheep Integration (11) mMT/TK Integration (61) o (3LG/hFIX Integration (61) o(3LG/halAT Integration (61) mMT/bGH Expression (62) mMT/hGRF Expression (62) oMT/oGH Expression (63) o(3LG/hFLY Expression (47) 16 IUNE 1989 Fig. 1. Cross section through the loin at the 8th rib of a G2 MTbGH boar (right) from line 31-04 and a control (left) half-sibling male. Both animals weighed approximately 90 kg at the time when they were killed. receptors (24), whereas the decrease in endogenous GH is due to feedback inhibition by transgenic GH and endogenous IGF-I on the hypothalamus and pituitary (25). Of the seven founder pigs with the MThGRF minigene, two had high concentrations of GRF in plasma as detected by immunoassay (Table 3). The plasma levels of GRF were at least ten times the plasma GRF concentrations found in the littermate controls. De- spite elevated plasma levels of GRF, the levels of plasma pGH were normal. In transgenic mice expressing this same construct, 100% of the mice with immunodetectable hGRF had elevated levels of mouse GH (mGH) (9). Most of the hGRF in the plasma is present in a biologically inactive form; the biologically active form is found principally in the pituitary, hypothalamus, and pancreas (26). The absence of an effect of hGRF in transgenic pigs may be attributable to lack of synthesis in cells capable of proper proteolvtic processing of the GRF precursor peptide. This issue can be addressed in progeny of line 86-04. Four transgenic pigs were produced containing an MThIGF-I gene, but only one of these animals (111-06) had elevated levels of Table 2. Production of transgenic pigs. Mature gilts were superovulated and bred as described (10). At 58 to 77 hours after human chorionic gonadotro- pin injection, ova were surgically collected from anesthetized donor females by flushing with modified Brinster medium for ovum culture (BMOC) (64) from the uterotubal junction through the cannulated infundibular end of each oviduct. Ova were maintained in modified BMOC. Centrifuged eggs were microinjected as described (11). The injected genes are described in the legend to Table 3. After microinjection, eggs were transferred to the oviducts of recipient gilts (11). Some pregnant recipients received control eggs in MThGRF and MThIGF-I experiments to aid in the maintenance of pregnan- cy. We estimated that 55% of control eggs develop to live piglets (11); to compensate for the control egg contributions, the number of pigs born has been reduced by 72 for the MThGRF experiment and 8 for the MThIGF-I experiment. Transgenic animals were identified by DNA dot hybridization to nucleic acids isolated from tail or ear biopsies (11). Expression indicates the presence of immunoassayable foreign protein in plasma. Group MThGH* MTbGH* MThGRF MThIGF-I Recipients 64 49 66 13 Injected ova transferred 2035 2330 2236 387 Pregnant recipients 37 24 35 5 Ova in pregnant recipients 1174 1255 1105 152 Pigs born 192 150 177 34 Transgenic pigs 20 (0.98)t 9 (0.39) 7 (0.31) 4(1.0) Expression 11 8 2 1 *Previously published (11, 20). tPercentage of injected eggs. 2 0 4 76 5 1 9 47 ARTICLES 1283
Page 39: brs52e00
1,000 watts of reliable pulsedRFpowerforyoar advanced NMR system As your horizons in NMR spec- troscopy expand, so do your needs for clean rf power and the noise-suppression capa- bility of a gating/blanking circuit. Our new Model 1000LP embodies the qualities you should expect of your rf power amplifier: Conservatively-rated pulse output of 1,000 watts with Class A linearity over a 100 dB dynamic range. An ample 8-msec pulse width at 10% duty cycle. Newly expanded band- width of 2-200 MHz, instantly available without need for tuning or bandswitching. Total immunity to load mismatch at any frequency or power level, ~- even from shorted or open out- put " put terminals. A continuously variable gain control to permit ` adjustment of output level as iL.'__~_desired. And an unexpected bonus: A continuous-wave mode, delivering over 200 watts for your long-pulse applications. If you're upgrading your sys- tem or just moving into kilo- watt-level spectroscopy, a few minutes with this remarkable instrument will show you the ease of shutting it down to reduce noise 30 dB in less than 4 µsec. The friendly grouping of lighted pushbuttons for power, standby, operate, and pulse. Finally, the peace of mind from knowing that the Model 1000LP will not let you down when you're most dependent on it. Call us to discuss your pre- sent setup and your plans for improvement. Or write for our NMR Application Note and the informative booklet "Your guide to broadband power amplifiers:" amPLiFieR 41or AeseaAai ~= 160 School House Road, Souderton, PA 18964-9990 USA __`__ -TET, 215 723-8181 • TWX 510-661-6094 • FAX 215-723-5688 Your Source for STABLE ISOTOPES Isotec Inc. offers the scientific community one of the world's largest selections of stable isotopes and labelled compounds 18 15 • NMR Solvents • Reagents • Organics • Inorganics • Biologicals D You Get More From ~~~~~~ ~~i~ > ~ • > 99% chemical purity • High isotopic enrichment • Competitive prices • Fast delivery Plus... metal stable isotopes, helium-3 and other noble gas isotopes, other enriched stable isotopes, multiply-labelled compounds and custom synthesis Call or write for your NEW complete price list today! iAW~""s i~isi" i iAiAW Ar-~ AIV A Matheson, USA Company 3858 Bemier Road, H'iamfs6urg, OH 45342 (513) 859-1808 (800) 448•9760 lelex: 288278 Fac (513) 8594878 Circle No. 171 on Readers' Service Card Circle No. 189 on Readers' Service Card
Page 40: brs52e00
® ® 0 Applied Biosystems electrified DNA research. Il ® 0 0 u ~.^..aP.°+" ~=:ri ~ d~ I ~ I i J 7~,,Im ® ® ll~ 0 I t IG P.: ® l We've electrified DNA research in more ways than one. As pioneers in developing innovative automated products for molecular biologists, we have the hands-on experience and uedtnical expertise needed to deliver the high-powered instruments that have vitalized DNA research. You can choose leading-edge instruments for automatic extraction, sequencing, syn- thesis, and purification of DNA. Unique DNA Extractor Ourone-ol-a-kind, automated extractor has putan end to tedious, time-consuming manual procedures and virtually eliminated exposure to toxic chemicals. Now researchers can count on consisten4 high-quality results. And, best of all, exciting new applications for the instrument are constantly being introduced. New Standards in DNA Sequencing We introduced the wodd'v first automated fluorescent-based DNA sequencet With our sequencer, researchers can now conceive of large sequencing projectl previously impos- sible. Now you can interpret up to 8,000 bases per gel. Our new Taq poly- merase reagent kit simplifies preparing extensions and delivers longer runs with improved accuracy over conven- tional sequencing chemistries. US..L tl511 Lin~dn Cenrtr Dmr. fiwer lSIY, CA Y9aW TcI. (n5)570-6ti67,(8q)IK!{_1Wbg, m LxG4,molM/Inl K9I 7582TeI,x:470115Y APBIOIR. Fu: (415) 572-Y713. NLduau,ry, Gnnd.l'd:141fi)N21-81tl7, Faw(416)tl21 8216. w.mngroo, U.R.TA:IhJE58E5660.Tdrs:6Y9611 APBIO (:. Fax:I)1E58Y81Yfi Wriiermdl,WerCerm.oy.TeI:UIn51H79tD.Te1n:41Y7918ZABIn.Fu:Ip151W1899. Pui~, Fnoc~Tcl: (11486N 24 44.'kk.:AHIFTA958F. Fax:11148 83 42 82 Sfllm, Iht~TcL OSM951379.Tekx: D57878AP8t0 LPasOY aYY 1655. Rotterdvv,The Nelhvand..7e1:111110 4 5 4 b511. ]elr.:'L51h9. P:-Iel If145Y!7157 Burvnad•Authalla.7Fl:U3R887777 Fac:IISBB714tl9. Tukp,Jlp.n.Tel:ll3 6'79 0700. F'ae 0.1 &Mllpry9. Iql'm,nR Plwvo 0 1 Anld Smd/lk ImRe 5un1 Most Popular DNA Synthesizers Our reliable DNA synthesizers have earned a reputation for deliver- ing quality synthetic DNA. Simple pushbuttnn procedures, streamlined operation, and dependable perfnr mance all combine to improve your research. Our reagent and amidite purity ensures biological activity of your sequence. Proven Purification Systems With our HPEC' System, we've automated established electrophor- esis technology to purify DNAThe system cuts sample handling steps and improves sample recovery over manual procedurn. When you need rapid, convenient purification, use our OPC" cartridge. Applied Biosvstems offers more high-powered instntments for molec- ular biologists than any other company in the field. For more information, pll the office nearest you. We'd like to electrify your DNA research. r7.iFmcu Bk3sysfum For information circle reader service number 220 For sales call circle reader service number 221
Page 41: brs52e00
from New York to Los Angeles, for in- stance. "Ten years ago I had a lot of'prob- lems with jet lag," he says, but with his bright light treatments, he adjusts easily to new time zones. Czeisler notes his data also imply that the result of 3 days of exposure to light was not simply three times the result of 1 da}~s exposure. The first pulse of light, Czeisler says, made the circadian cycles irregular and suppressed their magnitude-that is, the changes in the body temperature through- out the day were smaller than normal. "Two cycles of exposure crushed the amplitude," he says, and the third exposure reset the pacemakers to new phases. For theoreticians such as Winfree, the Czeisler data have important implications for the correct mathematical description of how the human circadian clock responds to light. Weak resetting is analogous to mov- ing the hands on a clock ahead or behind by a hour or nvo. But in the strong response elicited by Czeisler, the clock is shifted by 10 or 12 hours without moving the hands through the intermediate positions-there is, in some sense, a discontinuous jump. Mathematically, these are two fundamental- lv different types of responses, called Type 1 and Type 0. (The 1 and 0 refer to a concept from algebraic topology-the winding number of the response curve.) The fact that humans exhibit Type 0 resetting has an intriguing consequence, proved by Winfree: The right amount of light applied at the right time can bring the inner clock to a stop, so that there is no longer a strong circadian rhythm. Czeisler's claim that he crushed the amplitude of the circadian rhythm in some subjects seems to verify Winfree's theoretical prediction. Kronauer brings all this down to earth with a simple example based on the predic- tions of his model, which he says agree with the data from Czeisler's trials. Suppose you fly to Sydney, Australia, 14 hours ahead of Eastern Standard Time. If you immediately go to work, so that you are exposed only to interior lighting, your clock wrill be reset only by about 1 hour each day. It will take 10 days to fully adapt. But if you spend the first day outside, 6 to 8 hours of bright sunshine (about 100,000 lux) should do the work of the first two exposures in CzeisIer's experiment: It will crush the amplitude of your internal circadi- an pacemaker and prepare it to be reset to the proper time with light exposure on the following day. Another day outside should lock your clock into Australian time. So if you're flying to Australia, be sure to get there a couple of days early-go to the beach, catch some rays. Tell your boss it's doctor's orders.  ROBERT POOL New Machine Sparks Rivalries at CERN An intense 10-year effort by physicists and engineers at CERN is soon to bear fruit, when LEP, the world's largest particle accelerator, comes on-line next month Geneva LiKE SPRINTERS PREPARING for the big race, international teams of physicists at the European Laboratory for Particle Physics (CERIN), Geneva, are operating in an atmo- sphere of rising tension and excitement as they make their final preparations for the "big event." If all goes according to plan, the first week in August will see the maiden run of colliding beams of electrons and posi- trons in what will, for several years to come, be the world's largest particle accelerator, the 200-GeV Large Electron-Proton Col- lider (LEP). The sense of anticipation in Geneva is intense. Four separate detectors, each a com- plete piece of experimental apparatus manned by its own team of several hundred physicists from around the world, are locat- ed at four different points around the LEP ring. And each has a chance to come up with the first anticipated result of major impor- tance to physicists: a description of the chargeless Z particle that is sufficiently de- tailed to answer key questions about the fundamental building blocks of matter. Later on, when the accelerator has been brought up to its full operating energy, the same groups will have an even bigger prize in their sights, namely proof of the existence of the two particles next on the "to be discovered" list. These are the top quark and the elusive Higgs boson, widely postu- lated as the source of the mass of the W and Z particles (both of which were first seen at CERN in the early 1980s). With such attractive quarries looming, it is perhaps not suprising that scientists at CERN are working overtime to improve the chances of their team being the one that grabs the headlines. The one big surprise is that the CERN physicists are moving to- ward their prized goal virtually without competition from a key research facility in the United States, once seen as a big threat. Late last year CERN physicists had watched anxiously as the Europe- an laboratorYs main ri- val, the newly commis- sioned Stanford Linear Collider, seemed all set to crank out Z particles, precisely what LEP is designed to do. It looked as if CERN would not only be the loser in the race, but also would have lost to a more modest machine. The brainchild of Burton Richter, direc- tor of the Stanford Lin- ear Accelerator Center (SLAC), the linear col- lider was seen in Eu- rope as something of a spoiler-a deliberate at- tempt, fueled by appeals to U.S. chauvinism and f d i h ts o mer e vaunte t ; y "Yankee ingenuity," to Carlo Rubbia: His drive has brought LEP on-line at a rapid clip. cream off the most excit- He'll be looking for dramatic results, ing discoveries in a cut- I6 JUNE 1989 RESEARCH NEWS 1257
Page 42: brs52e00
Genetically Engineering Plants for Crop Improvement CHARLES S. GASSER AND ROBERT T. FRALEY Dramatic progress has been made in the development of gene transfer systems for higher plants. The ability to introduce foreign genes into plant cells and tissues and to regenerate viable, fertile plants has allowed for explosive expansion of our understanding of plant biology and has provided an unparalleled opportunity to modify and improve crop plants. Genetic engineering of plants offers significant potential for seed, agrichemical, food process- ing, specialty chemical, and pharmaceutical industries to develop new products and manufacturing processes. The extent to which genetically engineered plants will have an impact on key industries will be determined both by continued technical progress and by issues such as regula- tory approval, proprietary protection, and public percep- tion. T HE STABLE INfRODUCTION OF FOREIGN GENES INTO plants represents one of the most significant developments in a continuum of advances in agricultural technology that includes modern plant breeding, hybrid seed production, farm mechanization, and the use of agrichemicals to provide nutrients and control pests. The first-generation applications of genetic engineering to crop agriculture are targeted at issues that are currently being addressed by traditional breeding and agrichemical discovery efforts: (i) improved production efficiency, (ii) increased market focus, and (iii) enhanced etnironmental conservation. Ge- netic engineering methods complement plant breeding efforts by increasing the diversity of genes and germplasm available for incorporation into crops and by shortening the time required fbr the production of new varieties and hybrids. Genetic engineering of plants also offers exciting opportunities for the agrichemical, food processing, specialty chemical, and pharmaceutical industries to develop new products and manufacturing processes. The first transgenic plants expressing engineered foreign genes were tobacco plants produced by the use of Agrobacterium tumefaciens vectors (1). Transformation was confirmed by the presence of foreign DNA sequences in both primary transformants and their progeny and by an antibiotic resistance phenotype conferred by a chimeric neomycin phosphotransferase gene. These early transfor- mation experiments often utilized plant protoplasts as the recipient cells; the subsequent development of transformation methods based on regenerable explants (2) such as leaves, stems, and roots contrib- The authors are at Monsanto Company, 700 Chesterfield Village Parkway, St. Louis, MO 63198. uted significantly to the facile and routine transformation methods that are used today for many dicotyledonous plant species. A variety of free DNA delivery methods, including microinjection, electropo- ration, and particle gun technology are being developed for the transformation of monocotyledonous plants such as com, wheat, and rice. In view of the rapid progress that is being made, it is likely that all major dicotyledonous and monocotyledonous crop species will be amenable to improvement by genetic engineering within the next few years. In this article, we describe transformation methods that have been developed for plants and discuss some of the applications of genetically engineered plants in agriculture. We also address some of the critical issues that will influence the commercialization of genetically engineered crops. Methods for Introducing Genes into Plants Agrobacterium tumefaciens-mediated gene transfer. Derivatives of the plant pathogen Agrobacterium tumefaciens have proved to be efficient, highly versatile vehicles for the introduction of genes into plants and plant cells. Most transgenic plants produced to date were created through the use of the Agrobacterium system. Agrobacterium tumefaciens is the etiological agent of crown gall disease and produces tumorous crown galls on infected species. The utility of this bacterium as a gene transfer system was first recognized when it was demonstrated that the crown galls were actually produced as a result of the transfer and integration of genes from the bacterium into the genome of the plant cells (3). Virulent strains of Agrobacterium contain large Ti (for tumor inducing) plasmids, which are responsi- ble for the DNA transfer and subsequent disease symptoms. Genetic and molecular analyses showed that Ti plasmids contain two sets of sequences necessary for gene transfer to plants; one or more T-DNA (transferred DNA) regions that are transferred to the plant, and the Vir (virulence) genes which are not, themselves, transferred during infection. The T-DNA regions are flanked by border sequences that were shown to be responsible for the definition of the region that is to be transferred to the infected plant cell. The T-DNA contains 8 to 13 genes (4), including a set for production of phytohormones, which are responsible for formation of the characteristic tumors when transferred to infected plants. Several excellent reviews on the biology of this and other pathogenic species of Agrobacterium have been published for those who desire more detailed information (4). Early experiments demonstrated that heterologous DNA inserted into the T-DNA could be transferred to plants along with the existing T-DNA genes (5). Efficient plant transformation systems were constructed by removing the phytohormone biosynthetic 16 JUNE I989 ARTICLES 1293 204'765i957
Page 43: brs52e00
SCiENCE American Association for the Advancement of Science Science serves its readers as a forum for the presentation and discussion of important issues related to the advance- ment of science, including the presentation of minority or con- fiicting points of view, rather than by publishing only material on which a consensus has been reached. Accordingly, all ar- ticles published in Science-including editorials, news and comment, and book reviews-are signed and reflect the indi- vidual views of the authors and not official points of view adopted by the AAAS or the institutions with which the au- thors are affiliated. Publisher: Richard S. Nicholson Editor: Daniel E. Koshland, Jr. News Editor: Ellis Rubinstein Managing Editor: Patricia A. Morgan Deputy Editors: Philip H. Abelson (Engineenng and Applied Sciences); John I, Brauman (Physical Sciences) EDITORIAL STAFF Assistant Managing Editor: Nancy J. Hartnagel Senior Editor: Eleanore Butz Associate Editors: Keith W. Brocklehurst, Martha Coleman, R. Brooks Hanson, Barbara Jasny, Katrina L Kelner, Edith Meyers, Linda J. Miller, Philllp 0. Szuromi, David F. Voss Letters Editor: Chnstine Gilbert Book Reviews: Katherine Livingston, editor; Susan Milius This Week in Science: Ruth Levy Guyer Contributing Editor: Lawrence L Grossman Chief Production Editor: Ellen E. Murphy Editing Department: Lois Schmitt, head; Mary McDaniel, Patricia L. Moe, Barbara P. Ordway Copy Desk: Jw S. Granger, Jane Hurd, MaryBeth Shartle, Beverly Shields Production Alanager: Karen Schools Colson Assistant Production Manager: James Landry Art Director: Yolanda M. Rook Graphics and Production: Holly Bishop, Catherine S. Siskos Covers Editor: Grayce Finger Manuscript Systems Analyst: William Carter NEWS STAFF Correspondent-at-Large: Barbara J. Culliton Deputy News Editors: Roger Lewin, Coiin Norman News and Comment/Research News: Gregory Byme, Mark H. Crawford, Constance Hotden, Richard A. Kerr, Eliot Mar- shall, Jean L. Marx, Robert Pool, Leslie Roberts, Marjorie Sun, M. Mitchell Waldrop European Correspondent: David Dickson Contributing Writer: John Walsh BUSINESS STAFF Circulation Director: John G. Colson Fulfillment Manager: Ann Ragland Business Staff Manager: Deborah Rivera-Wienhold Classified Advertising Supervisor: Karen Morgenstern Guide to Biotechnology Products and Instruments: Shauna S. Roberts ADVERTtSING REPRESENTATIVES Director: Eart J. Scherago Traffic Manager: Donna Rivera Traffic Manager (Recruitment): Gwen Canter Advertising Sales Manager: Richard L Charles Marketing Manager: Herbert L. Burklund Employment Sales Manager: Edward C. Keller Sales: New York. NY 10036; J. Kevin Hanebry, 1515 Broad- way (212-730-1050); Scotch Plains, NJ 07076: C. Richard Callis, 12 Unami Lane (201-889--4873); Chicago, IL 60914: Jack Ryan, 525 W. Higgins Rd. (312-885-8675); San Jose, CA 95112: Bob Brindley, 310 S. 16th St. (408-998-4690); Dorset, VT 05251: Fred W. Dieffenbach, Kent Hill Rd. (802-867-5581); Damascus, MD 20872: Rick Sommer, 11318 Kings Valley Dr. (301-972-9270); U.K., Europe: Nick Jones, +44(0647)52918; Telex 42513; FAX (0647) 52053. Information for contributors appears on page XI of the 31 March 1989 issue. Editorial correspondence, including requests for permission to repnnt and reprint orders, should be sent to 1333 H StreeL NW, Washington, DC 20005. Tele- phone: 202-326-6500. Advertising correspondence should be sent to Tenth Floor, 1515 Broadway, New York, NY 10036. Telephone 212-730-1060 or WU Telex 9b8082 SCHERAGO, or FAX 212-382-3725. 16 JUNE 1989 VOLUME 'r;. NUMBER 4.910 The Engineering of Species S omewhere in the vast pantheon of science a molecular biologist is saying, 'Td like to engineer a wolf into a dog." Somewhere else, the sepulchral voice of a geneticist will reply, "It's been done." For in fact, over evolutionary time, the friendliest of wolves (and possibly the most intelligent) learned that wagging their tails and delivering slippers was an easier way to earn a living than hunting caribou in the wilds. In modem times, scientists have accelerated evolution for the benefit of humans bv deliberate selection techniques to improve livestock, crops, and other life forms. The difference benveen these techniques and the use of recombinant DNA is that direct gene alteration removes some chanciness and accelerates the pace at which new variants can be produced. This issue of Science, assembled with the insight and editing skills of Barbara Jasny, shows how various species are being genetically engineered. The most controversial genetic engineering involves humans and Friedmann covers the latest exciting advances in the development of gene therapies. Gene transfer techniques that produce somatic mutations, such as by the introduction of viral vectors into bone marrow, have great potential for curing patients without affecting succeeding generations. Homolo- gous recombination, as described in the article by Capecchi, allows the surgical removal of a single deficient gene and its replacement by a normal gene, the crucial step needed for efficient alteration of a germ line. It can reverse history in ending the progress of a deficient gene into new generations. Even the best intentioned genetic engineering can have bad effects as illustrated in the article by Pursel et al., in which the genetic engineering of livestock has been carried on for several generations. Two successive generations of pigs engineered to produce elevated levels of bovine growth hormone showed significant improvements in weight gain and feed efficiency and marked reduction in fat. However, these beneficial effects were offset by a high incidence of gastric ulcers, arthritis, cardiomegaly, dermatitis, and renal disease. Plant research, as discussed by Gasser and Fraley, is one of the triumphs of modern genetic engineering; plants are being produced that are resistant to infectious agents or weed-control agents and can produce more and better food. As pesticides come under continual attack, the development of plants that naturally resist predators will become increasingly useful. An ironic feature is that some plant defenses involve synthesis of natural carcinogens. It is thus conceivable to get a plant that can be grown without pesticides but is deadly poisonous. One alternative to pesticides is the use of biocontrol, a subject that is illustrated in the article by Lindow, Panopoulos, and McFarland. The famous "Ice-" bacterium is a classic case in which genetic engineering of a bacterial species results in an organism that protects plants against damage from freezing. The importance of microorganisms is further illustrated by the genetic engineering of Rhizobium to improve nitrogen fixation, a development that could increase plant yields and diminish the need for agricultural chemicals. Additionally, engineered bacteria are being used to improve the cleanup of hazardous waste sites. Techniques described by O'Connor, Peifer, and Bender can accelerate the ease and efficiency of genetic engineering, not only on bacteria, but possibly on other organisms as well. Finally, Timberlake and Marshall discuss genetic engineering of fungi, which have great relevance, not only because they are serious pathogens in many diseases, but also because they have potential applications for the industrial production of antibiotics and other important chemicals. This issue reminds us that we must proceed cautiously in introducing new genes or new ~ combinations of genes into species, and long-term experiments are needed to study ~ detrimental effects. We are nowhere near the knowledge needed to genetically engineer the ~ complex behavior of a wolf or a dog. An original wolf might say to the dog, "You have lost ~ your freedom. Your obsequiousness is humiliating to the family Canidae." The dog could G~ reply, "I am much less warlike, far more altruistic, and besides, it's a wonderful standard of ~ living." Whether society prefers to have wolves or dogs remains to be seen. -DADIIEL E. KOSHLADID, JR. ~ ~ ~ 16 JUNE 1989 EDITORIAL 1233
Page 44: brs52e00
R180ZVMES o~ ~ IN A R . SJ%Gl~.S1RAm aC M~N~E~ si o( usng a ribazyme as a molecular scissors is simple. USB irrtraduces RNAxyme7" However, its poten6al value Tet 1.0 (Rlboryme Tet 1.0) Ges in the development of cucu specific: the ftrat unaginative applications commerdaliy4veileble ~ivhich, until novti have been Ribozyme for sequence- ddficuh or impossihle to achiere specific cleavage of RNA. pne primary appiication The discovery of ribo- wi11, of caurse; be in the phys- zymes - novel enzymes ical mapping of related RNA canposedentirelyof RNA species In addifion, consider that cleave RNA in a; RNA sequancirrg, secondary sequence-specific manner - etructure analysis and in vitro represents a tremendous RNA metabolic studies opportunity to expand the We are ezcited to take the scope of RNA studies. leading role in the develop•~ Now USB srientisls have rnent of this rewlg4scovered ; produced the first commer- field, and dedicated to fulfilling ciattavadable ribceyme from the proamse ribozymes rep- a a naturally-occurring, self• , resent as extremely useful splicing group I itdran of tools in basic molecular t>io- Temfiymerra RNA (1). logical research, as xdl as in RNAiyme'" 7et 1A (Ribo- other areas as diverse as zyme Tet 1.0) cucu specific is oxAlogy, virology, pharma- one of a group of impostanE cology and agricuBure. 1 ~ ribozymes (sequence-depend- USB RNAzyme° Tet 1.0 ent RNA entlornxfeases), that (ROwzpme Tet 1.0) cucu prarrise to be powerPul tools specific ia offered In a kit ' in experiments irndving all '" with all the accessory ''' aspects of RNA. RNArymeTM reagerita necesaery to cali- . Tat 1.0 (Ribozyme Tet 1A) ', brate the dhoxyme activity cucu -if- resembles a with arry RNA substrate and DNA restriction widorx clease be9in RNA anahyaia inthatitwiBcutRNAinlo: ! As Nways, looktoUSBfor discrete segmen~ts at a specific specific and efficient mdecu- nucfeoGde sequence; in this i, lar too;s to handle innovative case, deaving RNA at sites i hPPliczSons in t>iok gy having the sequence cucu. (A,ddi6anal information As with DNA restriction on next page.) endonudeases, the concept Tateft P®narq. ~ C) t-+ t: . C +v'> ~ . United States Biochemical I
Page 45: brs52e00
and order of authorshi var in institutions p y and countries, the current practice is too the next pass over its ground station (whieh THE NEVADA vague to allow identification of any but the could be on the same orbit or as many as 14 orbits later); this effectively blinded the GBD most eminent authors. about 20% of the time. The sensitive detectors " MEDAL Publicly funded scientific research has so aboard Gamma Ray Observatory [The remainder of this paragraph is as published.] REQUESTING NOMINATIONS for the far been a matter of trust. Some members of In the report "Geomagnetic ortgin for tran- article events from nuclear reactor- stent 1990 NEVADA MEDAL from individuals, concerned that this our government are now p powered satellites" by G. H. Share er al. (28 organiz(ations, eorporations, academ- trust has been abused. It seems incumbent Apr., p. 444), the following corrections should ic and research institutions to recog- achievements in sel- outstandin i on the scientific community to demonstrate be noted. The last sentence of the second full paragraph on page 445 should have read, "Their g n ze an open, constructive attitude to this criti- report providcs detailed confirmation of the ence and engineering, Eligibility in- cism and to seek to mitigate its cause. ongm of rhe SMM events.' On page 446, the h ld ~ cludes singular accomplishments and ou ~~,ter,ce of the caP uon of figure 3 s fifetime contributions. NOMINATION CECIL H. Fox have read, "Rate is in counts per 0.5 s," On page text references to figures 2 and 3 were 4-47 CLOSING DATE: AUGUST 1, 1989. 8708 First Avenue, Silver Spring, :WD 20910 , interchanged. The sixth sentence of the fifth ftill paragraph should have read, "The concentration THE NEVADA MEDAL is awarded by of particles on this L shell explains the peak " the Desert Research Institute, Un Versity Corrections The fourth sentence of obsen~ed by the GRS. the sixth paragraph should have read, "The spike of Nevada System and is sponsored by near 12 mm coincides with the time when SMM Nevada Bell, a member of the Pacific The Perspective "Gamma-ray observations of reached L shells on which positrons had been Telesis Group. The award includes orbiting nuclear reactors" by Joel R. Primack (28 deposited about a minute earlier." Reference 12 " minted siNer medallion, $5,000 hono Apr., p. 407) incorrectly identified the Gamma- Ray Spectrometer on the Solar Maximum Mis- Solar Geophysical Data Prompt should have read, Reports, No. 535 (Pt. 1), H. E. Coffey, Ed , rorium, and travel expenses for pre- sion satellite as having been blinded by radiation (National Geophysical Data Center, Boulder, sentation in Nevada. Presentation ae- fom Soviet satellites. The seventh paragraph CO, 1989) ° tivities include lectures by recipient at University of Nevada's Las Vegas & should have read, in part, "Gamma-ray detectors are surrounded by charged-particle detectors, so In the report "Distribution and detection of pos itrons from an orbiting nuclear reactor" by E. 448 d P R Hi bi 28 A S~ H that events initiated by gamma rays can be pr., p. ), . g e ( . ones an . Reno campuses, distinguished from background events initiated die following corrections should be noted. The by electrons. But positrons can annihilate on f h d f h first sentence of the caption for figure I should f SMR4 (dots) and C°s- c tions d "L h For intormotioNnominarion forms, ,,vrffe to: etector spacecra er part.s o t e gamma-ray t ot such as the SMM shield, and the resulttng 511- ave rea , o a o mos 1176 (triangles) at the times of 21 of the kcV gamma rays can appear to be astronomical most intense 511keVgattuna events recorded il 2 S b i h A THE NEVADA MEDAL gamma-ray signals. The SMM-GRS picked up such stgnals an average ofeight times per day for pr eptem er ng t e 29 by SMM dur to 1980 operating period." The first sentence of the DESERT RESEARCH INSTIME much of 1987 and early 1988, each time causuig caption for figure 3 should have read "Estima[- f i University of Nevada System brief interference with astronomical observa- f th Gamma- ti Th d t t i pos trons es- cd differcntial energy spectrun~ o er joule of fission from Cosmos 171 6 ca in P.O. Box 60220 ons. e a a s orage capac ry o e D GBD h B p p g the second sentence of 450 O Reno, Nevada 89506 etector ( ) on t e Japanese ray urst Ginga satellite was sometimes saturated by such n page , energy the first full paragraph should have referred to events, so that it could take no more data until event 5, not event 59. i Make your data... greater. No matter how interesting your scientific results are, they're not worth much unless you can com- municate them to other people. That's where SlideWrite Plus comes in. You see, our powerful presentation graphics software for the IBM PC and compatibles can turn the data you worked so hard to capture into high impact Antibodies on Deficient Cell Line -~~ - - , I , - _-:.--_..-__-°-..._= t: a LFA -fa ~ 0 S: a LFA -fp 0.54 1.00 . 150 • 2.00 Relative Adherence Ratios (RAR's) charts, graphs, slides and over- heads - and do it all in minutes. S1ideWrite Plus gives you pow- erful graphing features, full drawing capability, flexible label- ing with 16 fonts, and e-wremely high quality output on printers, plotters, and cameras. And that's just for starters. It's no wonder SlideWrite Plus tied for first place in a recent PC Week poll! Call us for a free demo diskette right now. We'll show you how SlideWrite Plus can help your results get results. Call for your FREE full-featured trial diskette! (408) 749-8620 Advanced Graphics Software 333 West Maude Ave.. Sunnytiale. CA 94086 SlideWrite Plus:M We make your data look terrific. 1244 Circle No. 208 on Readers' Service Card SCIENCE, VOL. 244
Page 46: brs52e00
1 I New Hope on the AIDS Vaccine Front Vaccination protects chimpanzees against the AIDS virus. Other developments include new genes for the virus and a disturbing finding about the virus variability. NEW DEVELOPMENTS re- ported at the International AIDS Congress in Montreal are lifting the fog of gloom that has enshrouded efforts to develop an AIDS vaccine for the past few years. Two separate groups of research- ers, using different approach- es, have for the first time shown that vaccination can protect chimpanzees against infection by the AIDS virus. "Some of the animal experi- ments are turning out now. A year or two ago things were much bleaker," says Dani Bolognesi of Duke Alexandra Levine and Jonas Salk: the results they reported on vaccine work University School of Medi- in humans and chimps caused a stir, cine, who is a member of one of the groups. By far the most controversial vaccine ap- proach is that of polio-vaccine developer Jonas Salk, director of the Salk Institute in La Jolla, California. He engendered a great deal of skepticism a year or two ago when he proposed that it might be possible to use an inactivated AIDS virus to boost the immu- nity of people who had already been infected and thereby keep them from developing full- blown AIDS. Salk was proposing to use a preparation that includes the viral genetic material. The fear was that if the viral material were not completely inactivated, the AIDS virus might reproduce in the patients, possibly making them worse instead of better. At the AIDS conference, however, Salk and his colleagues Clarence Gibbs of the National Institute of Neurological and Communicative Disorders and Stroke in Bethesda, Marvland, and Alexandra Levine of the University of Southern California in Los Angeles had only positive results to report. In one series of experiments, Gibbs vacci- nated three chimpanzees, two of which had alreadv been infected with the AIDS virus, with the inactivated virus preparation. After the vaccination, the AIDS virus could no longer be isolated from the previously in- fected chimps. "That's the fascinating part- that they were able to clear the infection. I2$4 That is very surprising," Bolognesi says. There may be a handful of exceptions, but people who have been infected with the AIDS virus have not been able to rid their system of it. That was another of the reasons for the original skepticism about Salk's AIDS vaccine proposal. Not only were the two chimpanzees able to rid themselves of their original infections, but their immune systems were apparently able to fight off the AIDS virus when they were subsequently challenged with high doses of the active agent some 13 to 15 months after the original vaccination. "The two previously infected chimpanzees did not get superinfected. We have not been able to isolate the virus from them," Gibbs told a crowded press conference. The third animal, who had not been exposed to the active virus before, did be- come infected by the challenge dose, but only transiently. "We have somehow ame- liorated the course of infection in this ani- mal," Gibbs says. Levine, meanwhile, has vaccinated 19 people who have AIDS-related complex, a mild form of AIDS that usually progresses to the full-blown disease, with the inactivat- ed AIDS virus preparation. Although it is not possible to tell whether the vaccination has helped these patients, it does not appear to have hurt them. None has suffered any serious side effects during the year since they have been vaccinated, and only two have developed AIDS. The vaccination also ap- pears to have improved the cell-mediated immune re- sponses of the patients. If so, this could be very important. Most researchers think that control of AIDS will depend as least as much on priming immune cells to kill cells in- fected by the AIDS virus as on stimulating the produc- tion of "neutralizing" anti- bodies that recognize and in- activate the virus itself. In fact, a series of failed experiments had raised seri- ous doubts about whether neutralizing antibodies would work at all. But that situation, too, is getting better. Now, researchers have shown that neu- tralizing antibodies do have a protective effect against the AIDS virus. The findings are the result of a collaboration between the groups of Robert Gallo at the National Cancer Institute, Scott Putney at Repligen Corporation in Cambridge, Massachusetts, Emilio Emini at Merck, Sharpe, & Dohme Research Laboratories in West Point, Penn- sylvania, and Duke's Bolognesi. These researchers have found that a spe- cific segment of eight amino acids on the envelope protein is particularly important in eliciting antibodies that neutralize the AIDS virus. According to Emini, if neutralizing antibodies directed against this target are mixed with the AIDS virus before it is inoculated into chimpanzees, the infectivity of the virus is diminished. "We have estab- lished a correlation between the ability of the antibody to neutralize the virus and the ability to protect in vivo," Emini says. Although the new findings raise hopes that vaccination can prevent AIDS infec- tions, Jay Levy of the University of Califor- nia, San Francisco, pointed to a potential hazard in efforts to raise antibodies to the AIDS virus. His group has found that some of the antibodies made by people infected with the virus may actually contribute to the worsening of their condition. 204'765191#i SCIENCE, VOL. 244
Page 47: brs52e00
i Although the list of animal species and the number of genes that have been introduced and expressed is small, such a strategy will undoubtedly be important in agricultural improvement. One of the first questions investigated by transgenic technology was the regulation of growth (2). The general strategy has been to introduce growrh-regulating genes under the control of heterolo- gous promoters into the germ line to allow long-term production of peptides in ectopic tissues. Successful expression of these proteins then creates a system in which the effects of a single hormone can be assessed in an otherwise normal animal. The regulation of postnatal growth is an exceedingly complex process that involves an interplay between circulating hormones, genetic potential, and the prevailing nutritional status of the animal. The hormonal cascade controlling growth consists of an array of hormones produced principally in the hypothalamus, pituitary gland, and peripheral tissue. Growth hormone (GH), an intermedi- ate in this cascade, is produced in somatotrophs of the pituitary and is under the neurohumoral regulation of two hypothalamic pep- tides, somatostatin and growth hormone-releasing factor (GRF). Somatostatin inhibits the release of GH, whereas GRF stimulates both GH synthesis and release. GH is thought to mediate growth by stimulating the synthesis and secretion of insulin-like growth factor I (IGF-I), which acts in concert with GH on peripheral tissues (3). In mice, the most dramatic effect of expression of bovine (b), ovine (o), rat (r), or human (h) GH has been a stimulation of growth that commences at about 3 weeks of age and reaches a plateau at about 12 weeks when the mice are as much as twice their normal size (2, 4-7). During the maximum growth phase (5 to 11 weeks of age), the growth rate in transgenic mice is four times that in control mice (8). Postnatal growth can also be increased by ectopically expressing hGRF, which stimulates somatotroph cells to produce more endogenous GH (9). Similarly, production of hIGF-I in transgenic mice increases somatic grol~th rates, although less dramatically than GH or hGRF expression (10). More recently, gene transfer technology has been extended to commercially important livestock (Table 1). The purpose of many such experiments was to test the feasibility of introducing foreign growth-promoting genes into the livestock genomes and thereby enhancing growth performance. The annual gross receipts for the sale of livestock are about $60 billion in the United States, and the gross receipts for pork amount to about $9.5 billion annually. Any strategy to improve the rate and efficiency of body weight gain has obvious interest to producers. Strategies to alter the composition of pork toward a leaner, less fat product are consistent with biomedical advice that people reduce their consumption of animal fat. The first attempt at applying this technology to domestic animals involved introduction of a fusion gene consisting of the mouse metallothionein-I (MT) regulatory sequences linked to the hGH gene into the genome of pigs (11, 12). The effects of expression of hGH in pigs have been difficult to assess for several reasons. First, the growth performance data obtained on founder (GO) animals indicated that expression of hGH exerted a pronounced antilipo- V. G. Pursel, K. F. Miller, D. J. Bolt, and R. G. Campbell arc at the U.S. Department of Agriculture, Agricultural Research Service, Beltsville, MD 20705. C. A. Pinkert, R. L. Brinster, and R. E. Hammer arc at the Laboratory of Reproductive Physiolog~ School of Veterinary Medicine, Universitv of Pennsvivania, Philadelphia, P.°+ 19104. R. D. Patmiter is at the Howard Hughes Medical fnstitute Laboratory and Department of Biochemistry, University of Washington, Seattle, WA 98195. *Present address: Embryogen, Athens, OH 45701. i Prescnt address: Dcpattment of Obstetrics and Gynecology, Ohio State University, Columbus, OH 43210. *ermanent address: Animal Research Institute, Werribee, Victoria, 3030, Australia. §To whom correspendence should be addressed. liPresent address: Howard Hughes Medical Institute Laboratory and Department of Cell Biology and Anatomy, University of Texas Southwestern qedical Center, Dallas, TX 75235. 1282 genic and lipolytic effect and stimulated IGF-I production, but body size was not dramatically altered (13, 14). Second, many expressing founder animals exhibited infirmities, including peptic ulcers and pericarditis, that precluded the possibility of making accurate evalua- tions of growth performance. Third, most founders that expressed GH displayed impaired fertility, which made propagation of lines of animals difficult. To continue investigating the growth-promoting potential of these peptides in pigs, we introduced genes encoding bGH, hGRF, or hIGF-I into the pig genome under the control of the mouse MT promoter. We report the successful introduction and expression of these chimeric genes in founder pigs. Because definitive answers regarding growth effects in farm animals are most efficiently ob- tained by direct sibling comparisons, we compared the progeny in several generations of pigs expressing bGH. Production of Animals Several methodologies are currently being used to produce trans- genic mice (including microinjection of eggs, retrovirus infection of embryos, and embryonic stem cell transfer into blastocysts); howev- er, only microinjection of DNA has been successfully used for transferring genes into sheep and pigs (Table 1). Although microin- jection of mouse egg nuclei has become relatively common, the application of this technique to domestic animal eggs was impeded by the opacity of the eggs. In rabbits and sheep, egg nuclei can be identified by means of differential interference-contrast (DIC) mi- croscopy. The opacity of the cytoplasm of pig and cow ova makes identification of nuclei, even with DIC microscopy, virtually impos- sible. To overcome this impediment, pig and cow ova can be centrifuged at 15,000g for 5 min, which stratifies the cytoplasm and leaves the pronuclei or nuclei in a clear equatorial layer of the egg (11, 15). Egg nuclei can then be easily seen by DIC microscopy and injected. The efficiency of production of transgenic pigs is still low compared to that of the production of transgenic mice. In mice, approximately 10 to 15% of the microinjected eggs develop to newborns, and, of those that are born and weaned, approximately 25% are transgenic (16). In contrast, during 3 years of gene transfer studies in pigs involving MThGH, MTbGH, MThGRF, and MTIGF-I genes, only 8% of the 7000 injected eggs developed to birth and about 7% of those born were transgenic (Table 2). This resulted in an integration efficiency of about 0.6% for pigs as compared to the 2.5 to 6% achieved in mice (16, 17). Similarly, low integration efficiencies for gene transfer into pigs have been reported for the introduction of a Moloney murine leukemia virus (MLV) rGH gene and a hMTpGH gene (18, 19). Although great strides have been made in applying gene transfer to domestic animals, the methodology is still inefficient. In mice, the frequency of integration of foreign DNA is affected by such factors as buffer composition, conformation of the DNA, concentration of DNA used for injec- tion, and the skill and experience of the microinjector (16). In addition, the quality of the egg influences both its viability after injection and DNA integration frequency. The conditions used for gene transfer into pigs and sheep are those that are optimal for mice, and they may not be optimal for eggs of domestic animals. Transgene Expression A summary of the data on transgenic pigs that expressed the injected gene after birth is shown in Table 3. Of 29 founder MThGH and MThGH transgenic pigs born, 19 (66%) produced 2047651946 SCIENCE, VOL. 244
Page 48: brs52e00
:~ li $ki~ [ Progress Toward Human Gene Therapy THEODORE FRIEDMANN Current therapies for most human genetic diseases are inadequate. In response to the need for effective treat- ments, modern molecular genetics is providing tools for an unprecedented new approach to disease treatment through an attack directly on mutant genes. Recent results with several target organs and gene transfer tech- niques have led to broad medical and scientific acceptance of the feasibility of this "gene therapy" concept for disorders of the bone marrow, liver, and central nervous system; some kinds of cancer; and deficiencies of circulat- ing enzymes, hormones, and coagulation factors. The most well-developed models involve alteration of mutant target genes by gene transfer with recombinant pathogen- ic viruses in order to express new genetic information and to correct disease phenotypes-the conversion of the swords of pathology into the plowshares of therapy. D URING THE PAST SEVERAL DECADES, THE PROMISING new concept of "gene therapy" has emerged, a concept based on the assumption that definitive treatment for genetic diseases should be possible by directing treatment to the site of the defect itself-the mutant gene-rather than to secondary or pleiotropic effects of mutant gene products. This involves an attack directly on mutant genes to replace or supplement defective genetic information with normal, functional genes. Gene therapy received much of its early theoretical support by the early 1970s (before the recombinant DNA era) from knowledge of the mechanisms of cell transformation by tumor viruses. Classes of DNA and RNA tumor viruses have evolved that carry out precisely those functions crucial to gene therapy, that is, the heritable and stable introduction of functional new genetic information into mammalian cells. Thus it was proposed that such viruses or other similar agents, deprived of their own deleterious functions, could be used as vehicles to introduce normal, fi.uictional genes into human cells to correct cellular defects and cure genetic disease (1-7). At the outset, investigators studying genetic correction of human disease were faced with many serious conceptual, technical, and ethical problems, many of which surfaced after the studies by Cline et al. in 1980 on the use of cloned human R-globin genes to treat two patients with thalassemia (8, 9). Since that time, work with model systems has firmly established mutant genes as uniquely appropriate targets for therapy for at least some genetic disorders. The author is at the Department of Pediatrics and Center for Molecular Genetics, School of Medicine, University of California, San Diego, La Jolla, CA 92093. Few discussions of gene therapy at scientific meetings and in publications still argue its need or potential place in medicine or its ethical accrptability, but rather they emphasize technical questions of efficiency of gene delivery and targeting and selection of suitable disease models. This review summarizes recent technical progress and discusses future clinical applications of methods of gene thera- py. Strategies for Gene Therapy-Gene Replacement, Correction, or Augmentation One form of gene therapy would involve specific removal from the genome of a mutant gene sequence and its replacement with a normal, fiulctional gene. There is little or no conceptual ground- work to suggest how that might be accomplished. An ideal approach to gene therapy, gene correction, would entail specific correction of a mutant gene sequence without any additional changes in the target genome. Although gene correction has until recently seemed equally difficult, genomic targeting of foreign sequences (leading to specific gene sequence modification) has now been demonstrated in several mammalian systems. Several groups have shown that mammalian cells contain the enzymic and structural machinery for site-specific recombination of foreign DNA, in principle permitting targeted genetic modification of any known sequence (10-13). In most of these homologous recombination studies, targeted sequences have been introduced into cells by traditional gene transfer methods of calcium phosphate-mediated transfection, electroporation, or mi- croinjection and have produced site-specific mutations in a number of loci, including the hypoxanthine-guanine phosphoribosyltrans- ferase (HPRT) and the int-2 loci in mouse embryonal stem cells. These methods will be applied to many other markers to study aspects of gene expression and to produce animal models for many human diseases (14). More established than gene replacement or correction are several techniques of gene augmentation, that is, approaches for modif,ying the content or expression of mutant genes in defective cells by introducing foreign normal genetic sequences. During the past decade, a number of efficient methods have been developed to introduce functional new genes into mammalian cells (as discussed below). In many cases, it is possible to restore a genetic function by the addition of nontargeted but functional genetic information into nonspecific sites of the genome without the removal or correction of a resident, nonfunctional mutant gene. Inevitably, some insertional mutagenic events will result from the integration of foreign se- quences at unusual sites in the genome and by the associated likelihood that gene expression from such ectopic transgenes is unlikely to be regulated faithfully. Nevertheless, because of the high efficiency of some kinds of vector-mediated gene delivery, this gene 16 JUNE 1989 ARTICLES 1275
Page 49: brs52e00
J Table 5. Histopathology of MTbGH transgenic pigs. Five transgenic and three control G1 and G2 pigs (age 4.5 to 10 months) from lines 31-04 and 37-06 were used. Animals were killed, a necropsy was performed, and tissues were processed for light microscopic examination. The number of pigs showing symptoms out of the number of pigs examined is indicated. Number of animals Diagnosis* Transgenic C.ontrol Gastric ulcers 5/5 0/3 Synovitis 4/5 0/3 Cardiac myocyte nuclear hypertrophy 4/5 0/3 Dermatitis 4/5 1/3 Nephritis 3/5 0/3 Pneumonia 3/5 1/3 *see (70). species to another and have undoubtedly been affected by natural or deliberate selection processes. Hence, centuries of selection for growth and body composition may limit the ability of the pig to respond to GH, that is, in contrast to the mouse. Although the 10 to 15% increase in daily weight gain and 16 to 18% increase in feed efftciency obtained in transgenic pigs are modest improvements in growth (when compared to the degree of enchanced growth in transgenic mice), the results are quite similar to those reported for pigs injected daily with pGH and could have a significant impact on the $9.5-billion annual pig industry. In swine, appetite depression is a major factor that limits the growth response from elevated GH, and therefore the alleviation of this side effect could further enhance the economic potential. Elevated GH in rats stimulates hyperphagia, which provides them with the necessary nutrients to support the rapid rate of protein accretion (41). A comparison of the appetite control mechanisms in the two species may suggest strategies to increase appetite and feed consumption in transgenic pigs. Accurate assessment of the growth rate of pigs harboring GH transgenes was impossible until enough animals could be reared under controlled conditions for proper statistical analysis. The variable genetic background, environmental conditions, and biased attention that founder animals receive preclude accurate assessment of many characteristics. Initially, we thought that the failure of pigs to show more dramatic growth might be due to poor binding of the heterologous hGH or bGH to endogenous GH receptors. This now seems less likely because it is clear that IGF-I levels are elevated in pigs to a degree similar to that observed in transgenic mice, indicating that GH receptors in the pig liver are probably maximally stimulated. The pathological consequences of transgene expression might be ascribed to inappropriate binding of foreign GH to some receptors. Similar disorders were also observed when endogenous mGH was elevated by ectopic expression of hGRF (30). Thus, we believe that the infirmities observed in transgenic pigs are a conse- quence of the long-term exposure to elevated GH rather than the heterologous nature of the GH. Most market hogs are crossbreeds of several purebred strains, and therefore our experiments were conducted on this type of animal. In addition, in commercial hog operations livestock are generally reared on concrete in an indoor environment within a confined space, and our experimental environment was similar. We believe that the infirmities observed in the pigs expressing GH transgenes would have been less frequent and less severe if the genetic base used for our experiments had been selected for structural soundness of legs and the ability to withstand these commercial rearing condi- tions. Nevertheless, elimination of side effects can probably only be achieved by rigorous regulation of transgene expression to a dura- tion of 1 to 2 months during the rapid growth phase in domestic t286 swine. Thus, tightly regulated GH transgene expression would be analogous to a short-term duration of exogenous pGH injections, which generally have not caused severe adverse health problems in treated pigs. This degree of transgene regulation has not yet been achieved, but the rapid pace of discovery regarding gene regulation makes such a requirement a possibility within a few years. In the examples described here, we focused on enhancing the growth rate of pigs and a side effect was the reduction in subcutane- ous fat. Perhaps other approaches could be used to more directly change the body composition. One example is that the body fat characteristics might be altered or muscle mass might be selectively increased by introducing appropriate genes. Likewise, the composi- tion of milk could be altered to make it more nutritious or better suited for certain commercial processes. Another possible mechanism for improving domestic farm ani- mals involves introducing genes that would increase the resistance of these animals to infectious diseases or parasites. For example, novel immunoglobulins with specificities for particular antigens can be isolated from hybridomas and introduced into the germline. This has been accomplished in mice that expressed large amounts of antibodies to nitrophenyl, trinitrophenyi, and phosphorylcholine residues without prior immunization (42-44). A disadvantage of this approach is that the rearranged transgenes inhibit the rearrange- ment of endogenous immunoglobulin genes (45). Although this has not had a profound effect on the health of mice reared in the laboratory, it might compromise animals in a natural environment. It might be possible to redirect immunoglobulin production to Table 6. Growth performance of 2MTbGH transgenic pigs. Values are least- squares means -!- SEM; the number of animals is indicated in parentheses. Sample means were compared for significance by an analysis of variance. ND, not determined. Group Average daily weight gain (g) Feed cfficiency (kg feed/ kg gain) Founder animals* Control 743 ± 32 (6) 3.12 ± 0.15 Transgenic 690 ± 65 (6) 2.62 ± 0.12 P = 0.480 P = 0.026 37-06 G2 progenyt Control 760 ± 24 (8) 2.99 ± 0.12 (8) Transgenic 874 ± 30 (5) 2.46 ± 0.16 (5) P = 0.016 P=0.026 37-06 G3 progeny$ Control 867 ± 21 (15) ND Transgenic 933 t 31 (8) P = 0.098 31-04 G2 progeny§ Control 869 t 44 (7) ND Transgenic 988 ± 62 (7) P = 0.15 Combined progeny Control 815 ± 17 (30) ND Transgenic 905 ± 21 (20) P = 0.001 *Six transgenic pigs (GO) that express MTbGH (Table 3) and six control nontransgenic littermates had free access to a com-soybean diet (16% protein) at a body weight between 30 and 60 kg. tTransgenic and control pigs are G2 generation progeny of MTbGH founder 37-06 (Table 3). The experimental period began at an ininal weight of 30 kg and continued to 90 kg. Pigs had either restricted (90% of ad libitum consumption) or ad libitum access to a com-soybean diet containing approximately 18% crude protein supplemented with 0.25% lysine (39). Average daily weiQht gain and feed efficiency did not differ between pigs fed a restricted diet or pigs E'ed ad L'bitum, and therefore values are pooled means. $Transgenic and control G3 generation progeny of M-IbGH founder 37-06 had free access to com-soybean diet (18% protein) suppfemented with 0.25% lysine (39) at a body weight between 30 and 90 kg. 3Transgenic and control G2 progeny of MTbGH'founder 31-04 had free access to a corn-sovbean diet (18% protein) supplemented with 0.25% lysine (39) at a body weight between 30 and 90 kg. 204'7651950 SCIENCE, VOL. 244
Page 50: brs52e00
I r useful models for these human diseases. Such models will facilitate analysis of the pathology of the disease and provide a system for the exploration of new therapeutic protocols including gene therapy. A new arena for biotechnology is the application of transgenesis to the improvement of domestic animals and plants, as well as for the production of rare products such as pharmaceuticals within domestic animals (as discussed in this issue). These efforts will certainly be complemented and augmented by the use of gene targeting to modify the host genome. Transgenesis and gene targeting are often directed towards different ends, the former being used to gain new functions, the latter being used to augment or to generate loss of existing functions. As regulatory loops become better defined, it should become possible to alter such loops by gene targeting, thereby reducing the production of undesired products (such as fat content in meat) or increasing the production of desired products (such as pharmaceuticals in milk). The power of gene targeting resides in the ability of the experimenter to precisely choose both the gene to be modified and the specific change to be introduced. Molecular analysis of tumors and transformed cells has revealed a expression of the gene of interest is not detectable in ES cells, the experimental options are less well defined. With the above proviso, the future of gene targeting in mammali- an systems appears very bright. Generation of specific mouse mutations via gene targeting should have a major impact on all phases of mammalian biology, including development, cancer, immunology, neurobiology, and human medicine. For example, recent molecular genetic analysis of development in Drosophila has revealed a network of genes that control the fbrmation of its metameric pattern (23). On the basis of DNA sequence similarity, related genes, such as the hox genes, have been identified in the mouse (24). The embryonic expression patterns of these genes imply roles in establishing positional information during development. How closely the function of the mouse genes may parallel the function of the Drosophila homologs, if at all, remains to be determined. Targeted disruption of these genes may not only reveal the phenotypes associated with the inactivation of the individual genes, but, through epistasis and molecular analyses, may also help define the developmental network controlling early mouse morpho- genesis. plethora of genes contributing to malignant growth. The normal function of these proto-oncogenes is currently deduced from such features as their protein products, their cellular compartmentaliza- tion, and their expression pattern. Genetic dissection of their function in the mouse or in tissue culture systems should permit a more precise definition of the normal function of these genes, and potentially, a better appreciation of the role of oncogenes in causing malignancy. The development of genetically engineered mice in which the effects of deficiencies in anti-oncogenes, such as the retinoblastoma gene, could be studied would prove of great experi- mental value. On the other hand, the genetic function of some of the more ubiquitously expressed proto-oncogenes, such as myc, fos, and jun, may be more clearly defined in tissue culture systems rather than in the intact animal. ES cells could be a particularly attractive cell culture line for such an analysis. These cells are euploid and stable with respect to karyotype. Further, they can be induced to differenti- ate in vitro into many different cell types. If these factors participate in making early cell lineage decisions, then loss of function alleles could lead to a restriction in the spectrum of final differentiated cell types. Immunology appears to be a particularly fertile field for genetic analysis by gene targeting. It is by far the best characterized cellular system in mammals, and extensive molecular analysis has identified many of the genetic components responsible for immunological diversity. Further, since the immune system is dispensable, analysis of many of the null phenotypes should be simplified. Approximately 3500 different human genetic diseases are known. As the genes responsible for these diseases are identified and cloned, disruption of the corresponding genes in the mouse should provide 1292 REFERENCES AND NOTES 1. A. Gossler, T. Doetschman, R. Korn, E. Serfling, R. Kemler, Proc. Natl. Acad. Sci. U.S.A. 83, 9065 (1986); E. Robertson, A. Bradley, M. Kuehn, M. Evans, Nature 323, 445 (1986). 2. M. Hooper, K. Hardy, A. Handyside, S. Hunter, M. Monk, Nature 326, 292 (1987); M. R. Keuhn, A. Bradley, E. Robertson, M. Evans, ibid., p. 295. 3. S. Thompson, A. R. Clarke, A. M. Pow, M. Hooper, D. W. Melton, Cell 56, 313 (1988). 4. M. Evans and M. Kaufman, Nature 292, 154 (1981); G. Martin, Proc. NatL Acad. Sct. U.S.A. 78, 7634 (1981); T. Doetschman, F. Williams, N. Maeda, Dev. Biol. 127, 224 (1988). 5. J. Paszkowski, M. Baur, A. Bogucki, I. Potrykus, EMBO J. 7, 4021 (1988). 6. K. R. Folger, K. R. Thomas, M. R. Capecchi, Cold Spring Harbor Symp. Quant. Biol. 49,123 (1984); F. L. Lin, K. Sperle, N. Stemberg, ibid., p. 139; O. Smithies, M. A. Koralewski, K. -Y. Song, R. S. Kurcherlepati, ibid., p. 161; A. J. H. Smith and P, Berg, ibid., p. 171. 7. M. R. Capecchi, Trends Genet, 5, 70 (1989). 8. K. R. Thomas and M. R. Capecchi, Cell 51, 503 (1987). 9. T. Doerschman, R. G. Grcgg, N. Meada, M. Hooper, D. W. Thompson, O. Smithies, Nature 330, 576 (1987). 10. T. Doetschman, N. Meada, O. Smithies, Proc. Nat/. Acad. Sci. U.S.A. 85, 8553 (1988). 11. K. B. Mullis and F. Falovna, Methods Enzymol. 155, 335 (1987). 12. H. S. Kim and O. Smithies, Nucleic Acids Res. 16, 8887 (1988). 13. A. L. Joyner, W. C. Skarnes, J. Rossant, Nature 338, 153 (1989). 14. A. Z.inmier and P. Gruss, ibid., p. 150. 15. M. Jasin and P. Berg, Genes Dev. 2, 1353 (1988). 16. J. M. Sedivy and P. A. Sharp, Proc. Natl. Acad. Sa. U.S.A. 86, 227 (1989). 17. S. L. Mansour, K. R. Thomas, M. R. Capecchi, Nature 336, 348 (1988). 18. K. R. Folger, E. A. Wong, G. Wahl, M. R. Capeechi, ,M14ol. Cell, Biol. 2, 1372 (1982); D. B. Roth, T. N. Porter, J. M. Wilson, ibid. 5, 2599 (1985); K. R. Thomas, K. R. Folger and M. R. Capecchi, Cell 44, 419 (1986). 19. D. Kostic and M. R. Capecchi, unpublished results. 20. K. R. Thomas and M. R. Capecchi, unpublished results. 21. M. R. Capecchi, Cell 22, 479 (1980). 22. A. Larue and R. M. Liskay, Genetia 117, 759 (1987). 23. For a recent review see P. W. Ingham, Nature 335, 25 (1988). 24. For recent reviews see P. W. M. Holland and B. L. M. Hogan, Genes Dev. 2, 773 (1988); G. R. Dressler and P. Gruss, Trends Genet. 4, 214 (1988). SCIENCE, VOL. 2q-¢
Page 51: brs52e00
AcYoriyms in Search of Particles The largest of the four LEP experiments, each of which receives most of its funding from outside CERN, is known somewhat prosaically as L3. More than 400 physicists from the United States, Europe, the Soviet Union and the People's Republic of China will collaborate on L3, an unprecedented joint effort. The team has been put together by Nobel Laureate Samuel Ting of the Massachusetts Institute of Technology. The detector itself is as tall as a four-story house, It is distinguished from the other three in that the coil which produced its magnetic field is at the perimeter of the detector, rather than close to its heart. Achieving this has meant using 8500 tons of steel for the magnets that produce the field-more than the Eiffel tower in Paris-but it also provided unprecedented precision for tracking muons. These have long been Ting's specialty, and, he hopes, will prove the key to finding the Higgs boson. The next detector down in size is known as DELPHI. Incorporating the biggest superconducting magnet in particle physics-its cryostat has an internal diameter of 5.2 meters-DELPHI will specialize in precise three-dimensional measurements of the physical characteristics of the leptons and photons produced in the LEP electron/ positron collisions, More 400 scientists, coming from 40 separate research institutes, are involved in the DELPHI experiments alone, and the detector contains much state-of-the-art technology, including Ring Imaging Cherenkov counters that will be used to identify hadrons. "DELPHI is probably the most sophisticated of the four detectors, and we hope that it will produce the richest physics," says Peter Renton of the Uni- versity of Oxford. The most conventional machine is known as OPAL. Based on well-estab- lished detector techniques, including the use of lead-glass blocks for its electro- magnetic detector and streamer tubes for detecting hadron showers, OPAL will be able to provide highly accurate identifica- tion of electron and photon energies. The fourth detector, like OPAL, is a general purpose detector, ALEPH. Per- haps the simplest of the four, its particu- lar skill will be in tracking and identifying all types of charged particles. To do this with unprecedented accuracy, it will use a powerful Time Projection Chamber de- veloped at the University of California, Berkeley to provide highly detailed infor- mation about particle positions. The different capabilities of the four experiments will be most strongly felt when the accelerator comes up to its full LEP detector: Looking into the barrel of power sometime next year. Operating at ALEPH. beam energies above 80 GeV that will be achieved once superconducting radio frequency accelerating cavities are introduced, this will in particular make it possible to study the production of W+W- pairs. It is at the higher energy levels, for example, that the first evidence for the existence of the top quark is likely to appear (although, given the right circumstances and and slice of luck, there is a small chance that it could before). And it will also be when the greater luminosity means that LEP is producing Z particles by the tens of thousands that the Higgs particle will finally emerge. "We really have no precise clues as to where to look for it; it will be like looking for a needle in the proverbial haystack," says Renton of DELPHI. "The hope is to study about 10 million collisions over the next 3 or 4 years, and among these, we may be looking for signals of about 10 events." With that kind of signal to noise ratio, you need the right machines and the right teams working them.  D.D. rate operation that would leave to Europe the less glamorous tasks of filling in the gaps. But as physicists at CERN involved in LEP (about 200 of whom are U.S. citizens, out of a total of 1200) tell it, these fears have largely evaporated. Delays in the completion of the Stanford machine have diminished the chances that it will prove to be a serious challenger, either scientifically or politically, they say. It's true that the California physi- cists greeted the first Z particle with much hoopla in April; but the machine is still producing Zs at the rate of only a few a day. Several thousand per day, however, are go- ing to be needed before any significant conclusions can be reached about the precise characteristics of the particle, and-if every- thing goes according to plan-LEP will be able to produce these in only a few days of operation. "From our point of view, what has hap- pened with the SLC has been too perfect for words," says CERN physicist Alasdair Smith. "The machine has not failed to work, which would have made things difficult for everyone in high energy physics; but neither have they come up with thousands of Z particles before we have even started, which had been their original plan. It leaves the real crunch to us." And Smith and his CERN colleagues are experiencing the unique features of that crunch. "In the past ... the main competi- tion has tended to be between different accelerators," says former CERN director- general Henvig Schopper, who has since joined one of the experimental teams. "Competition in the future will be between different groups working around the same accelerator." This translates into a second unique as- pect of CERN's research environment: "There has always been competition," Smith points out, "but it has never been as intense as it will be now, because people have never been doing virtually identical experiments." From this, Smith concludes that: "If one group feels it has found something signifi- cant, they know another group will have more or less equivalent data, and perhaps they will do a better job at analyzing it." As Schopper proudly points out, LEP has been built on time and at a total cost of about $660 million, all of which was achieved within CERN's constant operating budget. This has been achieved through imposing draconian restrictions on spend- ing, a new experience for a laboratory which has, in the past, been accused by its detrac- tors of "gold-plating" its equipment in com- parison to that in U.S. accelerators. In a series of moves that have at times caused considerable ill-feeling and discontent SCIENCE, VOL. 2q-} M8 2047e51920
Page 52: brs52e00
result trt the HSV-tk gene not being transferred into the target locus. The HSV -tk gene 'ts lost during the process of homologous recombination because it is located distal to the region of homology between the vector and the target. Only cells in which random integration of the targeting vector has occurred will be able to retain the HSV-tk gene. This is predicted from the observation that most random insertions of exogenous, linearized DNA into the genome occur via their ends (18). Therefore, by using G418 to select for cells that contain a functional neo` gene and by using gancyclovir to select against cells that contain a functional HSV-tk gene, we can enrich for cells in which the targeting event has occurred. We have tested the above PNS approach by using it to disrupt the mouse hprt, int-2, hox 1.2, and hox 1.3 genes (17, 19) and observed as much as a 2000-fold enrichment for targeted disruptions. Targeting into Genes Not Expressed in ES Cells An ideal strategy for disrupting a gene not expressed in ES cells has not yet emerged. Preliminary attempts in which the PNS procedure was used to mutate one such gene, the proto-oncogene int-1, suggests that the targeting frequency is much lower than that obtained at the hprt, int-2, hox 1.2, and hox 1.3 loci (20). It may be possible to increase the enrichment factor by strategies designed to enhance the stringency of either the positive or negative component of the selection. As an example of the latter, to reduce the frequency of HSV-tk loss during transfection, two HSV-tk genes could be inserted into the targeting vector, one at each end, and then at least one should survive transfection to permit selection against cells containing random integrations. Placement of a large block of nonhomology at both ends of the linearized targeting vector, as is required to construct a double tk vector, does not affect the frequency of homologous recombination (20). Among alternative approaches to consider are the use of pure screening procedures or enrichment procedures. Embedded within the decision of whether to use nonselective or selective protocols is the choice of whether to deliver the targeting vector to the recipient cells by microinjection or electroporation. Microinjection into the nucleus results in very high frequencies of stable transfectants (10 to 20% of the cells receiving DNA) (21). However, only a single cell at a time can be microinjected, whereas electroporation allows large numbers of cells to be simultaneously transfected. After electroporation -1% of ES cells are stable trans- fectants (17). The choice of transfection protocol should be deter- mined, in part, by the method chosen to identify and isolate the ES cells in which the desired targeting event has occurred. Methods that rely solely on screening are dependent on the absolute targeting frequency and therefore microinjection should be considered. On the other hand, since enrichment procedures rely on selection they are not as dependent on the absolute targeting frequency and can take advantage of mass transfection protocols. As already discussed, Zimmer and Gruss (14) used microinjection to deliver the targeting vector and reported that 1 in 150 cells receiving an injection of an altered hox 1.1 genomic fragment yielded a disrupted hox 1.1 gene. The reasons for this very high frequency of homologous recombination are not clear, but some or all of the following factors may have played a role: (i) delivery of the DNA by microinjection, (ii) absence of a selection protocol to isolate the ES cells in which a targeting event had occurred, (iii) disruption of the hox 1.1 genomic fragment in the targeting vector with only a small (20-bp) insert, or (iv) a hot spot for recombination at the hox 1.1 locus in ES cells. Intrachromosomal gene conversion experiments in cultured mam- malian cells suggest that the frequency of recombination events is inversel,v related to the length of nonhomology that must be corrected (22). Therefore, small disruptions in the targeting vector may favor higher targeting frequencies. This parameter has not, however, been directly measured in gene targeting experiments. Since the DNA substrates participating in intrachromosomal and gene targeting reactions may be quite different, extrapolating the results from one set of experiments to the other could be misleading. On the basis of the above discussion, a number of alternative approaches can be suggested that may allow disruption of a gene not expressed in the recipient cell. Among these alternatives are: (i) microinjection of the targeting vector into the recipient cells fol- lowed by PCR to screen for the transfer of a small oligonucleotide insert to the desired target gene, (ii) electroporation of the targeting vector followed by PCR or (iii) electroporation of the targeting vector followed by an enrichment procedure, such as PNS, to select cell lines in which the targeting event has occurred. Each approach is associated with its own risks. If the targeting frequency with microinjection is in the range of one event per 104 cells, then this procedure is extremely labor-intensive. The absolute frequency of targeting events by the second procedure could be less than one event per 10s electroporated cells. Under these conditions, it becomes a challenge to use PCR to identify the targeting event. Finally, concerning the third approach, it is possible that the chromosomal environment surrounding a silent gene in ES cells may repress expression of the selectable marker. Under these conditions, enrichment procedures such as the described PNS procedure cannot be used. The Future of Gene Targeting As different methods of identifying successful targeting events are applied to more genes, their strengths and limitations will become evident. Current techniques should permit the generation of mouse mutants in many, if not all, genes. In particular, if the gene is expressed in ES cells, then enrichment procedures should allow the desired, targeted-modified ES cells to be found among a small number of selected clones (1 to 20). If, on the other hand, Fig. 3. The targeting frequency at the hprt locus as a function of the extent of homology be- tween the targeting vector and the endogenous target. A series of replacement, 0, and inser- tion, 0, hprt targeting vectors were constructed that varied in the extent of homology to the endogenous hprt. Hprt sc- quences in each vector were in- terrupted in the eighth exon with neo. The amount of hprt sequence 3' to neo was kept constant and the amount of hprt sequence 5' to neo varied. The conditions for electroporation and selection for G418~-6-TGr 10-4 ~• / ~ ~ 1 a 5 ~ m m ~ ZZ 5 / O ~ . ~ o a t o"6 ~ ~. ES cells were as described (7). J CQ All G418`-6-TG' cell lines were hprt- as a result of targeted dis- ry G` Independence ruption of hprt. of the targeting events was guaranteed by only scoring G418`-6-TG` colonies that arose on separate plates. The absolute targeting frequency 10'7 1 2 i i i 6 10 14 Homology (Kb) number of independent targeting events per total ES cells electroporated is plotted on a logarithmic scale as a function of the number of kilobases of hpn sequence contained within the targeting vectors. l I f 16 JUNE 1989 ARTICLES I29I
Page 53: brs52e00
(I I deliberately encourages close rivalry, for ex- atnple, by requiring that all potentiallv inter- esting data be analyzed by two separate teams completely independently. "If both teams come up with the same results, we can already be much more sure that there is not a mistake," says Mannfred Steuer, a physicist from the Massachusetts Institute of Technology who works with Ting on the L3 detector. "Competition [be- tween the different experiments] is a good thing, because it will ensure that one gets the results very fast, and also that they are unbiased." The results obtained in the first few months of operation will be important for more than their scientific significance. They will also be used by CERht director Rubbia to decide what type of upgrading of LEP in the mid-1990s he should try to persuade the member states to back. This will be high on the agenda when research ministers meet to discuss CERNs future early next year. There are two main possibilities in the medium term. One is to increase the energy levels in the LEP ring (a move that would require applying for new planning permis- sion from local authorities). The other is to introduce polarized beams, a step already being planned at Stanford. Looking further into the future, the 14 member states will also have to decide what type of support to give to Rubbia's proposal for a second, superconducting ring in the LEP tunnel. This would turn LEP into a Large Hadron Collider capable of produc- ing collisions at around 10 TeV; this energy range approaches that of the proposed Su- perconducting Super Collider in the United States-but, according to LEP officials, at about one-fifth the cost of that mega-ma- chine. It will be no easy task to squeeze the money for LHC out of governments for whom high energy physics no longer has the same glamour it once did. But Rubbia seems determined to put some of this glamour back; despite the cuts, for example, the advertising firm Saatchi and Saatchi has already been brought in to advise on how best to stage the official opening of LEP later this year, with guests ranging from the King of Norway to British Prime Minister Margaret Thatcher. For most CERN physicists, however, the pomp and glamor of such a ceremony will be a side-show to the real action. After 10 years of design work and construction all eves are on the performance of LEP as it slips into action in the next few weeks. Whatever happens, there is certain to be a great deal of work to do and hundreds of pairs of hands put to the task.  DAVID DICKSON 1260 Another Piece of 3.14159 ... ? In 1666, Isaac Newton turned some knobs on his newly invented calculus and cranked out a decimal approximation to the ancient number pi-the ratio of circumference to diameter of a circle. "I am ashamed to tell you to how many places of figures I carried these computations, having no other business at the time," he later wrote. The figure was 16. If Newton was ashamed, then David and Gregory Chudnovsky might well be mortified: the two Columbia University mathematicians have computed 480 million digits of pi. The Chudnovskys' feat eclipses the previous record of just over 201 million digits, set last year by Yasumasa Kanada of the University of Tokyo. If Science tried printing their result, the digits would fill up every page of every issue for the rest of the century. So you might ask: Why would they do this? One reason for computing digits of pi is pure competitiveness and what can only be called the Mount Everest syndrome: because it's there. The Chudnovskys maintained silence during the calculation, not even telling the people at IBM or Cray exactly what they were doing, lest the competition dedicate a machine or two to the same task. But there's a practical use for their work, as well. For one thing, there's nothing like a good run of pi digits to shake down a new computing system. For another, you can investigate a variety of number-theoretic and statistical hypotheses regarding pi this wav: for instance, the relative frequency of various digit strings. The Chudnovskys' result allowed them to improve an analytic theorem regarding rational approxima- tions to pi. So if you accept the importance of this work, you may come to the question: how in the world did they do it? Part of the how, of course, is computers. The Chudnovskys carried out their calculations on a CRAY 2 at the Minnesota Supercomputer Center in Minneapolis and on an IBM 3090-VF at the IBM Yorktown Heights Research Center in New York. The rest of the how is pure mathematics. "In order to compute a number well, you have to know it intimately," says David Chudnovsky. Their calculation is based on a formula which the Chudnovskys discovered in 1984, relating pi to an infinite sum of rational numbers. The new formula was inspired by one discovered earlier this century by the Indian mathematician Srinivasa Ramanujan. William Gosper of the Symbolics Inc. in Palo Alto, California, used the Ramanujan formula in 1985 to obtain a short-lived record 17 million digits of pi. Both formulas stem from deep relationships in number theory and algebraic geometry. But what if a cosmic ray or a power surge or a speck of dust on a disk messed something up in the calculation-how would you ever know? "We have an absolutely sure-fire way of validation and verification of the calculations," David Chudnovskv says. The verification is based on deep number-theoretic properties of the infinite sum, which they proved only last year. It can be thought of as a sophisticated version of the old accountants' trick of checking calculations by casting out nines; for the Chudnovskys a large set of prime numbers do essentially the same thing. The Chudnovskys were extremely careful in handling the data. "We deposited on every media--disk or tape or anything else-the data together with a complete set of keys.... This means that every time we wrote in and every time we wrote out, we were checking whether we were correctly writing in and correctly writing out," David Chudnovsky says. "Out of all the computational time, over 90% of it went on verification, and the real run was under 10% of CPU time-which shows that our algorithm was pretty good." Finally, there's the question, Where do we go from here? The answer to that one is that inherent in the Chudnovsky victory is the seed of its eventual defeat. A key new feature of their approach, the Chudnovskvs say, is that it is expandable: more digits can be added on demand. By that they mean that you don't have to start from scratch to beat them, you can use their own method to pick up from where they left off or at any point in the chain of digits. So the procedure can actually be farmed out, with independent computers contributing to the calculation. That possibility evokes perhaps the grandest aspect of the Chudnovsky vision: a "pi chain letter" leading to a multibillion-digit decimal expansion of pi. The burghers of Oklahoma, who once tried to eliminate by legislation all the decimal places from pi because it was too complicated, will not be pleased.  BARRY A. CIPxA Barry Cipra is a rnathematician and writer based in North/ield, Minnesota. Z-4) © ~ ~ U"'• T1z SCIENCE, VOL. 24¢
Page 54: brs52e00
BIO-SOLUTHS N ,n.be., An Update on the State of theArtin SeparationsTechnology ew capillary electrophoresss system prwrrides unprecedented flexibilitg: Capillary electrophoresis is draw- ing a great deal of attention for its ability to separate a wide range of molecules rapidly and with high resolution. With a potentially wide variety of applications, CE serves such disparate needs as basic research, methods development, and automated QA analysis. The Dionex Capillary Electro- phoresis System I rises to this challenge. The CES I features fully programmable, dual-polarity power supplies with 3 control modes and gradients. It offers 3 automatic sample -injection modes: electromigration, gravity, and pneumatic. An intelligent, 40-position autosampler runs samples in any N owyou can map the oligosaccharide components of glycoproteins. Until now, glycoproteins have pre- sented serious analytical obstacles to the researcher.While peptide mapping is relatively routine, oligo- saccharides have always been notoriously resistant to mapping and sequencing. With the growing awareness of the importance of oligosaccha- rides in numerous biological order, and the system automatically rinses and refills vials and capil- laries at each run. Two detection modes are standard-UV/Vis with fiber optic-based remote cell and f luorescence with photo multiplier tube. The CES I uses forced-air cooling which assures reproducible analytical conditions. The CES I breaks new ground in flexibility, ease of use, and value-regardless of application. Oligosacclxrride map of botine fetuln 20 2 , 30 40 50 iime(min) processes, the need to perform oligosaccharide mapping and pro- filing has also grown. Now Dionex makes all aspects of glycoprotein analysis not only possible but, for the first time, practical as well. Dionex OligoStandards' are the latest addition to what is fast becoming a total system for ana- lyzing glycoproteins from initial purification to final analysis. They allow comparison of oligosaccha- rides under investigation to known standards for fast and easy recog- nitlon.What in the past required months and years of work can now be accomplished in minutes on the Dionex BioLC' system. nique 4mniPac' columns-a major advance over bonded silica. These remarkable polymeric, multi-dimensional columns com- bine 2 separation modes-ion exchange and reversed phase.100°0 solvent- and buffer-compatible, the OmniPac columns can work small miracles, such as combining sample preparation and analysis in one column, or separating ionic impurities from peptides and pro- teins. The columns are utuque in their use of solvents and buffers to control selectivity for peptide mapping. OmniPac columns combine a pH stability of 0-14 with the speed and efficiency of bonded silica, providing the ideal solution for bio separations. or complete information or ~ to dlscussyour ~ application, ~ contactyour ~ localDione»k representative f or (in U.S.A.) calll- ~ 800-2271817, ext. 42. ~ DIONEX ~ ~ 60 Systern: 6loLC Cdumn: CarboPac PA1 Detrctor: Pulsed Amperometrtc Oetectlon fP,aks 1 and 2 can be identtfied u~tb D1igoStandards' A BE1M SOLU110N ~ Dionex Cofporazion, P 0. Box 3603. SLnnymle, CA94088-3603 C t989DiaiexCorporatlm Circle No. 202 on Readers' Service Card
Page 55: brs52e00
MACINTOSH DATA ACQUISITION SOLUTIONS... Yours is here. Let us help you find it! Gwl has more Macintosh data acquisition products and experience than anyone. Call today and discuss your project with an experienced applications engineer. FREE 56-PAGE CATALOG 617-625-4096 ~ N . \ / GW Instruments, Inc. 35 Medford Street • Somerville, MA 02143 The Macintosh Data Acquisition Company Circle No, 69 on Readers' Service Card 14 32 35 125 BIOSCAN Imaging Scanners provide rapid, quantitative radioisotope analysis without plate scrap~ng ro scintillation counting. Imaging Scanners are the ulti- mate systems for analysis of TLC plates, gels, blots and paper strips ... A powerful quantitative tool (yet surpris- ingly affordable) for research in: • drug metabolism • lipid biochemistry • biotechnology • enzymology • radiochemistry • toxicology Call toll-free, 800-255-7226. B 1osic=~ 4590 MacArthur Blvd. Washington, D.C. 20007 Circle No. 237 on Readers' Service Card THE SOURCE FOR CARBOHYDRATE CHEMISTRY Unrivalled expertise and product lines to serve the life scientist Pfanstiehl Laboratories is the world leader in isolation, synthesis and puri- fication of carbohydrates-everything from simple sugars to blocked inter- mediates to polysaccharides. This broad product range provides the tools for synthesis of nucleosides, biologically active carbohydrates, and other biopharmaceuticals. With a heritage of 70 years of spe- cialization, Pfanstiehl scientists and skilled technicians are well-equipped to meet the constantly changing needs of today's dynamic life sciences. This expertise is available to you on a confidential disclosure basis. Product capability from bench to pilot plant to bulk volume Whatever your needs, we can meet your requirments on spec, on budget and on time. Meticulous attention is paid to analysis and product quality, with full documenta- tion maintained in accordance with GMP Guidelines. Product purity and uniformity are assured, batch after batch. In addition, special ultra-pure products are available as "reference standards:" We stand ready to serve you as a reliable, confidential and experienced supplier for your specialty chemical needs. PFANSTIEHL LABORATORIES, INC. ~ The Source torCarbohydrate Chemistry 1219 GLEN ROCK AVENUE ~ WAUKEGAN, IL 60085-0439 Tel,: 3121623-0370 ~ (After Nov. 1989: Area Code 708) ~ FAX: 312/623-9173 TELEX: 25-3fl72 PFANLAE ~ Send me: O New Capabilities Brochure I ~ Product Catalog ~ ~ Gall us to discuss a project. ~ Area Code / C." ~ NAME ~ I TITLE I FIRM ~ ADDRESS w ciTV I I L STATE ZLP 50_W Circle No. 252 on Readers' Service Card il r
Page 56: brs52e00
I engrneered crops has been Iess controversial than the introduction of other recombinant organisms into the environment. In the last 3 years there have been over a dozen tests of engineered crops in diverse locations across the United States (72)-by year end there will be over 30 such tests. All of these tests have been reviewed in detail by the USDA, with input from the other government agencies. The key consideration in approval of these tests has been a scientific evaluation of the risk and environmental impact of a particular field test experiment. Several studies and discussions of the issues and perceptions that surround the release of genetically engineered crops have produced a consensus that such engineered crops present virtually no direct risk to human or animal health (73). The specific knowledge of the introduced DNA sequences, the detailed understanding of the known functions of the gene prod- ucts, and the high level of biological or physical containment were cited as key reasons for the inherent low risk to human and animal health. The "success" of such small field tests, while important, has overshadowed other needs in the regulatory process. For example, many unanswered questions remain regarding the cost and regula- tory requirements for large-scale multisite field tests. It is important that an approval process be developed to accommodate the rapid transition that will occur as testing of engineered crops goes from small, isolated field plots to large-scale, multisite testing; the devel- opment of genetically engineered crop varieties and hybrids will ultimately occur in the fields around the world-not in the research laboratory. The mechanism for FDA or EPA approval or endorse- ment of genetically engineered plants and food products remains undefined. Issues such as regulatory requirements, registration costs, and commercialization timelines are already becoming signifi- cant issues for companies attempting to develop improved genetical- ly engineered crops for the mid-1990s. Several groups (74), such as the International Food Biotechnology Council (IFBC) and the Federation of American Scientists for Experimental Biology (FA- SEB) expert panel on criteria for determining the regulatory status of food and food ingredients produced by new technologies, consisting of academic scientists and representatives of major food, chemical, biotechnology, and seed companies, are working with government agencies to develop appropriate registration guidelines. The regulation of transgenic plants must be based on scientific principles that (i) meet the general public's need for a safe and reasonably priced food supply and (ii) recognize the inherent low risk of gene transfer technology and the benefits afforded by genetically engineered crops to growers, food processors, and consumers. Proprietary protection. Patent protection for genetically engineered plants is considered essential to offset the cost of developing crops with significant new traits. The Supreme Court decision in Dia- mond v. Chakrabarty (75) ruled that microorganisms were not unpatentable simply because they were living cells, and in 1985, the U.S. Board of Patent Appeals and Interferences ruled specifically that whole plants were patentable (76). Numerous companies have since filed patent applications that cover the genes, the processes of isolating genes, and making the genetically modified plants and seeds themselves. Patent protection provides a broader proprietary right than is provided under either the International Union for the Protection of New Varieties of Plants (UPOV) or the U.S. Plant Variety Protection Act (PVPA). The scope of the proprietary right of a patent on a plant is broadened by the absence of the "experi- mental use" exceptions found in protection afforded by plant varietal certification status. Although no one disputes that companies that have invested heavily in R&D to isolate, test, and commercialize genes are entitled to protection for their inventions, there is considerable debate within the seed industry concerning how much protection is deserved and what impact patents will have on the cooperative nature of the seed industny itself (77). The concern has been voiced that patents on plants will favor large seed companies and reduce the overall number of companies. In contrast, while there were three private soybean seed companies before PVPA, now there are more than 40; patenting plants will likely create further incentive to invest in the seed industry in order to position it to meet the technological challenges and supply needs of the future. Much of this debate results from confusion surrounding the restrictions imposed by patent rights versus the incentive they provide for the competitive research and product development that stimulates inno- vation. Many of the conciliatory proposals, including patenting of genes (but not plants) and compulsory licensing in the event that plant patenting is permitted, if implemented, could significantly reduce the incentive for private industry funding in this field. Lack of proprietary protection for genetically engineered plants outside the United States remains a serious limitation; plant and animal varieties are largely excluded from patent protection by European countries that signed the 1973 European Patent Conven- tion. At this time only specific processes can be patented. The European Patent Office (EPO) is currently readdressing the patent- ing of plants and animals, but this seems certain to be appealed and it may be several years before the situation is clear, and only then will ~ Fig. 2. Virus-resistant plants. (A) Greenhouse evaluation of tomato plants containing the TMV coat protein gene. Tomato cotyledons were trans- formed (83) with an Agrobacterium strain containing a TMV coat protein cDNA chimeric gene (51). Transgenic regenerates were screened for coat protein production by immunoblot analysis. The Ri progeny of a repre- sentative plant that expressed high levels of coat protein were anlayzed for virus resistance after inoculation with TMV. The control plant on the left is a segregant that lacks the TMV coat protein gene; the plant on the right has inherited the gene. (B) Field test (1988) of tomato plants containing TMV coat protein gene. Control and transgenic tomato seedlings were grown in a greenhouse and transplanted 6 weeks later to the field test site located in Jersey County, Illinois. The control (left) and engineered (right) plants were inoculated with the PV230 strain of TMV (10 µg/ml) 2 weeks after planting, and the photo was taken 4 weeks later. The fruit yield on the control plants was 19.6 kg per plot compared to 62.4 kg per plot for the engineered plants; the yield of the inoculated engineered plants was equiva- lent to that of noninoculated plants. I 16 JUNE 1989 ARTICLES 1297
Page 57: brs52e00
48. C. D. Rasmussen et al., Methods Enzymo(. 139, 642 (1987). 49. K. I. Bems et al., Replication of Parvovinues (Raven, New York, 1985). 50. B. Roizman and W. Batterson, in Virology, B. N. Fields, Ed. (Raven, New York, 1985), pp. 497-526. 51. R. C. Desrosiers et al., Mol. Cell. Biol. 5, 2796 (1985). 52. M.-F. Shih, M. Arsenakis, P. Tiollais, B. Roizman, Proc. Natl. Acad. Sa. U.S.A. 81, 5867 (1984). 53. E. S. Mocarski, W. C. Manning, J. M. Cherrington, in Viral Vectors, Y. Gluzman and S. H. Hughes, Eds, (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988), pp. 78-84. 54. R. F. Margolskee, P. Kavathas, P. Berg, Mol. Cell Biol. 8, 2837 (1988). 55. L. E. Post and D. R. Thomsen, in Viral Vectors, Y. Gluzman and S. H. Hughes, Eds. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988), pp. 73- 77. 56. T. D. Palella et a/., :4fol. Cell. Biol. 8, 457 (1988). 57. A. I. Geller and X. O. Breakefield, Science 241, 1667 (1988). 58. A. D. Miller et al., ibid. 225, 630 (1984). 59. J. E. Dick et al., Cell 42, 71 (1985). 60. D. A. Williams et al., Proc. Natl. Acad. Sci. U.S.A, 83, 2566 (1986). 61. G. Keller and E. F. Wagner, Cold Spring Harbor Symp. Quant. Biol. 51, 1053 (1986). 62. M. A. Eglitis et a/., Ciba Found. Symp. 130, 229 (1987). 63. R. B. Stead, W. W. Kwok, R. Storb, A. D. Miller, Blood 71, 742 (1988). 64. W. Gi'. Kwok et al., Pioc. Natl. Acad. Sa. U.S.A. 83, 4552 (1986). 65. E. Linney, B. Davis, J. Cverhauscr, E. Chao, H. Fan, Nature 308,'470 (1984). 66. B. Sdiger et ai., Mol. Cell. Biol, 6, 286 (1986). 67. M. Taketo and M. Tanaka, Proc. Natl. Acad. Sa. U.S.A. 84, 3748 (1987). 68. B. C. Guild et al., J. Virol. 62, 3795 (1988). 69. F. Fujimura, P. Deininger, T. Friedmann, E. Linney, Cell 23, 809 (1981). 70. P. W. Kantoff et a/., Annu. Rev, Immunol. 6, 581 (1988). 71. R. S. Mclvor et al., MoL Cell. Biol. 7, 838 (1987). 72. M. C. Dinauer and S. H. Orkin, Hematol. Oncol. Clin. North Am. 2, 225 (1988). 73. J. Sorge et al., Cold Spring Harbor Symp. Quant. Biol. 51, 1041 (1986). 74. M. L. Market et al., J. Clin. Immunol. 7, 389 (1987). 75. F. Costantini, K. Chada, J. Magram, Science 233, 1192 (1986). 76. F. Grosveld, G. B. van Asscndelfr, D. R. Greaves, G. Kollias, Cell 51,975 (1987). 77. C. T. Noguchi et al., N. Engl. J. Med. 318, 96 (1988). 78. J. A. Wolff et al., Pror. Natl. Acad. Sa. U.S.A. 84, 3344 (1987). 79. A. Mivanohara et al., ibid. 85, 6538 (1988). 80. J. M. Wilson, D. E. Johnston, D. M. Jefferson, R. C. Mulligan, ibid., p. 4421. 81. F. D. Ledlcy, G. J. Darlington, T. Hahn, S. L. C. Woo, ibid. 84, 5335 (1987). 82. F. D. Ledley, H. E. Grenett, D. P. Bartos, S. L. Woo, Genomics 61, 113 (1987). 83. H. Peng et al., Proc. Natl. Acad. Sci. U.S.A. 85, 8146 (1988). 84. A- A. Demetriou et al., Science 233, 1190 (1986). 85. S. Gupta et al., Pathology 19, 28 (1987). 86. J. E. Seegmiller, F. M. Rosenbloom, W. N. Kelley, Science 155, 1682 (1967). 87. D. J. Jolly et al., Proc. Natl. Acad. Sa, U.S.A. 80, 477 (1983). 88. K. Sakimura, E. Kushiya, Y. Takahashi, Y. Suzuki, Gene 60, 103 (1987). 89. R. C. Willis et al., J. Biol. Chem. 259, 7842 (1984). 90. F. H. Gage et al., Neuroscience 23, 795 (1987). 91. M. B. Rosenberg et al., Science 242, 1575 (1988). 92. Ad Hoc Working Group on Nerve Growth Factor and Alzheimer's Disease, Science 243, 11 (1988). 93. A. G. Knudson, Jr., Annu. Rev. Genet. 20, 231 (1986). 94. H.-J. S. Haung et al., Science 242, 1563 (1988). 95. R. D. Palmiter et al., Cell 50, 435 (1987). 96. E. Borrelli et al., Proc. Natl. Acad. Sci. U.S.A. 85, 7572 (1988). 97. S. B. Howell et al., Mol. Biol. Med. 4, 157 (1987). 98. D. M. Tidd et al., Anticancer Dntg Des. 3, 117 (1988). 99. O. Shohat et al., Oncogene 1, 243 (1987). 100. C. Paoletti, Anticancer Dntg Des. 2, 325 (1988). 101. R. Khokha and D. T. Denhardt, Anticancer Res. 7, 653 (1987). 102. R. Y. To, S. C. Booth, P. E. Nciman, Mol. Cell. Biol. 6, 4758 (1986). 103. C. C. Smith, L. Aurelian, M. P. Rcddy, P. S. Miller, P. O. P. Ts'o, Proc. Natl. Acad. Sci. U.S.A. 83, 2787 (1986). 104. R. F. Selden et al., N. Engl. J. Med. 317, 1067 (1987). 105. F. D. Ledley and S. L. Wood, J. Inherited Metab. Dis. 9(suppl. 1) 85 (1989). 106. D. St. Louis and I. M. Verma, Proc. Natl. Acad. Sci. U.S.A. 85, 3150 (1988). 107. C. Nicolau et al., ibid. 80, 1068 (1983). 108. P. Soriano et al., ibid. p. 7128. 109. Y. Kaneda, K. Iwai, T. Uchida, Science 243, 375 (1989). 110. L. Walters, Nature 320, 225 (1986). 111. J. C. Fletcher, J. Med. Philos. 10, 293 (1985). 112. C. Grobstein and M. Flower, Hastiqqs Cent. Rep. 14, 13 (1984). 113. L. Walters, report to the Biomedical Ethics Advisory Committee of the congres- sional Biomedical Ethics Board, Washington, DC, February 1989. A listing of policy statements on human gene therapy is available through the National Reference Center for Bioethics Literature at the Kennedy Institute of Ethics, Georgetown University, Washington, DC. 114J. Rilkin, Declaration of a Heretic (Routledge & Kegan Paul, Boston, 1985). 115. Fed. Regist. 54 (no. 47), 10508 (13Iv1arch 1989). 116. H. Miller, personal communication. 117. I thank the many colleagues in my laboratory for their critical and helpful readings of this review. Genetic Engineering of Livestock VERNON G. PURSEL, CARL A. PINKERT,* KURT F. MILLER,t DOUGLAS J. BOLT, ROGER G. CAMPBELL,$ RICHARD D. PALMITER, RALPH L. BRINSTER,§ ROBERT E. HAMMERI I Genetic engineering of livestock is expected to have a major effect on the agricultural industry. However, accu- rate assessment of the consequences of transgene expres- sion is impossible without multigenerational studies. A systematic study of the beneficial and adverse conse- quences of long-term elevations in the plasma levels of bovine growth hormone (bGH) was conducted on two lines of transgenic pigs. Two successive generations of pigs expressing the bGH gene showed significant im- provements in both daily weight gain and feed efficiency T HE ABILITY TO INTRODUCE NEW GENES INTO THE GERM line of an animal and thereby produce proteins outside their normal environment and separated from their usual physio- logical control mechanism has been extremely valuable for studying and exhibited changes in carcass composition that includ- ed a marked reduction in subcutaneous fat. However, long-term elevation of bGH was generally detrimental to health: the pigs had a high incidence of gastric ulcers, arthritis, cardiomegaly, dermatitis, and renal disease. The ability to produce pigs exhibiting only the beneficial, growth-promoting effects of growth hormone by a trans- genic approach may require better control of transgene expression, a different genetic background, or a modified husbandry regimen. numerous aspects of gene expression as well as other questions in biology (1). Most investigations of gene expression in animals have utilized the mouse as an experimental animal. However, gene transfer has recently been extended to domestic animals (Table 1). t 16 JUNE 1989 ARTICLES I28I
Page 58: brs52e00
lin levels: transgenic, 480 ± I I8 pg/mI, n = 10; control, 24 ± 4 pg/ ml, n = 10; P = 0.001]. A s'unilar degree of hyperglycemia, but less pronounced hyperinsulinemia, was observed in pigs injected with pGH (34, 35). Similarly, one transgenic pig expressing rGH had severe hyperglycemia with glucosuria (19). Several of the most prevalent health problems of the hGH and bGH transgenic pigs are widespread in the general swine popula- tion, although at a lower frequency and with less severity. Necropsy surveys conducted on market hogs at slaughter indicate that 10 to 30% have gastric ulcers (35), 30 to 80% have lesions typical of enzootic pneumonia (36), and up to 90% have osteochondrosis (37), which leads to synovitis and degenerative joint disease, the major cause of lameness in breeding-age swine. Growth Performance Many transgenic mice that express MTrGH, MThGH, or MTbGH genes grow at four times the rate of growth of control mice during the maximum growth phase (4, 6, 8). These results coupled with the observation that injections of pGH into pigs stimulate growth and improve feed efficiency suggested that expres- sion of GH transgenes would also improve growth in pigs (38). This expectation, however, was not realized in the founder population of MThGH pigs (13) or MTbGH pigs (Table 6). Single pigs express- ing rGH or pGH showed increased growth (18, 19); however, one must be cautious in not overinterpreting the significance of single- animal observations because daily weight gains in both transgenic and control animals have differed from the mean by as much as 30%. Although the lack of a dramatic growth effect in hGH and bGH founder animals was surprising, we believed it was possible that bGH transgenics might respond with enhanced growth perform- ance if the protein, and particularly the lysine, content of the diet was elevated to levels that conform to those used in recent studies with exogenous pGH administration in pigs (39). To systematically assess growth of transgenic pigs, we measured the average daily weight gain and the feed efficiency of animals from two successive generations of transgenic and control littermates of line 37-06 and the G2 generation of line 31-04 (Table 6). When G2 progeny of line 37-06 were placed on a diet with elevated crude protein and additional lysine, transgenic animals grew 15% faster than littermate controls. In combined growth data from G2 and G3 progeny, transgenic animals grew 11% faster than control siblings (P = 0.002). Similarly, G2 progeny from line 31-04 gained weight 14% faster than control siblings, but this difference was not significant. Perhaps the fact that this line of pigs had much higher levels of circulating GH (Table 4) adversely influenced the relation- ship of the beneficial to detrimental effects of GH. One of the detrimental effects is a suppression of appetite. In pigs injected with pGH, feed intake was suppressed between 14 and 17% when compared to controls (34, 39). In comparison to littermate controls, the feed intake of founder bGH pigs was depressed 20% and, in G2 progeny of line 37-06 that were given ad libitum feed, intake was depressed 17%. Therefore, depression of appetite limits the avail- ability of essential nutrients for accretion of tissues, and, as a consequence, low feed intake prevents pigs with GH transgenes and pigs injected with pGH from attaining their maximum genetic potential for growth rate. Although the founder group of expressing MTbGH pigs did not exhibit increased daily weight gain, they were 16% more efficient at converting feed into body weight than controls (Table 6). The G2 generation of line 37-06 was 18% more efficient than control siblings. Similar improvements in feed efficiency have been reported for pigs injected with exogenous pGH (34, 39). Because feed T9bie 4. Plasma bGH in successive generations from two lines of transgenic pigs. Two founder (GO) MTbGH animal's, lines 31-04 and 37-06 (Table 3), sired transgenic progeny (G1, G2, and G3) that were identified by DNA dot hybridization to nucleic acids isolated from tail samples. In both lines, the foreign genes were inherited as an autosomal dominant trait. The bGH levels were measured in plasma samples by radioimmunoassay (see Table 2). Values are means ± SEM; NA, not assayed. In control pigs pGH levels are 9.7 ± 2.7 ng/ml (mean ± SEM, n = 64) for pigs between 7 and 30 days of age and 2.9 ± 0.3 ng/ml (n = 117) for pigs between 90 and 120 days of age. G i Plasma bGH (ng/ml) enerat on Line 31-04 Line 37-06 GO 1345 t 114 (1, 22)* 45 t 4 (1, 19) G1 1318 ± 88 (2, 34) 139 ± 25 (6, 60) G2 1217 ± 134 (21, 29) 63 ± 9(11, 43) G3 NA 94 ± 13 (28, 45) *(Total number of pigs, total number of samples). constitutes 60 to 70% of the noncapitalized cost of pig production, a 15% improvement in feed efficiency has the potential for an enormous impact if this technology becomes practical. We also evaluated the effects of long-term exposure to elevated GH on visceral and skeletal growth. In transgenic pigs of line 37-06, the liver, heart, kidney, adrenal glands, and thyroid were significant- ly larger than in sibling controls (Table 7). Even more pronounced selective visceromegaly has been noted in transgenic mice expressing foreign GH (4, 30, 40). In addition to exhibiting a selective increase in organ weight, MTbGH animals from line 37-06 also had increased long bone weight and circumference (Table 8). In con- trast, linear long bone growth was similar to that of sibling controls. These observations contrast with those made on a single transgenic boar expressing the MLVrGH gene. In this animal, the linear bone growth of fore and hind limbs was greater than for littermate controls (19). Reasons for this may be related to the nature of rGH function in pigs or the fact that only one animal was studied. The presence of high levels of GH in the plasma of MThGH (14) and MThGH transgenic pigs prevented subcutaneous fat accretion and enhanced the utilization of nutrients for other carcass compo- nents. Mean back fat thickness at the tenth rib of eight G1 and G2 bGH transgenic pigs from line 31-04 was 7.5 ± 2.3 mm, whereas for eight littermate controls the thickness averaged 21 ± 1.7 mm (mean ± SEM). This measurement is an underestimate of subcuta- neous fat because it is a reflection of both skin thickness and subcutaneous fat over the loin. This dramatic difference is evident on a cross section through the loin of a transgenic and sibling control (Fig. 1). The decrease in carcass fat is of considerable importance in the production of leaner meat. Conclusions and Prospects Although we have been able to stimulate pig growth and enhance food conversion to protein, it is clear that detrimental effects on the general health of the pigs were also observed. It is also clear that multigenerational studies are essential to evaluate the physiological effects of transgenes specifically in pigs and perhaps in all livestock animals. These factors, coupled with the long reproductive interval in some of these species, will pose an obstacle to the rapid introduction of transgenic animals into the general agricultural community. However, several aspects of our study suggest avenues for improvement. Growth control is a complicated process governed by a number of hormones acting on a background of - -nes that are largely unknown. The hormones and other gene pro,..Icts that are rate-limiting for growth are not necessarily the same from one I 16 JU24E 1989 2047651949 ARTICLES I285
Page 59: brs52e00
_________ - -- 1 -- __________
Page 60: brs52e00
Transgcnic tomato, tobacco, and cotton planrs containing the B.t, gene e~iibited tolerance to caterpillar pests in laboratory tests (48). The level of insect control observed in the field tests with tobacco and tomato plants has been excellent; in one such test tomato plants containing the B.t. gene suffered no agronomic damage under conditions that led to total defoliation of control plants (49). The excellent insect control observed under field conditions indicates that this technology may have commercial application in the near future. Early market opportunities for caterpillar resistance are leafy vegetable crops, cotton, and corn. Crop targets for beetle resistance are potato and cotton. Other types of insecticidal mole cules are necessary to extend biotechnology approaches for control- ling additional insect pests in these and other target crops. Plants genetically engineered to express a proteinase inhibitor gene are partially resistant to tobacco budworm in laboratory experiments (50); field tests will be necessary to determine the agronomic utility of this approach. Disease resistance. Significant resistance to tobacco mosaic virus (TMV) infection, termed "coat protein-mediated protection," has been achieved by expressing only the coat protein gene of TMV in transgenic plants (51). This approach produced similar results in transgenic tomato, tobacco, and potato plants against a broad spectrum of plant viruses, including alfalfa mosaic virus, cucumber mosaic virus, potato virus X, and potato virus Y (52). One mecha- nism of coat protein-mediated cross protection appears to involve interference with the uncoating of virus particles in cells before translation and replication (53). Transgenic tomatoes carrying the TMV coat protein gene have been evaluated in greenhouse and field tests and shown to be highly resistant to viral infection (Fig. 2) (54). The transgenic plants showed no yield loss after virus inoculation, whereas the yield was reduced 23% to 69% in control plants. The level of capsid protein in the engineered plants [typically 0.01% to 0.5% of the total protein (52)] is well below the levels found in plants infected with this endemic virus. This fact should facilitate registration and commer- cialization of virus-resistant plants. Virus resistance could provide significant yield protection in important crops such as vegetables, corll, wheat, rice, and soybean. While limited success in engineering resistance to fungal diseases has been reported (55), genetically engineered resistance to fungal pathogens and to bacteria remains in the early research stages. Key Advances in Expression and Gene Isolation Technology Dramatic progress has been made in our understanding of and ability to alter the regulation of gene expression in plants and in techniques for the identification and isolation of genes of interest. In many cases, this progress has been facilitated by the availability of efficient gene transfer systems. The engineered plants discussed in the previous section generally depend on the use of continuously expressed promoters driving dominant single gene traits. Future plant genetic engineering will probably include alteration of traits that require subtle temporal and spatial regulation of gene expres- sion and introduction or alteration of entire biosynthetic pathways. Regulated gene expression. Genes that show precise temporal and spatial regulation in leaves (56), floral organs (57), seeds (58), and other plant organs have now been identified and isolated from a number of species of higher plants (59). Within the next few years, genetic engineers will have in hand a large battery of regulatory sequences that will allow for accurate targeting of gene expression to specific tissues within transgenic plants. In addition, a number of genes that respond to external influences, such as heat shock, anaerobiosis, wounding, nutrients, and applied phytohormones, have been isolated and characterized (60). The control regions of these genes may also find utility in genetic engineering strategies. The ability to decrease the expression of a gene in a transgenic plant also has potential utility in the study of plant gene expression and function as well as in crop improvement. Significant successes have already been achieved with genes that produce antisense RNAs to the messengers for polygalacruronase in tomato fruits (61) and chalcone synthase in petunia and tobacco plants (62). In all of these studies, substantial reductions (up to 90%) in the levels of the mRNA and protein products of the target genes were observed. Striking phenotypic alterations were observed in some of these transgenic plants (62). This method of constructing mutant pheno- types will significantly enhance biochemical and physiological stud- ies on protein and enzyme function. In an alternative approach to reducing expression of a gene, the enzymatic regions derived from self-splicing RNA molecules are used to design RNA enzymes capable of specific RNA cleavage (63). In vitro studies have demonstrated the potential of this method, but it has yet to be applied in plants (63). Prelimulary work on insertion of donor DNA into plant chromosomes by homologous recombination (64) indi- cates that it may also be possible to use this approach for the selective inactivation of a gene. Gene tagging. Advances in methods for Lhe identification and isolation of new gene coding sequences are of great importance to the engineering of improved plants. The cloning of transposon sequences has allowed the isolation of genes from several species by transposon-mediated gene tagging (65). The demonstration that mobile elements isolated from maize are able to transpose when introduced into dicot species (66) indicates that this powerful technique is applicable to any plant species for which transformation is possible. It has also been shown that under appropriate transfor- mation conditions, the T-DNA of a plant transformation vector can itself serve as an insertional mutagen (67). Gene mapping. Major efforts have been mounted to obtain high- resolution restriction fragment length polymorphism (RFLP) ge- netic maps in a number of plant species (68). The availability of such a map in tomato has already led to the resolution of several loci affecting quantitative quality traits (69). The RFLP mapping tech- nique will be especially powerful in Arabidopsis, where the small genome size and lack of significant repetitive sequences (70) will simplify the process of genome "vallcing" from an RFLP marker to a closely linked gene. The availability of Arabidopsis genomic libraries in cosmids, which can also act as plant transformation plasmids (71), will allow direct testing of the isolated DNA for its ability to complement the mutation of interest at each step of the walking process. In addition, such libraries may be used in large-scale transformation experiments to directly rescue genes by complement- ing mutants with a selectable phenotype (71). Key Issues Affecting Introduction of Genetically Engineered Plants The advances in crop improvement by genetic engineering have occurred so rapidly that the initial introduction of these crops in the marketplace will be primarily influenced by nontechnical issues. These issues include regulatory approval, proprietary protection, and public perception. Regulatory approval. In the United States, genetically engineered plants potentially come under the statutory jurisdiction of three federal agencies: the United States Department of Agriculture (USDA), Food and Drug Administration (FDA), and Environmen- tal Protection Agency (EPA). The field testing of genetically 1296 2 0 47 0 519 6 0 SCIENCE, VOL. 244
Page 61: brs52e00
r Hreakthrauc3h in Rt3A 1solatiafr'Cechnology A second generation of our proprietary technology (U.S. Patent) for rapid isolation of pure undegraded total RNA from tissues and cells of human, animal, plant and bacterial origin. Q~ RNA isoiatiorr.in 9a minutes : fd No uftracentrifugatiorr requiredL 19 Simultaneous processing of a large number of samples ISOLATION PROTOCOL • Sample homogenization • Liquid phase separation • RNA precipitation and wash with ethanol • The RNAzoI method is being used successfully in leading laboratories of the United States, Europe and Japan providing consistently high yield and purity of RNA preparations. • Isolated RNA is ready for Northern blotting, dot blot hybridization, molecular cloning, in vitro translation, PCR, S1 protection and other enzymatic assays. RNAzo[TS ~ ~ I IIII (~ t ~ REF,11 TM Computerizes your REFERENCES and prepares your BIBLIOGRAPHIES E Maintains a data base of references .- Searches for any combination of authors, years of publication, reference title, publication title, keywords or abstract :- Formats bibliographies exactly as you want them = Reads your paper, inserts citations into the paper, and prepares a bibliography of the references cited (optional) = Downloads references from MedLine data bases such as NLM, BRS and DIALOG (optional) IBM PC/XT/AT, MS-DOS, CP/M 80 .. 11951, RT-11, TSX-Plus, RSX-11, P/OS ...... $25000 VAX/VMS (native mode) ............ $35000 ORDERING- INFORMATiON Product RNAzoI'" Cat. No. CS-101 CS-102 Size 100 ml 200 ml RNAzoI'"B CS-104 100 ml CS-105 200 ml CINNA/BIOTECX INTERNATIONAL INC. P O. BOX 1421, FRIENDSWOOD. TEXAS 7,7546. U.S.A (713) 482-2672 • TOLL FREE (900) 631-0600 TELEX (ITT) 4998324 ITDI UI • FAX: (713) 482-1070 Circle No. 246 on Readers' Service Card ANY MANUAL $1500 b DEMO 52000 322 Prospect Ave., Hartford, CT 06106 (203) 247-8500 Connect cut iesidents add 7va % sales tax. Circle No. 31 on Readers' Service Card Monoclonal Antibodies to Protein Kinase C Isozymes TynQj('Y) Typeil(P) Tynei11(a) Novel monoclonal antibodies to 3 types of isozymes, MC-la, MC-2a, and MC-3a which recognize respective isozyme were developed with protein kinase C purified from rabbit brain by affinity chromatography using protein kinase inhibitor H-9. RELATED PRODUCTS Protein Kinase Myosin Light Protein Kinase C Inhibitors Chain Kinase Activators Inhibitors H-7, H-8, H-9, HA1004 ML-7, ML-9 SC-9, SC-10 FOR RESEARCH USE ONLY. NOT FOR DRUG OR OTHER USE. SEIKAGAKU AMERICA, INC. P.O. Box 21517 Toll free: (800) 237-4512 9049 4th Street North Telex: 52-9422 SKKSTB St. Petersburg, FL 33702 Fax: (813) 576-1870 SEIKAGAKU KOGYO CO., LTD. Tokyo Yakugyo Bldg. 1-5, Nihonbashi-Honcho 2-Chome Chuo-ku, Tokyo, 103 Japan ~ Tel: (03) 245-1951 Telex: SKK J27140 Fax: 03(242)5335 Q Circle No. 233 on Readers' Service Card
Page 62: brs52e00
I begin the wave of oppositions, appeals, and infringement actions tr'iathave macked the early phannaceutical patents in the biotechnol- ogy area (78). Enforceability of plant patents in other countries, including Japan, China, and Eastern Bloc countries, is questionable. While there are numerous initiatives to harmonize both registration and proprietary protection throughout the key trading countries in the world, the outcome is not imminent and will be unlikely to have an impact on first-generation products. Public perception. Genetically engineered crops are being developed at a time when a lack of understanding regarding the importance of agricultural research exists. Current issues, including concerns about (i) periodic, temporary production surpluses, (ii) changing farm infrastructure, (iii) inconsistency in farm policies, and (iv) a general distrust for new technologies, have at times overshadowed the long- term need for the provision of economical, high-quality food products for a growing world population. Currently, at the begin- ning of the 1989 cropping season, world reserves of grain are at their lowest level since the years immediately following World War II; another drought in 1989 could create a world food emergency (79). Despite this background, recent polls conducted by the Office of Technology Assessment indicate that most people believe that the benefits of agricultural biotechnology research outweigh remote risks (72). In view of the initial public debate that has occurred over the last several years on field testing and environmental release of genetically engineered organisms, it would seem that agricultural biotechnology has indeed passed its first major public perception obstacle. The next test of the public acceptance of this technology will come in several years when food products derived from genetically engineered crops enter the general food supply. The current focus on issues of risk and environmental release has heightened the need for increased science education and open discussion of issues. It is essential that the safety and benefits of agricultural biotechnology research and the critical role that it will play in providing for world food demand (80) be communicated and understood, so that informed decisions by the public are possible. A Future Perspective on Genetically Engineered Plants During the last 5 years, the availability of gene transfer systems has catalyzed a major refocusing on plants as a biological system; the use of genetically engineered plants as an analytical tool to explore unique aspects of gene regulation and development and the poten- tial to produce novel commercial crop varieties has created a high level of scientific excitement and has driven research into many new areas. The breadth of information to be gained from the study of transgenic plants is serving as an important focus for unifying basic plant science research in plant breeding, pathology, biochemistry, and physiology with molecular biology. Regulation of gene expres- sion is the fundamental basis for manipulating cellular metabolism, and this new research tool offers the possibility of extending physiological and genetic observations to a mechanistic level. In the next few years we can expect to see major advances in our understanding of basic plant processes. These advances, in turn, will accelerate the application of geneti- cally engineered plants in the seed production and agrichemical industries. The major crops that can currently be improved with genetic techniques are soybean, cotton, rice, and alfalfa (Table 1), and commercial introductions of genetically engineered varieties are likely in the mid-1990s. Rapid progress is being made in the genetic engineering of corn, and it is likely that genetically engineered corn i298 hybrids carrying traits for resistance to herbicides, insects, and viral diseases will reach the marketplace by the year 2000. The timing of commercialization of genetically engineered crops is ultimately determined by the need to address each of the following issues: (i) evaluation of field performance, (ii) breeding and seed increase for commercial-scale release, (iii) establishment of optimal agronomic practices, and (iv) regulatory approval and crop certification. The worldwide agrichemical industry has been and will continue to be a leading sponsor of agricultural biotechnology research. All major agrichemical companies have R&D efforts in the area of biotechnology for crop improvement. These companies see oppor- tunities to develop new products and extend the use of existing products, as well as to be positioned at the leading edge of new technologies that may have a significant impact on existing agri- chemical businesses. Genetic engineering of plants also offers exciting opportunities for the food processing industry to develop new products and more cost-effective processes. While many of the early successful examples of genetically engineered plants have focused on agronomic genes, it is possible that the food processing and specialty chemical industries may represent the greatest commercial opportunity for biotechnolo- gy. Examples of such applications include production of (i) larger quantities of starch or specialized starches with various degrees of branching and chain length to improve texture and storage proper- ties, (ii) higher quantities of specific oils or the elimination of particular fatty acids in seed crops, and (iii) proteins with nutrition- ally balanced amino acid composition. The ability to reduce process- ing costs by the elimination of anti-nutritive or off-flavor compo- nents in foods is quite feasible with antisense nucleic acid technolo- gy. The enzymes and genes involved in biosynthesis of coloring materials and flavors are important to the food industry and to the consumer. Studies on the biosynthesis of some of these compounds have been hampered by the low quantities of enzymes present in the producing cells, but new techniques based on gene tagging may overcome these difficulties. Enormous opportunity lies in the successful use of crops for both commodity and specialty chemical products. Plants have traditional- ly been a source of a wide range of polymeric materials. These range from starch and celluloses, which are carbohydrate-based, to polyhy- drocarbons such as rubber and waxes. Many of these polymers have been replaced in the last two to three decades by synthetic materials derived from petroleum-based products. However, the cost, supply, and waste-stream problems often associated with petroleum-based products are issues that are focusing renewed attention on the use of biological polymers. Genetic engineering will significantly enlarge the spectrum and composition of available plant polymers. Plants also offer the potential for production of foreign proteins with various applications to health care. Proteins such as neuropep- tides, blood factors, and growth hormones could be produced in plant seeds, and this may ultimately prove to be an economical means of production. Several mammalian proteins have been pro- duced in genetically engineered plants (81), and expression of pharmaceutical peptides in oilseed rape plants has been reported (82). REFERENCES AND NOTES 1. R. B. Horsch et al., Science 223, 496 (1984); M. De Block, L. Herrera-Estrella, M. Van Montagu, J. Schell, P. Zambryski, EMBOJ. 31, 681 (1984). 2. R. B. Horsch et al., Science 227, 1229 (1985). 3. M.-D. Chilton et al., Cell 11, 263 (1977). 4. E. W. Nester, M. P. Gordon, R. M. Amasino, M. F. Yanofsky, Annu. Rev. Plant Physiol. 35, 387 (1984); G. Gheysen, P. Dhaese, M. Van Montagu, J. Schell, in Genetic Flux in Plants, B. Hohn and E. S. Dennis, Eds. (Springer-Verlag, New York, 1985), pp. 11-47; P. Zambryski, J. Tempe, J. Schell, Cell 56,193 (1989). 5. K. A. Barton et al., Cell 32, 1033 (1983). 204'7651964 SCIENCE, VOL. 244
Page 63: brs52e00
wetl, &urler sat,s. "I have vet to see the kind i vf actimonv Xhat is just endemic to bureau- cracy, although there are tense moments." I-Ie adds: "There is a sense that there is enough work for everybody." A more guarded appraisal is offered by Francis Bretherton, director of the Space Sciences and Engineering Center at the Uni- versitv of Wisconsin at Madison, and one of NASA's chief academic advisers. He points out that NOAA has already declined to join NASA on the first EOS platform scheduled for launch in 1996 because it is concerned about potential delays. NOAA is an opera- tional agency providing regular services to a broad clientele. It takes the position that it cannot risk any gaps in coverage, the kind that it sees in NASA's recent record. NOAA may decide in 1997 to jump aboard a later platform, after the system has proved itself. Meanwhile, the two agencies are designing their instruments and orbit profiles for fiill compatibility. At the top level, Bretherton says, every- one agrees that NOAA is on board the program spiritually if not physicall}'. At the working level, however, one encounters the view that "NOAA has dropped out, so forget 'em." The discrepancy may simply be a problem of poor communication, but Bretherton says it is "very, very important" that it be resolved quickly. Failure to reach agreement would endanger not just the quality of the data bank but the monitoring program itself. It would be fatal for NASA and NOAA to seek duplicate instruments to collect similar atmospheric data. `We could end up with a situation in which neither approach is viable on its own, and yet we've got two separate approaches," Bretherton says. "I'm not sounding any major alarms yet," but he is worried. NASA officials believe these rumblings are normal for a program in the early stages of formation. They are certain that NOAA's special concerns can be accommodated. And they say they have begun to work on the problems of scientific direction raised by Hansen and others. They insist that existing global research projects will not be asked to make sacrifices, but that, on the contrary, thev will benefit because of the increased attention given to the Earth Observing Sys- tem. The test of these commitments and of the government's good faith may come soon. If the existing earth observing projects-such as Landsat and the ocean and weather moni- tors run by NOAA-are not given better support in the next budget than they have received in the past two administrations, promises of future growth in space-based environmental research will be hard to cred- it.  ELIOT MARSHALL German Biotech Firms Flee Regulatory Climate A law that puts roadblocks in the way of new facilities is causing rnany firms to locate production plants overseas; the governrnent has responded with a less onerous proposal Ludwigshafen, West Germany ALFRED VELLVCCI would probably appre- ciate the irony. A decade after the feisty mavor of Cambridge, Massachusetts, fought bitterly-and unsuccessfully-for the right to impose local controls on recombinant DNA research, the West German chemical company BASF has announced plans to open a new biotechnology laboratory in Boston, on Cambridge's very doorstep. The reason: BASF sees the Boston area as a safe haven from the public opposition the pro- ject may face back home. "We were faced with the decision of whether to invest in German}', in order to make biotechnology grow here, or to go to the U.S.," says the company's director of biotechnology research, Rolf-Dieter Acker. `We decided to do both; to develop some biotechnolog}' facilities here, but also to build up a research group in the U.S., just to be on the safe side." BASF's decision to set up shop in Boston, where a group of 60 scientists will eventual- ly work in a brand new research institute on the development of anticancer drugs, fol- lows a similar decision by the Bayer compa- ny. Bayer recently announced plans to open a facility for the production of recombinant Factor VIII in Berkeley, California, rather than closer to its home base of Leverkusen, outside Cologne. These two moves have dramatically brought home to West German politicians the extent to which the country's large chemical companies are finding genetic en- gineering to be a "no go" area at home. Faced with public concerns about both the safetv and ethical aspects of genetic engi- neering, the nation's biotechnology industry has been contending with growing regula- tory problems for several years, which is whv even some politicians are joining Ger- man scientists in warning that something must be done quickly, since many of the best and brightest young molecular biologists are already fleeing the motherland for the Unit- ed States. What drives the corporate leaders to dis- traction is an amendment that was added last September to existing environmental legislation. It requires that proposals for all new production facilities using genetically engineered organisms-whether they are in- herently pathogenic or not-be put to pub- lic debate. That may not seem too onerous, but the problem is that there are few admin- istrative guidelines on how the law should be put into practice, and this has resulted in a kind of regulatory limbo. No new produc- tion facilities have been approved in the 8 months since the amendment was passed. A related and, to the companies, no less dis- turbing aspect of the legislation is its implic- it threat to commercial secrets that they claim are embedded in the requirement for full public disclosure. One consequence of all this is that many companies have put on ice any development plans that include the use of recombinant DNA techniques. Another is that they have "Some people feel that they cannot always trust the scientist. " -Ernst-Giinter Afting virtually stopped recruiting molecular biolo- gy graduates until the situation is clarified. "Students finishing their Ph.D.'s in molecu- lar biology now tend to look to American or Swiss companies [for jobs]. They are voting with their feet," says Hermann Bujard, di- rector of the University of Heidelberg Cen- ter for Molecular Biology. And few U.S. biotechnology companies are w'illing to risk joint ventures (as they have done elsewhere in Europe) in a country where full public discussion of their pro- posed activities is required. Last year, for example, when Genentech set up a Research Institute of Molecular Pathology with the German company Boehringer Ingetheim, the U.S. firm insisted that the new institute be located outside Germany, and a site was found near Vienna. Indeed, "no U.S. com- pany has invested over the past year in anything related to genetic engineering in Germany," says Acker. , 16 JUNE 1989 NEWS & COMMENT 1251
Page 64: brs52e00
augmentation model has received the most attention and has provided some of the most impressive progress in studies of gene therapy models. Gene Transfer by Physical and Chemical Methods Naked functional DNA can be taken up into mammalian cells by a number of physical methods, including coprecipitation with calcium phosphate, the use of polycations or lipids to complex with DNA, or by encapsidation of DNA into liposomes or erythrocyte ghosts (15- 18). Exposure of cells to rapid pulses of high-voltage current (electroporation) (19) and even the introduction of DNA into cells by direct microinjection (20) or on high-velocity tungsten micropro- jectiles (21) also allows effective gene transfer and expression in target cells. A general characteristic of most of these transfection methods is the integration into the genome of multiple tandemly repeated copies of the transgene in a relatively stable form, although some investigators have found that integrated sequences can be highly unstable and can become inactive by a number of genetic and epigenetic mechanisms (22). The efficiency of physical transfection methods in vitro can approach or exceed 1% in suitable recipient cells. Virus Vectors The delivery of nucleic acids into mammalian cells can be made more efficient than permitted by the physical methods through the use of viral vectors capable of infecting virtually every cell in a target population (23). One can imagine many ways in which virus vector infection might damage host cells, including insertion of the vector into an essential gene of the host cell, the activation of a silent proto- oncogene by introduction of viral promoter or enhancer sequences, the activation of latent viruses encoded by the genome, or the rescue of infectious virus from the defective vector by recombination with cellular sequences. For the development of transducing viral vectors, most workers have concentrated on tumor viruses that integrate into host cell genomes and express foreign genes efficiently and stably without harming host cells. The first viruses used as expression vectors or gene transfer vectors for mammalian cells were transform- ing DNA viruses, including the papovaviruses (simian virus 40 and polyoma) and the adenoviruses (23-26). The genomes of these viruses are well understood and are still useful sources of transcrip- tional sequences for the construction of many current vectors, but because their capacity for foreign sequences is small, interest in them has waned as other potential vector systems have been developed. Obviously, such vectors will not be possible for the expression of many other disease-related functions because of the large size of many intact genes and the limitation of retroviral vectors to approximately 7 to 8 kb of added sequence. Recently, the most useful and popular model vectors for the efficient introduction of foreign genes into target mammalian cells have been derived from murine and avian retroviruses. The mecha- nisms of infection, replication, integration, and gene expression from these replication-defecdve vectors have been reviewed else- where (27-30). Although retrovirus vectors are capable of infecting a broad class of cell types, cell replication and DNA synthesis are required for provirus integration; this effectively restricts efficient use of retrovirus vectors to replicating cells. To be useful clinically, retrovirus vectors would have to lead to efficient infection and stable gene expression. High-titer virus should be free of wild-type recombinants and, ideally, be capable of efficient and targeted delivery to specific sites in the genome and to appropriate cells and organs in vivo, Expression and stability. Since the original reports of retrovirus- based vectors and helper cell methods, technical improvements have led to production of more useful vectors. Some of these contain only a single function expressed from the viral long terminal repeat (LTR). To simplify the isolation of suitable producer cells, other retroviral vectors also express a selectable marker, such as the transposon Tn5 phosphotransferase gene, to confer drug resistance to infected cells. In vectors with multiple transcription units, which express one function from the retroviral LTR promoter and another from an internal promoter, the relative position of the promoters expressing these two functions has a strong influence on the efficiency of gene expression and on virus production. Interactions between the promoters can result in marked reduction of the expression of one function as a result of selection for the other, and an upstream LTR promoter can interfere with expression from a downstream internal promoter (31). In a reverse orientation vector expressing the full genomic human (3-globin gene under the control of its own promoter (32), globin gene transcription was efficient and specific in cells of the erythroid cell lineage. A commonly cited advantage of retroviral vectors over other gene transfer tools is the presumed structural and functional stability of the integrated form of the retroviral vector or provirus. Although many retroviral sequences are stable, several studies have indicated that proviruses, like other transgenes, can show high-frequency structural and functional instability (33, 34) and that vector design, the nature of the target cell, the presence or absence of selection pressure, and the nature of the expressed genes can contribute to vector instability by mechanisms still not fully understood. Retroviruses and their vectors are thought to integrate almost entirely into random sites in the cell genome, although some integration at specific preferred sites in the cell genome has been observed (35). Random integration will obviously lead to occasional insertional mutagenesis through the interruption of vital cellular genes or through the insertion of retroviral regulatory sequences that modulate the expression of flanking cellular genes. To avert problems of promoter interference and to reduce the likelihood of insertional mutagenic events, a number of investigators have de- signed retrovirus vectors that are devoid of their own promoter and enhancer sequences and are therefore transcriptionally disabled (36, 37). As expected, such disabled vectors have been shown to express vector-encoded genes exclusively from promoters introduced to- gether with the gene, but so far their use has been limited by their low titers. Vector titer and recombination. The preparation of high-titer retrovi- rus vectors has been aided by the development of efficient helper cell lines (38, 39) and the finding that the retroviral packaging signal required for encapsidation of virus RNA into particles includes a portion of the 5' region of the gag gene in addition to the tr site close to the 5' LTR (40). Nevertheless, it has not been possible to reproducibly achieve retrovirus vector titers greater than approxi- mately 106 infectious units per milliliter, whereas titers 10- to 100- fold higher would be necessary for many in vivo applications. Identification of more efficient helper lines and greater understand- ing of the mechanisms by which producer cells commit themselves either to express or to package provirus transcripts are needed before efficient vector delivery may be possible in vivo. A continuing problem with the use of defective retrovirus vectors has been the eventual appearance of wild-type virus in producer cells, presumably through recombination between the transfected vector plasmid and endogenous retrovirus-like sequences. To reduce the opportunities for recombination, several investigators have produced helper cell lines that express the gag, pol, and env genes I2?6 SCIENCE, VOL. 2¢¢ 204'7651940
Page 65: brs52e00
Thermal Microscope Stage Maintains specimen at any temperature between -20° and + 100°C Fits most standard microscopes Temperature control is automatic AEk M ~ 1.2 ~i 154 HURON AVENUE, CLIFTON NJ 07013, USA • Tel: 201-779-5577 Circle No, 24 on Readers' Service Card FOTO/PREPI. Available only from FOTODYNE...a leader you rely on for innovative advancements in DNA analysis instrumentation. Call 1-800-362-3686 1320 AIDS Drug Research Tools from MGR PR (p15 Protease) RT IN (Reverse Transcriptase) (integration Protein) Critical reagents for the design and screening of drugs for AIDS therapy are available from MGR. Currently the best source for these reagents is avian myeloblastosis virus (AMV) and MGR has years of experience working with AMV. Focus yourAIDS research with dependable products from MGR. For more information, call or write: Molecular Genetic Resources, Inc. 6201 Johns Road #8 Tampa, FL 33634 800-255-8142 813-886-5338 (Florida Residents call collect) Circle No. 162 on Readers' Service Card With Foto/Prep l, you get two transilluminators in one - Analytical and Preparative. FOTO/PREP I is the first innovative transilluminator to offer the sensitivity of 300nm midrange UV, with the kind of protection previously provided only by 366nm UV sources. The key? A unique sensitivity control device. In the analytical mode it provides the nanogram level sensitivity distinguishing all FOTODYNE 300nm DNA transilluminators. Switching to the preparative mode, the gel can be exposed as long as 20 minutes with little or no detectable photonicking damage. Yet, a 2000bp band containing less than 10 nanograms of DNA can be visualized for cutting. FOTO/PREP I comes with a replaceable UV trans- parent protective sheet, so gels can be cut directly on its surface without damaging the UV glass. The molded, UV blocking cover can be raised from 00 to 90° to allow easy access to the gel. For more information call or write. FOTODYNE, Inc. 16700 W. Victor Road New Berlin, Wlsconsin 53151-4131 USA a 414-785-7000 Telex 260127 FAX 414-785-7013 IDIODYNE iNCORPORATED I Circle No. 255 on Readers' Service Card
Page 66: brs52e00
comparison is in terms of absolute frequency of homologous recombination. How many cells were electroporated and how many independent targeting events were recovered? With this criterion for comparison and with allowance for the differing extents of homolo- gy to the target, the results from the different laboratories are in moderate agreement [When targeting vectors containing approxi- mately 2 to 4 kb of hprt homology were used, absolute targeting frequencies in the range of one event per 5 x 107 to 5 x 106 treated cells were reported (3, 8-10)]. Alternatively, it is possible to compare the ratio of homologous recombination events to nonho- mologous recombination events. Unfortunately this ratio is depen- dent on the method used to estimate the frequency of nonhomolo- gous recombination. As an extreme example, if the comparison was made to the transfection efficiency measured with a completely defective selectable gene, this ratio would be infinitely large. Indeed a wide range of ratios have been reported, from 0.001% to greater than 10%. It should also be pointed out that even when the same selectable gene is used, in the same nucleotide environment, mea- surements of both the targeting and random insertion frequency may be less than ideal, since expression of the selectable gene will inevitably be different at the target locus relative to random loci. Thus, the ratio will be dependent on the thresholds set by the selection conditions. Nonselectable Genes The advantages of hprt-its presence as a single copy in male cells and the ability to use direct selection as a way of isolating homolo- gous recombinants-are not the case for most genes of interest. Indirect enrichment or screening procedures must be used to identify the rare ES cell in which a nonselectable gene has been inactivated. A very sensitive screening method makes use of the polymerase chain reaction (PCR) (11) to specifically amplify a novel DNA junction created by the targeting event (12). Two groups have recently reported success using this approach to screen pools of transfectants and detect the rare ES cell in which the targeting event occurred. Joyner et al. have disrupted the homeobox-containing gene en-2 in ES cells by means of a replacement vector in which one of the en-2 exons was interrupted by neo (13). After introducing the Flg. 2. Disruption of hprt by gene targeting with (A) a sequence replacement targeting vector or (B) a sequence insertion target- ing vector. Vectors of both classes contain hprt sequences interrupted in the eighth exon with neo gene. With the sequence • replacement vector, after homologous pairing be- tween the vector and ge- nomic sequences, a recom- bination event replaces the genomic sequence with vector sequences contain- ing neo. Sequence inser- tion vectors are designed such that the ends of the linearized vector lie adja- A Sequence replacement 1 2 3 4 5 6 78 9 hprt} I 1 2 3 I 4 5 I 6 7 /1e0 en-2/neo` targeting vector into ES cells by electroporation and selecting for G418` cells, the authors screened pools of G418` colonies by PCR to specifically amplify the neo-disrupted en-2. They detected approximately one targeting event per 300 G418r colonies. Zimmer and Gruss have disrupted another mouse homeobox- containing gene, hox 1.1 (14). They used a replacement vector in which the homeobox domain carried a 20-bp insert, which disrupt- ed the coding sequence and created a novel hybridization site for one of the PCR primers. The targeting vector was introduced into ES cells by microinjection. Since no selectable marker was used, ES cells in which a targeting event had occurred were identified solely by the presence of a specific PCR product. Only homologous recombination would juxtapose the two PCR primers, one within the targeting vector and the other from flanking hox 1.1 sequences in the endogenous gene. Approximately 1 in 150 cells receiving an injection yielded the predicted amplified PCR fragment. It is also possible to use the cis-acting regulatory sequences of the target gene in order to enrich for successful recombination events. In this case, the targeting vector is designed in such a way that expression of the selectable marker, neo, depends on homologous integration to supply a missing promoter or enhancer, as described by Jasin and Berg (15) as well as Sedivy and Sharp (16). In this way, a several hundredfold enrichment for targeted integrations relative to random insertion of the vector was obtained. This strategy only applies to genes that are expressed in the recipient cell line. The Positive-Negative Selection (PNS) Procedure Recently, we have described an enrichment procedure that is independent of the function of the target gene (17). This procedure uses a positive selection for cells that have incorporated the targeting vector anywhere in the ES cell genome and a negative selection against cells that have randomly integrated the vector. The net effect is to enrich for cells containing the desired targeted mutation. The vector contains 10 to 15 kb of DNA homologous to the target gene, a neo inserted, along with its own strong promoter, into an exon of that sequence; and thymidine kinase gene from herpes simplex virus (HSV-tk) adjacent to the region of homology. This vector was designed so that homologous recombination will 9 1 B 1 2 3 2 3 4 5 4 Sequence insertion 6 7 /7eo hprt G418r I hprt G418r 9 6 78 9 cent to one another on the hprt map. Pairing of such a vector with its results in insertion of the entire vector into the endogenous gene. This genomic homolog, followed by recombination at the double-strand break, produces a duplication of a portion of hprt. 1290 SCIENCE, VOL. 24-¢
Page 67: brs52e00
from separate integrated plasmids (41, 42). Virus titers obtained with these helpers have been reported to be as high as with the more conventional single-plasmid helper lines. Vector targeting. Although highly efficient gene transfer is already a feature of retroviral vectors, it has not been possible to incorporate site specificity of integration. One preliminary but promising ap- proach has been the recent report of restoration of function to a defective neo gene that was integrated in rat cells by infection of the cells with an integration-defective retrovirus vector containing a partially deleted, nonfunctional neo gene (43). The appearance of G418-resistant cells was attributed to homologous recombination between the two different deleted neo genes. It remains to be seen whether efficient site-specific integration is compatible with mecha- nisms of retroviral integration or whether site-specific targeting will require other kinds of vector delivery. Other Virus Vectors Retrovirus vectors are useful for many kinds of in vitro gene transfer studies, but the problem of relatively low titers limits their use for some in vitro and most in vivo studies. Expression vectors derived from viruses such as vaccinia virus (44, 45), adeno-associated virus (AAV) (46, 47), herpesviruses, bovine papilloma virus (48), and others offer features that may make them attractive for some applications of long-term genetic modification of mammalian cells. Human AAV viruses have a number of potential advantages over retrovirus vectors, including the fact that they are ubiquitous in humans and can be concentrated to titers exceeding 109 infectious units per milliliter. They are completely nonpathogenic integrating viruses that require coinfection with helper adenoviruses or herpes- viruses for replication of their 5-kb single-stranded DNA genomes (49). A prototype transducing AAV vector has been shown to express an integrated neo gene stably in human and mouse cells in vitro (46). As is true of other systems (including, to some extent, the retrovirus vectors), there continue to be difficulties with the AAV vector system, including the presence of contaminating cytopathic or pathogenic helper viruses, relatively uncharacterized mechanisms of integration, and a paucity of information on the long-term consequences of integration and gene expression from the integrat- ed AAV provirus. Because of the restriction of retrovirus vectors to replicating cells and the need for high-titer vectors for transduction and expression of foreign sequences in nonreplicating or fully differentiated postmi- totic cells such as neurons, hepatocytes, and other retrovirus- refractory cells, interest is increasing in vectors derived from several classes of nonintegrating viruses, such as the herpesviruses. Portions of their large genomes (150 kb) (50) may be expendable for virus replication and other viral life cycle functions, and they could therefore have much higher capacities for added foreign sequences than most other known vectors; they may also be able to transfer and express large, intact genes. Natural herpes infections often become latent in neural cells, implying that herpes-based vectors that mimic latent infection have the potential for long-term gene expres- sion in neural cells. Expression vectors developed from herpes saimiri (51), herpes simplex virus type-1 (HSV-1) (52), cytomegalovirus (53), Epstein- Barr virus (54), and pseudorabies viruses (55) have been shown to express reporter genes in mammalian cells in vitro. One group has recently used recombination to prepare a vector expressing the human HPRT cDNA and has demonstrated expression of the human gene in HPRT-deficient rat neuroma cells in vitro (56). Since the recombinant vector in this case was replication competent, transgene expression was limited to short periods of time after Fig. 1. Genetic correc- Veetor tion of CNS defects. O ~ Donor eeii m Phenotvpic modification :.y of CNS f'unctions can be produced by implanta- tion of donor cells previ- ously modified geneti- cally in vitro. The new function can then be supplied by cell-cell con- tact or by transport or diffusion to target CNS " Target neuron cells. Alternatively, the gene transfer vector can be introduced into CNS either directlv or through the circulation. infection. Noncytopathic herpes-based vectors can be prepared by several methods, including the use of plasmids containing replica- tion and packaging signals linked to the gene to be expressed, or the introduction of foreign sequences into replication-defective virus mutants by recombination. In either case, preparation of the vectors requires the use of (i) either temperature-sensitive or other condi- tional virus mutants to provide replication and encapsidation func- tions or (ii) nonconditional modified helper viruses and appropriate cell lines that complement the defects of the helper virus. To generate replication-defective vectors that can be maintained free of wild-type virus for prolonged periods of time, other workers have prepared a plasmid-based HSV-1 vector able to express an Fscherich- ia coli (3-galactosidase gene in cultured peripheral and sensory neurons (57). There is little information available on the long-term fate or stability of gene expression from these vectors, on the development of latency in infected cells, on the rescue of latent herpesvirus by exposure to vectors, or other effects of the vector on cells. Nevertheless, these preliminary studies should lead to consid- erable interest in development and further characterization of herpes-based vector systems. In Vivo Delivery and Disease Models Bone marrow. Much of the work in developing techniques for clinically applicable gene transfer has centered around complementa- tion of genetic defects in target cells in vitro followed by the implantation of the resulting genetically modified cells into a suitable organ in vivo (Fig. 1). The target organ for implantation must be the site of relevant disease, easily accessible, manipulable in vitro, susceptible to genetic modification methods, and, ideally, should contain either nonreplicating cells or cycling stem cells to perpetuate a genetic correction. If only differentiated, replicating cells are infected, the newly introduced gene function will be lost as those cells mature and die. Finally, it should be possible to reimplan genetically modified cells into the organism in a functional anc stable form. Because the mammalian bone marrow satisfies all oi these criteria, it has been one of the most attractive organs for earl) studies of gene therapy. Certain cells of the mammalian bone marrow are susceptible to infection with retrovirus vectors, and a number of studies in mice have shown that retrovirally delivered transgenes in infected bone marrow cells in vitro can, under some conditions, restore enzymic activities for months in vivo after repopulation of the bone marrow space (58-61). Evidence that authentic stem cells have been infected with the vectors has come from experiments in which transplanted marrow cells expressing a retrovirally transduced neo gene have been removed from a primary recipient animal and transplanted to 16 JAAIE 1989 ARTICLES 1277
Page 68: brs52e00
48. D. W. Salter, E. J. Smith, S. H. Hughes, S. E. Wright, L. B. Crittenden, Virology 157, 236 (1987). 49. R. A. Bossclman et al., Science 243, 533 (1989). 50. D. W. Salter and L. B. Crittenden, Theor. Appl. Genet., in press. 51. K. Roshlau et al., Arch. Tierz. 31, 3 (1988). 52. Z. Zhu, K..l'u, G. Li, Y. Xie, L. He, Kexue Tongbao 31, 988 (1986). 53. K. Ozato et al., Cell Differ. 19, 237 (1986). 54. D. Chourrout, R. Guyomard, L.-M. Houdebine, Aquaculture 51, 143 (1986). 55. R A. Dunham, J. Eash, J. Askins, T. M. Townes, Trans. Am. Fish. Soc. 116, 87 (1987). 56. G. Breni, B. Brenig, G. Hocrstgen-Schwark, E.-L. ~irmnacker, Aquaculture 68, 209 (1988). 57. T. McEvoy et al., ibid., p. 27. 58. G. W. Stuart, J. V. McMurrav, M. Westerfield, Development 103, 402 (1988). 59. E. J. C. Polge et al., in Bioteclmology of Growth Regulation, R B. Heap et al., Eds. (Butterworth, London, in press). 60. K. L. Knight, H. Spicker-Polet, D. S. Kaydin, V. T. Oi, Proc. Natl. Acad. Sci. U.S.A. 85, 3130 (1988). 61. J. P. Simons et al., Bio/Techrtology 6, 179 (1988). 62. C. E. Rexroad, Jr., et al., bfol. Reprod. Dev. 1, 164 (1989). 63. J. D. Murrav, C. D. Nancarrow, J. T. Marshall, I. G. Hagelton, K. A. Ward, Reprod. Fertii. Dev., in press. 64. R L. Brinster, in Growth, Nutntion and Metabolism of Cells in Culture, G. Rothblat and V. Cristofalo, Eds. (Academic Press, New York, 1972), pp. 251-286. 65. From D. J. Bolt, U.S. Departrnent of Agriculture, Beltsville, MD. 66. D. N. Marple and E. D. Aberle, J. Anim. Sci. 34, 261 (1972). 67. L. A. Frohman and T. R Downs, Methods Enzymol. 124, 371 (1986). 68. R. W. Furlanetto et al., J. Clin. lnvest. 60, 648 (1977). 69. W. H. Daughaday, I. K. Mariz, S. L. Blethen, J. Clin. Endocrinoi. Metab. 51, 781 (1980). 70. Gastric ulceration: focal loss of gastric mucosa with local inflammation in the pars esophagus and variable evidence ofgranulation tissue in healing lesions. Synovitis: inflammation ofjoint synovium, ranging from mild edema with focal aggregates of inflammatory cells to necrosis and ulceration of thickened synovium with erosion of underlying cartilage. Dermatitis: focal perivascular accumulation of inflanuna- tory cells in subcutis and superficial dermis and mild epidermal thickening. Nephritis: mild, multifocal accumulation of lymphorytes in tubulointerstitial space. Pneumonia: inflammation of lung, ranging from mild interstitial accumulation of lymphocytes to multifocal perivascular and peribronchiolar accumulation of lym- phocytes and plasma cells consistent with enzootic pneumonia. Cardiac myocyte nuclear hypertrophy: enlargement of numerous cardiac myocyte nuclei of unknown significance. 71. We thank L. L. Schulmann, M. K. Chandlee, N. J. Faulkner, M. Avarbock, L. Baker, and M. K. Yagle for technical assistance and K. D. Bender, T. E. Clover, J. A. Piatt, and J. E. Stevens for animal care. We acknowledge the assistance of K. E. Mayo and L. A. Frohman in analyzing the GRF pigs; T, J. Van Winkle and D. M. Gillette in performing the necropsies and the histologic work-up; and A. D. Mitchell and M. B. Solomon in evaluating growth performance and carcass composition. We thank R. R. Behringer, C. E. Resroad, Jr., E. P. Sangren, and N. C. Steele for assistance and helpful discussion in preparing the manuscript. Supported by lv'IH research grants (HD-19018) to RL.B. and (HD-09172) to RD.P. Altering the Genome by Homologous Recombination MARIO R. CAPECCHI Homologous recombination between DNA sequences residing in the chromosome and newly introduced, cloned DNA sequences (gene targeting) allows the trans- fer of any modification of the cloned gene into the genome of a living cell. This article discusses the current status of gene targeting with particular emphasis on germ line modification of the mouse genome, and describes the different methods so far employed to identify those rare embryonic stem cells in which the desired targeting event has occurred. T HE IMPLICATIONS OF THE NEW GENE TARGETING TECH- nology are far-reaching. If the recipient cell is a pluripotent, embryo-derived stem (ES) cell, it is possible to transfer a modification of a cloned gene, created in a test tube, to the germ line of a living organism (1-3). The potential now exists for modifying any gene, in a defined manner, in any species from which functional ES cells can be obtained. ES cells have been isolated from mouse and hamster embryos (4) and major efforts are currently under way to isolate equivalent cells from domestic animals including sheep, pigs, and cattle. In addition, because many plant cells are intrinsically pluripotent and the means exist for generating whole plants from The author is associated with the Howard Hughes Medical Institute, Department of Biology, University of Utah, Salt Lake City, UT 84112. these cultured cells, we can anticipate the application of gene targeting to the modification of plant genomes as well (5). The discussion need not, however, be limited to experiments directed only at germ line modifications. In specific cases it may be advantageous to modify only certain somatic tissues of an organism. For example, as the means to propagate a variety of human somatic stem cells (such as hematopoietic, epithelial, liver, or lung stem cells) become available, protocols based on gene targeting could be used to correct defective genes in the appropriate human tissue. This scenario of human somatic gene therapy has some obvious advan- tages over the random insertion of a nondefective gene: for example, the corrected endogenous gene is much more likely to be expressed in the appropriate tissue at appropriate levels. Further, it should be possible to use this approach to correct dominant mutations. In addition to its implication for in vivo manipulations, gene targeting technology has broad potential for fundamental research with cells cultured in vitro. Many biological questions can be answered directly and more simply with tissue culture systems. In such cells, both alleles of an autosomal gene could be modified by the sequential application of gene targeting. Cell-lethal phenotypes could be maintained and analyzed by a variety of techniques, including the introduction of a transgene under the control of an inducible promoter. However, in this article I will emphasize experiments involving mouse embryo-derived stem cells. This choice is based on the interest and potential of using targeted, modified ES cells as a vehicle to generate mice of any desired genotype. Unfortunately, this choice precludes reviewing the gene targeting literature leading SCIENCE, VOL. 2.q-4¢ 1288 204'7851952
Page 69: brs52e00
at 42°C. At a frequench dependent on the stze of Lbe overlap, the colntegrates will Iesolve via a second homologons recombination, and the shuttle plasmid, unable to replicate, will be lost. Resolved F plasmids can be identified by screening for camr tets colonies (this occurred at about 5% for an overlap of 3 kb). If recombination occurs at the original site, it restores the parental wild-tvpe plasmid. If recombination occurs on the opposite side of the deletion, the deletion is transferred to the F plasmid. The two modes of resolu- tion happen at equal frequency if the flanking homologies are of equal size. The resolved plasmids are tested by restriction enzyme digests to determine whether the mutation has been acquired. We have used this strategy to introduce a 5-kb deletion into the large intron of the abdA transcription unit (Fig. 2). The strategy should work equally well to introduce insertions, substitutions, or point mutations. Plasmids that have acquired point mutations can be identified by differential hybridization of an oligonucleotide probe (12) or by denaturing gradient gels (13). We have also used a similar strategy to substitute alternate selectable markers. In this case, the rfsF site is used as one of the segments of homology flanking the "mutated" marker gene. Site- specific recombination catalyzed by the F resolvase is used to accomplish the second recombination event. We have used this procedure to replace the neomycin resistance gene in many of our contructs with either the Alcohol dehydrogenase (14) or the rosy (15) genes. We have also modified a large plasmid to carry the yeast his3 and ura5 genes, a yeast ars, a centromere, and an inverted repeat of a a B - C II. Resolve at 30° C Reverse building ~ to allow recovery /Cointeflrate C1.r of shuttle. A i Site•specific I. Select recombination Resolvase te rates [ 4 g co n e , I C Crossing on mutations t ~ t. ,.._ a r 0 E ..• r cern t t i rfaF III. Use pushout plasmid to select against F plasmids and cointegrates. Pushout plasmid (tet 'and kan rat 30°C)~ ~~ C ~ ImAN•F «+91ro 1. Select for cointegrates (camr and tetr at 42°C) cam Mutant oc F plasmid New shuttle plasmid .-,r e o ntegra II. A11ow co r resolve (camr and tet' at 42°C) yeast relomere. We have transformed this plasmid into yeast and have linearized the molecule to form a linear yeast mini-chromo- some. The marker substitution strategy should facilitate the transfor- mation of large plasmids into other organisms besides yeast and Drosophila. Discussion The procedures described here can be used to construct large, defined clones of DNA in E. coli. Despite their size, the large plasmids are stably maintained and can be easily isolated in a form suitable for reintroduction into many eukaryotic organisms. We have used this building procedure to make numerous large clones of DNA from the bithorax complex of Drosophila, carrying what genetic and molecular analyses suggest are complete functional units. We are beginning to use these constructs to examine the regulation and function of the bithorax complex gene products. If our model of the bithorax complex (3) is correct, it will be difficult to dissect its regulatory regions with small pieces of DNA. Some aspects of the regulation seem to require the correct arrangement of very large DNA domains. It is for the study of such large domains that the building strategy was designed. Whereas we have applied the building technique to the bithorax complex, this approach is applicable to any gene with a large transcription unit or regulatory regions. The 125-kb plasmid inser- b Building from phage I. Integrate phage in bacterial chromosome R-B-C ~ ~_ prophap. !n ehromoaome t,t II. Integrate shuttle plasmid (tetr at 42°C )~ R ),t R-B-C ),R 2nd Recombination R III. Screen for transfer of DNA to shuttle plasmid Fig. 4. Additional procedures tor building. (a) Keverse building. in oraer to transfer a large segment A-B-C from F plasnud to shuttle plasmid, the shuttle plasmid is constructed with segment A, and the two plasmids are joined in a cointegrate. The cointegrate is resolved at 30°C to allow replication from the shuttle origin. The pushout plasmid, which is a mini-F factor, is used to select against the F plasmids and cointegrates. Cointegrates are excluded because of incompatibility of the two F origin plasmids, and so the resulting colonies contain only a resolved shuttle plasmid carrying the cloned segment of DNA A-B-C. (b) Building from phage. The X shuttle carries the lacZ gene between fragments from the arms of a X vector. It is transformed into cells containing a prophage carrying the DNA segment A-B-C. When the cells are grown at 42°C in the presence of tetracycline, the survivors have the shuttle plasmid integrated into the chromosome by homologous recombination with the prophage. When the temperature is reduced to 30°C, the plasmid begins replication and is excised from the chromosome by a second homologous recombination event. Half of the time the recombination occurs at the other arm from the initial event, resulting in loss from the shuttle plasnud of lacZ, which is then replaced by the insert of the recombinant phage. (a) Crossing on mutations. The deletion is first generated on a small DNA fragment (B-AC-D) cloned in the shuttle plasmid. The length of the homology on both sides of the mutation should be relatively equal (B =- D). This shuttle is transformed into a cell containing an F plasmid with a larger DNA segment A-B-C-D-E. Cointegrates are formed and resolved. In about half of the resolved molecules, the F plasmid should carry the deletion. t 16 JUNE 1989 ARTICLES 1311
Page 70: brs52e00
ters for the inner lone-pair orbital. Of the 262 segments, there were 63 cases with only CO; extemally bonded to a water molecule. The average values of the five pairs of the (~, tj angles in these segments were: (i) -63°, -40°; (i + 1) -66°, -43°; (i + 2) -63°, -43°; (i + 3) -64°, -40°; and (i + 4) -65°, -41°. Nine segments showed distortions in the (~, ty values that exceeded the average values by 3 SD and were omitted. The remaining 190 segments had one or more of the CO groups at i+ 1, i+ 2, i+ 3 and i+ 4 that were hydrogen- bonded to water molecules and thus were omitted in the calculation of the average d>, t1i values. The (~;+ i, Jj; values are similar to those observed by Blundell et al. (10) for the a helices in hydrophilic environment (-66°, -41°) and deviate from the values found for the helices in hydrophobic environment (-59°, -44°) (10). The corresponding values of the three-centered cases, excluding four segments with deviations greater than 3 SD from the average (~, tli, were: (i) -66°, C a D C O ~ O 0 4 3 .¢ ~ _N O 4 3 Transition state NgOw C-O`gN c-otl7 ow 1 60 12a ieo 240 Segment number 300 a o °a 000 O 0 0 0 0 0 -38°; (i + 1) -66°, -40°; (i + 2) -68°, -41°; (i + 3) -64°, -41°; and (i + 4) -61°, -36°. The perturbations in these values are small compared with those for buried helix; nevertheless, they display a tendency for distortion in the direction of a 310 helix, -71°, -18°. In the internally bound water segments, the conformational distortions are more di- verse and the d ' ) and tj values (Fig. 3) are dispersed over the a helix, type-III tum, type-I turn, and occasionally in the type-II 0 0 a a e a ~ aa e 0 e 0 a 0 ae a 0 0 a o a o. e 8 a ea aa Q Q oa a 00 ao a a a a 0 0 0 a 0 Fig. 2. (A) Schematic drawing of an a-helical segment showing the potential hydrogen-bond distances and angles involving the carbonyl 0 atom, the amide group, and the water molecule. (B) A plot of the distances d1, d2, and d3 in the ascending order of the magnitude of d3. Note that as d3 decreases and reaches the hydrogen-bonding distance of 3.4 A (transition state), d2 increases abruptly accompanied by the disruption of the helix hydrogen bond in the 33 cases where the water molecule is inserted. In the 17 three-centered cases, this dramatic change is not seen and the helix hydrogen bond is intact as in the external cases. (C) Stereoplot showing the distribution of the externally bound water molecules to the a helices in proteins. Note that the water molecules favor the direction of the outer lone-pair orbital of the 0 atom. (D) Stereoplot showing the distribution of the water molecules in the three-centered cases showing a preference for the outer lone-pair orbital as in (C). (E) Stereoplot showing the distribution of the water molecules in the intemally bound segments which show a preference for the inner lone-pair orbital in contrast to (C) and (D). t 16 JUNE I989 REPORTS 1335
Page 71: brs52e00
The New Genetics: Medical and Moral Implications of Recent Advances in Recombinant DNA Research University of Oxford, 8-15 July 1989 Sponsored by Oxford University, the American Association for the Advancement of Science, and the British Association for the Advancement of Science Think of us as your immunology department. Custom polyclonal antibody production. Irnmunobiochemical services. rs:e Ascites scale-up production. We're BAbCO. The full-service group staffed by experts and supported by state-of-the-art animal facilities and laboratories. Professionals experienced with antibody production on different scales. Scientists like yourself, ready to collaborate with you and to tailor projects to your needs. Send for our catalog today. Better yet, give us a call and let's start thinking about your requirements. BAbCO 4131 Lakeside Drive, Suite B Richmond, CA 94806 (415) 222-4940 (415) 222-1867 (FAX) In this unique collaborative effort, prominent researchers from England and the United States will provide a review of the latest advances in medi- cal genetics and their moral and social implications. They will deal with such major topics as human gene therapy, genetic screening, the molecular basis of disease, and genetic fingerprinting. The seminar, designed for persons with diverse disciplinary backgrounds, will give participants a working knowledge of the latest technologies and the issues surrounding their use. Distinguished faculty include: Pro- fessor David Bishop, director of the NERC Institute of Virology and visit- ing professor of virology, University of Oxford; Dr. Jeremy Cherfas, biologist and author of Man Made Life; Dr. Kay Davies, clinical molecular geneticist, John Radcliffe Hospital, Oxford; Dr. Paul Debenham, director of scientific services, Cellmark Diagnostics; Dr. Pe- ter Goodfellow, Imperial Cancer Re- search Fund; Dr. Richard Mulligan, Whitehead Institute for Biomedical Research; Sir David Weatherall, direc- tor of the Institute of Molecular Medi- cine, John Radcliffe Hospital, Oxford; and Dr. Emrna Whitelaw, molecular geneticist, University of Oxford. The week-long seminar program will include lectures on aspects of Ox- ford and English life and times, vari- ous social events, and excursions in and around Oxford, including the Royal Shakespeare Theatre at Strat- ford-upon-Avon. Cost for the entire program, includ- ing lodging and meals, is £500 (£285 for residents of European Economic Community member countries). An advance booking fee of £200 is re- quired. For more details, contact: Carol L. Rogers AAAS 1333 H St., NW Washington, DC 20005 or Dr. John R. Durant University of Oxford Department for External Studies Rewley House, 1 Wellington Square Oxford, England OX1 2JA 1322 Circle No. 222 on Readers' Service Card ' 2 0 4'7 6519~6
Page 72: brs52e00
P able 3. Authuirte~ teleasc of 1rve recombinant bacteria into the open environment as of 1989. Bacterium Altered trait Site of test Purpose of test Year of first test P. syringae Deletion of ice g (13, 14) California Control of frost damage to plants 1987 P. fuorescens Deletion of ice g (14) California Control of frost damage to plants 1987 P. fluorescens Addition of lacZY to chromo- some (78) North Carolina Assessment of spread of released bacteria 1987 R. meliloti Additional copies of nif g Wisconsin To increase efficiency of N2 fixation 1988 C. xyli Introduction of B, thuringiensis Maryland and France Control of corn ear worm 1988 A. radiobacter delta endotoxin gene (6) Deletion in tra g of Agrocin 84 Australia Biological control of crown gall 1988 P. f uorescens plasmid (62) Addition of lacZY to chromo- Washington To assess movement and survival of 1988 some (78) biological control agent of take- all disease of wheat (17) derivatized silicon chip to convert the binding of phosphate by the protein into an electronic signal for use as an on-line monitor of phosphate concentration (57). Ecological Considerations for the Use of Genetically Engineered Bacteria A large number of bacterial strains that are to be engineered for specific practical processes will need to be released into the environ- ment, although some bioprocessing activities will likely be conduct- ed in a confined and well-controlled setting, such as a bioreactor. Many genetically engineered bacteria to be released in the open environment will be descendants of indigenous environmentally competent bacteria. The potential environmental impact of released recombinant bacteria will need to be examined. This subject has been the focus of much attention and several international confer- ences since 1975 (58), and this review cannot adequately address the many concerns that have already been stated in other proceedings (59). Regulations affecting the use of genetically engineered bacteria differ greatly between different countries (60, 61). One or more agencies in the United States have jurisdiction over a research activity or commercial biotechnology product, and excellent sum- maries of current agency jurisdiction in the United States have been published (61). The data required to support initial requests for field releases of recombinant bacteria have been formidable, and despite extensive documentation, not all requests for release of bacteria have been approved. Each experiment is currently addressed on a case-by- case basis. Assessment of the environmental safety of released recombinant bacteria is rapidly taking advantage of advances in the methodology to sensitively and accurately detect specific bacterial strains or their genes. For example, bacterial DNA can now be efficiently extracted directly from environmental samples (such as soil) and identified and quantified by hybridization procedures (62). The polymerase chain reaction method for amplifying specific DNA sequences coupled with direct extraction of DNA from environmental samples increases the sensitivity of this method to as few as one cell per gram of soil (63). Information is also being generated on the frequency of gene exchange among bacteria in natural and managed environ- ments (64). Several approaches to reduce or eliminate the potential persistence of modified bacteria also have been evaluated (65). For example, the hok gene, which encodes a protein that causes lethal collapse of the transmembrane potential of cells, has been placed under the control of the inducible lac promoter (66). The hok gene product can be induced to kill cells, if necessary, by application of inducer, thereby eliminating the recombinant cells from that emri- ronment. However, mutations that result in insensitivity to the hok gene product are strongly selected. Combinations of several condi- tional lethal blocks have yet to be tested for effectiveness and possible interference with intended biological performance. Whereas tools now exist to genetically modify bacteria and to detect, disable, or measure cell activity in natural environments, a consensus has yet to be reached on what constitutes a safe release. There is need for better integration of research both on the ecology and molecular biology of bacteria and better focus on relevant questions that can be addressed by scientific methods. Modified bacteria, when properly applied, can become an important compo-' nent of our environmental protection strategies in the future. REFERENCES AND NOTES 1. H. T. Dulmage and K. Aizawa, in Microbial and Viral Pesticides, E. Kurstack, Ed. (Dekker, New York, 1982), pp. 209-237; L. K. Miller, A. J. Lingg, L. A. Bulla, Jr., Science 219, 715 (1983). 2. G. A. Held, L. A. Buila, E. Ferrari, A. I. Aronson, S. A. Minnich, Proc. Natl. Acad. Sci. U.S.A. 79,6065 (1982); A. Klier, F. Fargette, J. Ribier, G. Rapport, EMBO J. 1, 791 (1982); D. Lereclus et al., Biochimie 67, 91 (1985); A. I. Aronson, W. Beckman, P. Dunn, Microbiol. Rev. 50, 1 (1986); B. B. Spear, in Biotechnology in Agricultural Chemistry, H. M. LeBaron, R. O. Mumma, R. C. Honeycutt, J. H. Duesing, Eds. (American Chemical Society, Washington, DC, 1987), pp. 204- 214. 3. L. S. Watrud et al., in Engineered Organisms in the Environment: Saentific Issues, H. O. Halverson, D. Prarner, M. Rogul, Eds. (American Society for Microbiology, Washington, DC, 1985), pp. 40-46; G. F. Barry, Bio/Technology 4, 446 (1986). 4. G. Johnson, S. F. Tomasino, J. Flynn, Phytopathology 78, 1540 (abstr.) (1988); P. W. Reeser and S. J. Kostka, ibid., p. 1540 (abstr.). 5. S. J. Kostka, P. W. Rceser, D. P. Miller, ibid., p. 1540 (abstr.). 6. S. J. Kostka, S. F. Tomasino, J. T. Turner, P. W. Reeser, ibid., p. 1540. 7. E. W. Buxton, O. Khalifa, V. Ward, Ann. Appf. Biol. 55, 83 (1965); R. Mitchell and M. Alexander, Soil Sn. Soc. Am. Proc. 26, 556 (1962); I. Chet, Y. Hcnis, R. Mitchell, Can. J. Microbiol. 13, 137 (1967); A. Ordentlich, Y. Elad, I. Chet, Soil Biol. Biochem. 19, 747 (1987). 8. J. D. G. Jones, K. L. Grady, T. V. Suslow, J. R. Bedbrook, EMBO J. 5, 467 (1986). 9. E. C. Wynne and J. M. Pemberton, AppL Environ. Microbiol, 52, 1362 (1986); R. L. Fuchs, S. A. McPherson, D. J. Drahos, ibid., p. 504; A. T. Wortman, C. C. Somerville, R. R. Colwell, ibid., p. 142; P. W. Robbins, C. Albright, B. Benfield, J. Biol. Chem. 263, 443 (1988); L. Sundheim, J. Agric. Sci. Finl. 59, 209 (1987). 10. S. E. Lindow, Plant D'u. Rep. 67, 327 (1983); D. C. Amy, C. D. Upper Appl. Environ. Miaobiol. 36, 831 (1978); Plant Physiol. 70, 1084 (1982); S. E Lindow, Anna. Rev. Phytopathol. 21, 363 (1983). 11. C. S. Orser, B. J. Staskawicz, N, J. Panopoulos, D. Dahlbeck, S. E. Lindow, J. Bacteriol. 164,359 (1985); R. L. Green and G. J. Warren, Nature 317, 645 (1985). 12. J. Lindemann and T. V. Suslow, in Proceedings of the 6th International Conference on Plant Pathogenic Bacteria, E. L. Civerolo, Ed. (U.S. Department of Agriculture, College Park, MD, 1985), pp. 1005-1012. 13. S. E. Lindow, in Engineered Organisms in the Environment: Scientific Issues, H. O. Halvorson, D. Pramer, M. Rogul, Eds. (American Society for Microbiology, Washington, DC, 1985), pp. 23-25. 14. and N. J. Panopoulos, in The Release of Genetically Engineered Microorganisms, M. Sussman, C. H. Collins, F. A. Skinner, Eds. (Academic Press, London, 1988), pp. 121-138; S. E. Lindow, in Microbial Ecology, F. Megusar and M. Gantar, Eds. i t6 JUNE r989 ARTICLES 1305 11
Page 73: brs52e00
,lf Genetic Engineering of Bacteria from Managed and Natural Habitats S. E. LlrrDOw, N. J. PANoPovws, B. L. MCFAxIArrD The genetic modification of bacteria from natural and managed habitats will impact on the management of agricultural and environmental settings. Potential appli- cations include crop production and protection, degrada- tion or sequestration of environmental pollutants, extrac- tion of metals from ores, industrial fermentations, and productions of enzymes, diagnostics, and chemicals. Ap- plications of this technology will ultimately include the release of beneficial agents in the environment. If safely deployed, genetically modified bacteria should be able to provide significant benefits in the management of envi- ronmental systems and in the development of new envi- ronmental control processes. M ANY DISTINCT FORMS OF BACTERIA EXIST IN NATURE, each with potentially useful or detrimental attributes. Several strategies can be used to modify bacteria for usefiil purposes. In some instances, one or more genes for undesirable traits have been targeted for removal. There are also circumstances when the survival of useful microorganisms may be improved by single gene transfer or by genetic selection for tolerance to toxic substances. Sometimes a trait or process that is restricted to a given strain may prove useful in a habitat that is not readily exploited by that species. Although the adaptations that enable bacteria to colonize or survive in specific habitats are generally unknown, it is likely that many characteristics collectively determine survival. Thus, it is presently difficult or impossible to transfer all the genetic determinants enabling a bacterium to survive in a habitat to which it is not already adapted. However, certain traits that may be desirable to have expressed in a given environment are conferred by single genes or gene clusters, which can be transferred to and expressed in a bacterial strain indigenous to that environment. Most studies have emphasized the introduction of genes for novel traits into bacteria indigenous to the habitat to be exploited. Because of the wide scope of genetic engineering targets, this review will focus on the modifi- cation of some bacteria that affect important natural and industrial processes. Plant-Microbe-Pest Interactions Most bacterial species that reside on plant surfaces are not harmful to the plant and may even protect it from pathogens, other deleterious microorganisms, and insects. Many such species, particu- larly strains of Pseudomonas, are well adapted for growth and survival on leaves or roots of plants, with population sizes of 105 to 107 cells 1300 per square centimeter of plant surface being common. Attempts have been made to modify these bacteria by the addition of single genes so that they might protect crops against insect pests. For example, many lepidopteran insects are susceptible to the delta endotoxin produced by various strains of Bacillus thuringiensis (1). This bacterial species is found in diseased insects or in soil and plant debris and can cause low levels of mortality in susceptible insects in natural settings (1). The genes conferring production of several different B. thuringiensis delta endotoxins with different insect host specificities have been cloned and partially characterized (2), and effbrt has been directed toward determining the functional domains within the toxin so that hybrid toxins with altered host ranges or enhanced potency can be made (2). Commercially produced cells of B. thuringiensis are effective insecticides, which are used on several agricultural and forest plant species. However, effective insect control requires repeated applications of B, thuringiensis since this species does not multiply on plants. Attempts have been made to overcome the spatial and economic limitations of foliar applications of commercially produced B. thuringiensis cells for insect control. For example, the delta endotoxin gene was introduced into the chromo- some of Pseudomonas fluorescens (an effective colonizer of corn roots) in order to ensure stability of the gene and to minimize the risk of its transfer to other bacteria indigenous to corn roots (3). This recombinant strain attained population sizes similar to those of the parental strain on corn roots and did not differ from the parental strain in survival and dispersal characteristics as measured in labora- tory studies. The modified Ps fiuorescens strain showed some toxicity to root cutworm but not to corn rootworm, which is a more important pest. There has not been a field test of the efficacy of this bacterium because environmental issues raised during an Environ- mental Protection Agency (EPA) review have necessitated addition- al research by the Monsanto Chemical Company, the initiator of this project. Whereas transfer of the B. thuringiensis endotoxin gene to root-colonizing bacteria may be potentially useful for increasing the number of habitats to which the toxin might be applied, its incorporation into an internal colonist of plants also has promise. Clavibacter xyli subspecies cynodontis is generally found inside Bermu- da grass plants but can reach population sizes of > 10$ cells per gram of stem tissue when inoculated into other plant species, including corn (4). Such a bacterium could be an efficient vector for the expression of cloned genes inside plants, and the B. thuringiensis delta endotoxin gene has been incorporated into this species (5). Field studies have been initiated with recombinant C. xyli strains for the control of leaf- or stem-feeding lepidopteran insects (6). Chitin, a polylner of N-acetylglucosamine, is a structural compo- S. E. Lindow and N. J. Panopoulos are in the Department of Plant Patholog, 147 Hilgard Hall, University of California, Berkeley, CA 94720. B. L. McFarland Ls at the Chevron Research Company, Process Research Department, Richmond, CA 94802. 20470-5i964 SCIENCE, VOL. 1q.¢
Page 74: brs52e00
tory region). One could, in a similar fashion, fuse regulatory sequences to complementary DNAs or juxtapose regions that are normally widely separated. DNA Preparation and Analysis Most procedures for isolation of plasmid DNA from E. coli were designed for small high-copy plasmids. The plasmids produced by the building strategy can be quite large and are maintained at a low copy number. Despite these differences, only slight modifications of standard protocols are necessary to prepare plasmid DNA. Cointe- grates, when maintained in a rec- cell, can be grown at the permissive temperature for the replication via the temperature- sensitive origin. Cointegrates as large as 150 kb have been propagat- ed stably at a copy number of six to ten. These plasmids are prepared by the boiling miniprep procedures (10) and visualized on an ethidium bromide-stained agarose gel. (We use boiling miniprep DNA for restriction analysis and alkaline miniprep DNA (10) for transformation of bacteria.) After resolution of the cointegrate, F plasmid derivatives can be prepared by the same miniprep proce- dures. Because of the large number of restriction fragments in the larger plasmids, it is often difficult to detect all the bands by ethidium bromide staining, but DNA blotting and hybridization permit easy evaluation. To prepare large amounts of plasmid, we have used the alkaline lvsis procedure for making plasmid DNA (10), followed by two cesium chloride gradients to remove contami- nating bacterial chromosomal DNA. We have obtained yields of 30 µg of plasmid DNA per liter of cells with plasmids as large as 136 kb. One initial concern was that large plasmids would be easily broken by shear forces, but we have not found these plasmids to be overly fragile. There is not significant breakage or nicking of closed circles in the standard manipulations to prepare the plasmids. We were particularly concerned about possible shearing of plasmid DNA in the 1-µm tip of the microcapillaries used for injection of Drosophila embryos. An 80-kb plasmid was examined by electron microscopy before and after passage through such an injection Fig. 2. Assembled DNA segments from the bi- thorax complex of Dro- sophila. The hatched line at the center represents the molecular coordi- nates of the DNA of the bithorax complex (9). Distance is in kilobases from an arbitrary zero point. Immediately be- low the coordinate axis Regulatory regionsi -too 10 kb 4 abx and bx -80 -so -40 ~ {-----;--I I- Ubxtranscription unit needle. No significant increase in either broken or relaxed circle molecules was observed. We assume that the supercoiled nature of these plasmids is responsible for their resistance to shearing. Mapping large DNA molecules can be difficult. We have con- structed F plasmids carrying a single Not I site, which can be linearized to help in restriction analysis. In addition, probes corre- sponding to one or the other of the flanking vector sequences can be used to identify end fragments. In our experience, however, for constructs as large as 80 to 100 kb, such additional information is not necessary. The pattern of DNA fragments generated by digests with restriction enzymes that have six-base pair recognition se- quences, as analyzed on an ethidium bromide-stained gel, is suffi- cient to verify the identity of clones. The basic building strategy, as outlined above, was sufficient for much of the work illustrated in Fig. 2. We have developed a few procedures that speed the process and that permit further manipula- tion of constructed DNA. These are outlined in the sections below. Reverse Building Since the process of building requires little labor relative to time, it is efficient to construct a large segment by making several portions simultaneously and then to join them together. However, the intermediate-size segments end up on the F plasmid. Two F plasmids cannot be joined together by the building procedure; one of the two segments must be on the shuttle plasmid. A procedure called reverse building can be used to transfer DNA from the F plasmid to the shuttle. Reverse building differs from the basic building process in that DNA moves from the F plasmid to the shuttle, rather than the opposite (Fig. 4a). Cointegrates are made as in the basic building procedure (step I). However, in this case the resolution is done at 30°C with selection for ampr and tetr, to allow recovery of the shuttle plasmid (step II). Resolution is less efficient at this tempera- ture and many cointegrates remain. A DNA miniprep is made from these cells and used to transform a rec- cell carrying the pushout plasmid. The pushout plasmid is incompatible with the F origin f bxdand pbx lab-2 !ab-3 lab-4 -20 0 +20 +40 +60 +80 +100 F- ~ I -! I-~-f----1 f I-}-4--I abdA transcription unit Reverse build .~71 1t 1? ~ 2(1,insert) 3 4(1, Inaert) S are diagrammed the e structure of the Ubx and Ubx construct 125 kb abdA transcription units. Above the coordinate axis are the abx, bx, bxd, and pbx regulatory re- gions, as defined by mu- tations affecting spatial bxconstruct 36 kb 1 facZ•Ubx regulation of the Ubx product. Likewise, the iab regulatory regions are defined by mutations disrupting segmental regulation of the abdA product. The bottom half of the figure shows the plasmids constructed, which fall into two classes. The first class (the Ubx and abdA constructs) contain transcrip- tion units and associated regulatorv DNA. The Ubx construct, at left, was made by cloning fragment 1 into the F plasmid and by adding successively the other fragments (each carried on the shuttle plasmid). The largest Ubx construct contains 125 kb and spans the Ubx transcription unit, including the abx/bx regulatory region, and part of the bxd/pbx regulatory region. On 9- 7 8 Reverse build t 2 S 6 2 3 4 ..~~. = * lacZ-Ubx ~ 1~1313 1 2 ~ 13 3 7(1 Insert) 4 S 8(lfnsert) Reverse build abdA construct 80 kb S-step abdA construct with 3=4 5 5-kb de{etion - 6 7 bxd construct 47 kb the right is the 80-kb abdA construct, containing the abdA transcription unit, and the iab-2, iab-3, and iab-4 regulatory regions. Also shown is a derivative of the abdA construct, in which a 5-kb deletion has been introduced by recombination. Fragments recombined directly from Charon 4 phage are indicated with a x. Three parts of the Ubx construct were obtained by reverse building, as indicated. In the second class of constructs, regulatory sequences from the abxlbx region or from the bxd/pbx region were connected to a Ubx- lacZ fusion gene. Successive steps in these constructions may be analyzed like a series of nested deletions. i 16 JUNE 1989 ARTICLES 1309
Page 75: brs52e00
aouars5 uo4ewaqul -4 0 L6qo!9 MnoqW a 0 paq1Y'8 Psuo'J '.bu3 aaetlS JO way Bu3 pn10 JO qaaW ..6u3 1oa13 ' ~3 -6 O AboPonh-r O sxskld 'f CI ~6 Cl ABqa nwu11 1 Q aa ap 1 3 CJ -6 O A6olWted -d O 107sry{ q At~ -A Cl -6 Ll A6ololewaH -H C I'!os -1eW-~jnIRSeW _8 f~ A6o~>tM. 1 CJ /,8sway0 fzn!wKl -3 CI uonOlod -L C] aunM>aW ld1 -A O A6op!qaoiW-W O cu!olPaW~? -9 O alEaE{~9qnd -n o A~!1~W3 -Z O a~ -S 0 au!o!p4W~~ao~oi d~ mBOOpx~.lel.ld -0 0 M ~~ uAod -Z O 6uqueg PuqB -9 Cl sanew~lRW -0 C:J ~Uls!w~ 8~X1 ~ O Ressaourunu!0!Pekl -H 17 eaua!x,, ialndwa3 M C] A11s!waq tf.wul -Z O almqaeKxt~ -N C] walp'p9 ualepeH -S CI Nlswalq IeuV -1 C3 -N L:1 Au.wGeuy -1 C'1 ~!lauaS -!l 0 1nenluAsd JO I~sd -V Cl A6apoZ -N 17 0 19N31N1 40 013Id AkMYVffdd MDM 7P'33N9 3S+Y31d SH b Ci S6'i 8 Ci OW Z[J 04d 1 C] @0a5'P XwA>f0mh mQ1d SVV V.dO H39W3W V 31 3H3H 7103H0 0 31V1S BUSINESS REPLY MAIL FIRST CLASS PERMIT NO. 5939 NEW YORK, N.Y. POSTAGE WILL BE PAID BY ADDRESSEE SCIENCE 10th FLOOR READERS SERVICE 1515 BROADWAY NEW YORK, N.Y. 10109-0163 300'J V3uV NVHl H3HA0 AH1Nf10J I N X08 L30 sSHOQV 133H13 NOISVVd H 1N31W1HVd30 j PuZ lsl S1VI11NI NO POSTAGE NECESSARY IF MAILED IN THE UNITED STATES aave!os uopelu qul -Y 0 moP!B ~~W -0 C7 Pa!Iro' 91suo0' bu3 {6 Cl /bolonA-* 0 sasAld -f 0 eaetlS JO o1ay . Ou3 -6 C] A6oyounwwl 1 D 8 3 O IP~J JO WeW' bu3 6 O A~lled d O Nnis!H~Y~~ A CI hal3'D9 -6 O A6op0ewa}{ -N O 1pS "leW-ABmNeJeW -8 0 Am-ml, 1 p Answaq0 t-!q -0 O uo9nlpd 'L CI cao!DaW 1RA -A 0 AW!q-!W -W 0 -!PaW IcNugd -9 CI UMea}I avqnd -n CJ A6olotAnopu3 -Z O ~-9 O A~IOS -S O a~®!oS pA~eW -x O Aosway0 -Z O au!opVy muapJ d el ln01o•.lew.leqd -0 CI Answaqj q9 -r cl 6PIueB PooN -0 O sagewelpeyy -0 0 Auslweq3 ~0 -8 L7 Fesseane.uu!opepi -H 0 eau9r.r5 xilndwql-M O Aliswe110 aoul -Z 0 eu~ -N 0 wetq'aD u09e!DaH-S 0 AAS!welq I~'W -L 0 -N O AwoteW -1 O S3IeuaO - 0 Al1eI11nASh co Io~PAsd "V n A6opaZ "X I.7 mh'9 -~ U 1S3N31N9 3i0 0131d AHWMI'Nd FAn0A X03N'J 3SY31d Se b G SW 8 C i aW Z Ci CIVd l C3 "J8P 3rmA>tmP "d SV W j0 H391V3W V 313H3H }103H0 0 31V1s I ON1VOOa r43131dW0O 391SnW 30'ddS SIH N011VZI~NVUH0 ZL000-99b - Uli1fD 33IAd3S li30`d3li 3DN3I3S BUSINESS REPLY MAIL FIRST CLASS PERMIT NO. 5939 NEW YORK, N.Y. POSTAGE WILL BE PAID BY ADDRESSEE SCIENCE 10th FLOOR READERS SERVICE 1515 BROADWAY NEW YORK, N.Y. 10109-0163 3000d j O4d 'DOlB w1H &V"'3 -0 d ueOrsAyl aienud -0 Cl (Are19Nf uou) -J -9 O qFq qNe®H J141d A d S=l4~W -X O /~J!pW -W O W~l b IBW W»H -Z L7 ~'>uun -n CI qel WAPd -d O XR'3 -0 O 15wa!oS le!hsnWl -3 O MKIS0H -W CI A11II03Pf31N3WA01dW91100A 7103N'J 3SV31d :H3N10 NVI9tSAHd'OVHd -9 11 Or73 NDIUlllOd- "d10 8V1155V -0 O ff3NIWVX3'03W -3 O 90 AHVIINYS x O N01.33HI0 "9tl1 -1 G 0'J3H 1d30 -H O 305'SV "S3N 111 H0133NI0 53N -N G NOSIAy3cN1S -S O H0103k110 -H331 -f 0 53Nd 331A -9 G 1NV111151m -A G NO1M3n03 I G S311d -S G "H031 "03W -1 G 1N300Ls "OYHo W Ci 30F:Id OOSStl -n CI 1SI1N3108'S3H -M 0 1SIlN31q5 idtlls -0 G 3nNd -d G 1X3 9000 V3H'c+ I 1 sn NVHl H3H1A AH1NnOO [ N X081jo SS3HOOV 133H18 NOISIAId 13O 1N3W1HVd30 J 3WVN1Stl-1 PuZ 1sl SIVIlINI NO POSTAGE NECESSARY IF MAILED IN THE UNITED STATES 1 IIJNI~II~~In ~~I~'I~f71~I~~II1l/71JI'N"NI7~~~~'NIN~I Ifl~'IIIIJI717IIIINNN'NIIUIIN~IJN~II~I'~Il~'INI~'IJ' I 'ON VWOOi 360'J dIZ wq3 ftr}plsuad -0 D uecnsAw ateNld -0 CI (A1qMW ~) WJ -9 0 qel tpRali o!IWId A O saleS )o 6uqalPeW -X 0 ~1!INI -W O pnoj 1m isul WomrsaN -z C1 0aAoo jo "n!un -n r7 qtl a.ler,!ld -d o m90 -0 [_I lsque!aS I¢ulsnpul -3 [7 ICPWH -v CI AUOD31YJ 1NMA013q3 Hf10A N'03H9 3SV31d :H3H10 NVI~'.vUld "'JV4Jd '9 f] 9N3 NOllnilOd - 810 "BV1 '1SSV -0 CI H3N1WW3'03W .0 !J HO AHtl11N15 * 0 H0133NI0 8tl1 -1 O OY3H 1d30 -H O -3nS5V S3}i -X [] H0133NMn "S3U -N G H0SNH3dnS -S O U0133110 -N031 -f Cl -53lid 301A 9 G 1NY11nSN00 -A G N01tl3003 '8 C i -S3Hd -5 Ci -H031'03W -i G 1N30n15 OVkFJ W G 'iOHd O0S;d -0 Ci JSI1N3qS "S3a -M (7 JSI1N310S 33'd1S -0 Li 30iid -d G NQi1180d HfIOA S39/N3330 A13S0101SOM HOIHM 31111 *13N'J 1X3 I ON "31318 S 13JOn81N3Wdlil03 F3f7OA SI 1VHM'OS hc 8"d'1 M3N VmQ11R9 3HW nOA rll N03H0 35'b3ld L7 I H39WN3NOHd I NOIlVZIN'd~'J~}jO T43131dW00 381Sf1W 33WS SIHl --- - -- 3WVN1SV1 ZL000-99b - aHVO 30IALi3S li3Ud3a 30N3IDS 20A,~6blWj IIDI1180d ®1qA S381fi0S30 A1330171SDW N59N+M 3'Nll X:13N7 ` S 13Ex]n81N3Wd1n03 HnOA SI 1VHM'OS di BVl M3N V~'JNInllfl9 3HV nOA.dl NO-3H035V31d Cl 1338Wf1N 3NOHd
Page 76: brs52e00
may enhance the recovery of gold from arsenopyritic-pyritic ores by T. ferrooxidans and increase the resistance of T. ferrooxidans and B. subtilis to arsenite and arsenate (52). A recA-like gene from T. ferrooxidans has been cloned, and selectable shuttle doning vectors have also been constructed for this bacterium (51). At least two companies plan to test genetically engineered organisms with en- hanced bioleaching capabilities (52). Wastewater Treatment Applications Few aspects of municipal and industrial wastewater treatment processes are understood at the genetic and biochemical level. Some bacterial funetions, such as the biodegradation of particular chemi- cals, may reside in one gene or gene cluster and be relatively easy to identify. Although it would be desirable to obtain improvements in other bacterial functions, such as better flocculation of heterotrophic bacteria in activated sludge, stronger attachment of bacteria to surfaces, increased growth rates of nitrifying bacteria, and decreased sensitivity to inhibitors, these are often complex and require multi- ple genes (53). Many wastewater treatment processes require removal of biomass for disposal or recycling purposes. The most common example is the activated sludge process, which depends on the formation of aggregates of microbes for effective treatment (53). Although several microbes produce exopolysaccharides, which contribute to floccula- tion in aerobic wastewater treatment facilities, Zoogloea species have been implicated in particular (53). Recombinant DNA technology has been used to control biopolymer synthesis in Zoogloea ramigera. Several genes that are responsible for the production of different exopolysaccharides required for flocculation have been cloned from Z. ramigera strains (54). The ability to link the genes for biopolymer and surfactant production together with catabolic genes may im- prove wastewater treatment processes (40, 43). This coupling would also provide a way of keeping plasmid-containing cells within the bioreactor during continuous-flow operations, as the nonflocculat- Table ~ Table 2. Examples of genetically engineered bacteria. ed, nonplasmid bearing cells would leave the system in the effluenr through the overflow (54). The cloning of the Vitreoscilla structural gene for the oxygen- carrying compound hemoglobin and its expression in E. coli may fiirther improve bioprocessing and biomining operations that are oxygen-limited (55). Evidence indicates that floc-forming bacteria have a lower affinity for oxygen than do certain filamentous bacteria (53). The linking of genes for biopolymer synthesis in floc-forming bacteria with an enhanced ability to scavenge oxygen from the environment could result in significant improvement in wastewater treatment. Genetic technology could also improve the sequestration of metals in bacteria by enhancing the absorption of metals to the microbial cell surface or by increasing intracellular uptake. This would be useful for the removal of metals from aqueous solutions for both pollution control and the recovery of precious metals (51). Metallothioneins are low molecular weight peptides that are in- duced in response to increased metal concentrations (56). Human metallorhionein has been cloned into E. coli and it has been proposed that these engineered bacteria be used as an immobilized cell system for removing metals from wastewaters (56). When the metallothionein fusion protein is induced in the presence of CdZ- or CuZ~, a direct correlation is found between the expression of the fiision protein and the bioaccumulation of CdZ, and Cu2, . The use of immobilized cells with high metallothionein responsiveness could provide a waste treatment system naturally responsive to variations in heavy metal concentrations. Bacterial metal-binding proteins can be used either to remove phosphorus in wastewater treatment systems, so as to prevent further eutrophication of waters that receive industrial and munici- pal wastewater discharges, or as regenerable adsorbants or biosen- sors (51, 53, 57). For example, the phosphate-binding protein of E. coli has been cloned and expressed in strains that secrete proteins directly into the medium, so as to minimize product recovery costs (57). The recovered phosphate-binding protein was immobilized on a support matrix as a thermally regenerable adsorbant and onto a Host bacteria Altered trait Genes transferred (source organism) Extension of substrate range Pseudomonas aeruginosa and Growth on whey for biopolymer production Lactose metabolizing enzymes (E. coli) (72) X. campestris E. coli Cellulose used as new feedstock Various cellulose degrading enzymes (73) Bacillus subtilis Starch used as new feedstock a-amylase (B. subtilis) (74) Thermophilic enzymes added E. coli Cellulose degradation Various cellulose degrading enzymes (75) E. coli Starch degradation a-amylase (Dictyglomus thermophilum and Bacillus li i 50 h i E. coii c en form s) ( ) Raffinose removal a-galactosidase (B. stearothermophilus) (76) Biodegradation and waste treatment applications Pseudomonas Altered pathway regulation TOL plasmid catabolic enzymes (44) E. coli Enhanced degradation pathway for mono- and Various genes (67) disubstituted chloroaromatics Pseudomonas spp. Alcaiigenes eutrophus E. roli Metal removal from wastewater Metallothionein (human) (56) E. coli Polychlorinated biphenyl metabolism Entire pathway (Pseudomonas spp.) (38) New biochemistry added Methylophilus methylotrophus Increased efficiency of methanol conversion to Alcohol dehydrogenase (B, stearothermophilus) single cell protein and glutamate dehydrogenase (E. coli) (77) E. coli Indigo production Naphthalene oxidation enzymes (P. putida) (46) E. coli Improved oxygen metabolism Hemoglobin structural gene (Vitreoscilla) (55) E. coli Control of intra- and extracellular biopolymers Exopolysaccharide and polyhydroxybutyrate biosynthetic genes (Z. ramigera and A. eutrophus, respectively) (54) I3o4. SCIENCE, VOL. 2¢¢ 204'785i968
Page 77: brs52e00
I American Type Culture Collection Algae Hybridomas Antisera to Viruses Libraries Bacteria and Phages Oncogenes Cell Lines Phage Vectors Chlamydiae Plasmid Vectors Cloned Genes Protozoa Cloned Viruses Rickettsiae DNA Probes Viruses Fungi Yeasts FREE REFERENCE CATALOGUES • Algae and Protozoa, 1985 Catalogue, 16th edition: lists over 1.000 strains: in- cludes an index to special applications. • Bacteria and Bacter/ophages, 1989 Catalogue, 17th edition, lists over 11,000 sfrains, includes an index to special appli- cations, media formulae. • Cell L'nes,Hybridomas, 1988 Catalogue. 6th editiom lists over 2.800 lines; indexed by species, tissue, tumor and MAb. • Fungi'Yeasts, 1987 Catalogue, 17th editiom lists over 21,000 stains. Includes an index to industrial applications and meaia formulae. • NIH Repository of Human DNA Probes and Libraries, August 1988 edi- tion: lists over 700 probes. clones genes and chromosome-specific libraries of the human genome: primate cDNA and lib- raries; multispecies orlcogenes. • Recombinant DNA Materials List, January 1989, 126 pages; list ot over 800 cloned inserts. libraries. vectors and 6osts. • Viruses and Virus Antisera (Animal & Plant), Chlamydiae. Rickettsiae, 1986 Catalogue, 5th editton: lists over 2000 strains and antisera. 12301 Parklawn Drive American Type Culture Collection Rockville, MD 20852 (301 ) 881 -2600 1(800) 638-6597 Circle No. 230 on Readers' Service Card t324. Your ~one stop for Cells and D2Lamps. A full line of quality cells: • Stock and custom • Dye laser Plane Optics UV light sources for all major instruments: • DZ and Hg. CUV-O-STIR • Mini-magnet cuvette stirrer • Variable speed ~ • Multiple cell capability. -----HELLMAr-- Box 544, Borough Hall Station, Jamaica, NY 11424 (718) 544-9534 or (718) 544-9166. n I-IELLMA----- Circle No. 166 on Readers' Service Card i MC MICRC)-g°LAB TABLES Higher performance...more options, more features The new TMC Micro-g Series 63-500 tab tables with advanced Gimbal Piston' isolators achieve highest attenuation of both vertical and horizontal vibration. Features include new leveling feet, new ?" thick, high-stiffness, highly damped stainless steel top with rounded seamless edges and corners. Options offer added utility and convenience: armrests, shelving, choice of top surfaces, casters, equipment support bars, Faraday cages. Sizes from 25" x 36" to 36" x 60". Write or call for new product bulletin No. MG30-86 and price list today. Technical Manufacturing Corporation 15 Centennial Drive • Peabody, MA 01960 Telephone508-532-6330 • Telex 951408 FAX 508-531-8682
Page 78: brs52e00
Thin TiQht Tin Slices. Spts. oToO Vibratome de Fonbrune Stage-Mounted Micromanipufator de Fonbrune Microforge Whether it's fresh sectioning, micromanipulating or forging, turn to TPI for instruments as precise as your procedure. Vibratome ! if wur research demands fresh tissue sectioning with no freezing or embedding, turn to the Vibratome, the superior tissue sectioning system, Series 1000 or Series 2000. Vibratome Series 2000 gives you specimen bath refrigeration, automatic sec- tioning repetition, and motorized digital control of section thick ness and spedmen height. For detailed information circle No. 40 on Readers' Service Card blicromanipulator. Precision control is in your hands with the TPI de Fonbrune Micromanipulators, free-standing and stage- mounted. Experience smooth, positive mavement, virtually zero drift and no backlash, with easy to use single joystick control for either right or left-handed operator, For detailed information circle No. 41 on Readers' Service Card Microforge. Perfect companion to the Micromanipulator, the TPI de Fonbrune Microforge, with 6 mrnement and 2 temperature controls, permits fabrication of both simple and complex micro- tools. Accomplish fusion/melting, distant/contact stretching, micro- glass blow7ng, fracturing, using glass, metals, alloys, organic crystals, polymers or other fusible materials. For detailed information circle No. 42 on Readers' Service Card Serviee. As the only US. manufacturer of de Fonbrune Micro- manipulators and Forges, and the maker of Vibratome, TPI provides you assured delivery, on-demand technical service and complete repair and replacement should y©u need it. When your research demands thin slices, finds you in tight spots, or needing tiny tools, call TPI. ~ C _~"T TECHNICIL f~ODUCTS 16 jvNE 1939 INfERNATIONAL, INC. 13795 RIDER TRPJL SUITE 104 / ST LOUIS, MO 63045 (314) 291-0198 FAX; 314-291-0710
Page 79: brs52e00
ase of particle guns are currently under way in many laboratories atouttd t~ie wot~d. Other methods that have the potential to influence the production of transgenic cereals include gene transfer into pollen (29), direct injection into reproductive organs (30), microinjection into cells of immature embryos (31), and rehydration of desiccated embryos (32). There has been some demonstration of transient or stable gene expression through the use of each of these methods in some species, but the range of their applicability remains to be demonstrated. Application of Genetic Engineering to Crop Improvement The availability of efficient transformation systems for crop species is of intense interest to biotechnology, agrichemical, and seed companies for the application of this technology to crop improvement. Initial research has been focused on the engineering of traits that relate directly to the traditional roles of industry in farming, such as the control of insects, weeds, and plant diseases. Progress has been rapid, and genes conferring these traits have already been successfully introduced into several important crop species. Genetically engineered soybean, cotton, rice, corn, oilseed rape, sugarbeet, tomato, and alfalfa crops are expected to enter the marketplace between 1993 and 2000. Weed control. Engineering herbicide tolerance into crops represents a new alternative for conferring selectivity and enhancing crop safety of herbicides. Research has largely concentrated on those herbicides with properties such as high unit activity, low toxicity, low soil mobility, and rapid biodegradation and with broad spectrum activi- ty against various weeds. The development of crop plants that are tolerant to such herbicides would provide more effective, less costly, and more errvironmentallv attractive weed control. The commercial strategy in engineering herbicide tolerance is to gain market share through a shift in herbicide use (33)-not to increase the overall use of herbicides, as is popularly held. Herbicide-resistant plants will have the positive impact of reducing overall herbicide use through substitution of more effective and environmentally acceptable prod- ucts. Two general approaches have been taken in engineering herbicide tolerance: (i) altering the level and sensitivity of the target enzyme for the herbicide and (ii) incorporating a gene that will detoxif,v the herbicide. As an example of the first approach, glyphosate, the active ingredient of Roundup herbicide, acts by specifically inhibiting the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) (34). Glyphosate is active against annual and perennial broadleaf and grassy weeds, has very low animal toxicity, and is rapidly inactivated and degraded in all soils (35). Tolerance to glyphosate has been engineered into various crops by introducing genetic constructions for the overproduction of EPSPS (36) or of glyphosate-tolerant variant EPSPS enzymes (37, 38). Similarly, resistance to sulfonyl- urea compounds, the active ingredients in Glean and Oust herbi- cides, has been produced by the introduction of mutant acetolactate synthase (ALS) genes (39). Glean and Oust are broad-spectrum herbicides and are effective at low application rates. Since both EPSPS and ALS activities are present in wild-type plants, the possibility of deleterious effects on crop performance or product quality due to their reintroduction is unlikely. The use of these herbicides in new crop applications may require reexamination of residues of the herbicides; however, since the residue safety levels for these two compounds in food crops have already been established, this is not an issue unique to genetically engineered plants. Resistance to gluphosinate (40) and bromoxynil (41) has been achieved by the alternative approach of introducing bacterial genes encoding enzymes that inactivate the herbicides by acetylation or nitryl hydrolysis, respectively. In field tests the gluphosinate-tolerant plants have shown excellent tolerance to the herbicide (42). Evalua- tion of the biological activity of the specific herbicide conjugates and metabolites that may be present in the transgenic plants will be carried out according to existing chemical residue regulations. Current crop targets for engineered herbicide tolerance include soybean, cotton, corn, oilseed rape, and sugarbeet. Factors such as herbicide performance, crop and chemical registration costs, poten- tial for out-crossing to weed species, proprietary rights issues, and competing herbicide technologies must all be considered before final decisions on commercialization of specific herbicide-tolerant crops can be made. Insect resistance. The production of insect-resistant plants is another application of genetic engineering with important implications for crop improvement and for both the seed and agrichemical indus- tries. Progress in engineering insect resistance in transgenic plants has been achieved through the use of the insect control protein genes of Bacillus thuringiensis (B.t.). Bacillus thuringiensis is an entomo- cidal bacterium that produces an insect control protein which is lethal to selected insect pests (43). Most strains of B.t. are toxic to lepidopteran (moth and butterfly) larvae, although some strains with toxicity to coleopteran (beetle) (44) or dipteran (fly) (45) larvae have been described. The insect toxicity of B.t. resides in a large protein; this protein has no toxicity to beneficial insects, other animals, or humans (46). The mode of action of the B.t. insect control protein is thought to be exerted at the level of disruption of ion transport across brush border membranes of susceptible insects (47). Table 1. Species for which the production of transgenic plants have been reported. Abbreviations: At, Agrobacterium tumefaciens; Ar, Agrobacteriutn rhizogenes; FP, free DNA introduction into protoplasts; PG, particle gun; MI, microinjection; IR, injection of reproductive organs. Plant species Method (reference) Herbacious dicots Petunia Tomato At (2) At (83) Potato At (84) Tobacco Arabidopsis At (1)), FP (85), PG (26) At (86) Lettuce At (87) Sunflower At (88) OiLseed rape At (89), MI (31) Flax At (90) Cotton At (91) Sugarbeet At (92) Celery At (93) Soybean At (38), PG (27) Alfalfa At (94) Medicago varia At (95) Lotus At (96) Vigna aconitifolia FP (97) Cucumber Ar (98) ~ Carrot Ar (99) Cauliflower Horseradish Ar (1(XJ) Ar (101) O FA Morning glory Ar (102) ~ Po lar Woody dicots At (103) p Walnut At (104) CS' Apple At (105) ~ Asparagus Rice Monocots At (1S) FP (21) C.+a CL Com FP (23) Orchard grass FP (106) Rye IR (30) 16 JUNE 1989 ARTICLES t295
Page 80: brs52e00
a0,2lysls (Sl, 52). An analogous approach has not been used with filamentous fungi because premeiotic diploid nuclei exist only transiently in specialized reproductive cells. In some species, such as A. nidulans, stable vegetative diploids can be formed, but these cannot be induced to produce meiotic spores. Two alternative approaches have thus been adopted. In the first, one putatively essential gene in a vegetative diploid is inactivated by site-directed mutagenesis. The resultant strain is then "haploidized" (53), and haploids are tested for the presence of both the mutated gene and the marker gene used to make the mutation. Absence of the mutated and marker genes in all haploids, accompanied by normal segrega- tion of other markers, shows that the gene is essential. In the second approach (54), a haploid strain is transformed with a plasmid that disrupts the target gene. Primary transformants are most often heterokaryotic, and nuclei containing potentially lethal mutations can thus be maintained. However, in most fungi the asexual spores are uninucleate or homokaryotic so that masked genotypes are exposed. If the mutation leads to cell death any time during spore germination, it can be detected by observing abortive growth of germinating spores from the heterokaryon. In N. crassa, pre-meiotic mutation of essential genes by RIP (34) leads to 2:2 segregation of viable versus inviable ascospores in many asci. Nondirected mutations. Plasmids lacking homology with the host genome apparently integrate at random sites and thus provide a convenient method for physically tagging chromosomal DNA se- quences. Insertional inactivation of genes by these plasmids can be used to clone the genes, just as with transposon tagging. A strain is transformed with an appropriate plasmid, and transformants are plated under conditions that will not select against desired muta- tions. The collection is screened for mutants. DNA hybridization analysis is then used to select those mutants containing one or a few plasmid copies. A genomic library is finally constructed and screened by hybridization with a DNA fragment that is unique to the plasmid used to make the disruptions. Corresponding wild-type clones can then be isolated from appropriate libraries. This approach to gene cloning does not depend on previous isolation of mutants as does the genetic complementation technique. Promoter fusions. The E. coli (3-galactosidase structural gene (lacZ) serves as a useful reporter in filamentous fungi whose endogenous (3-galactosidases are repressed by glucose (46, 55). Transcriptional or translational fusions of promoters and associated regulatory se- quences can be made with lacZ, and the activities of the resultant constructs can be measured by assaying (3-galactosidase on plates or in protein extracts. For systematic mutational studies of regulatory sequences, plasmids containing fusions can be integrated at a preselected chromosomal site (see above) to avoid position effects, which can be pronounced in filamentous fungi (31). Similarly, patterns of gene expression can be altered by fusion of structural genes to regulable promoters. For example, A. nidulans regulatory genes have been fused to the A. nidulans alcA promoter to investigate the functions of their products (54, 56). The alcA gene encodes catabolic alcohol dehydrogenase and the promoter is sub- ject to substrate induction and carbon catabolite repression (57). Genes fused to this promoter can be caused to be overexpressed or expressed at the wrong time during the life cycle or in the incorrect cell type. The results of such misexpression have been useful in making inferences about gene function. In a converse approach, cis- acting regulatory sequences from genes of interest that do not lend themselves to genetic selection schemes (for example, developmental regulatory genes) are fused to structural genes whose activities can be readily detected (for example, lacZ or alcA). Mutations that increase or decrease the levels of expression of the reporter gene can be identified following introduction of such constructs into the genome in one or more copies. Titrations of regulatory gene products. Numerous copies of selected DNA sequences can be introduced into fungal genomes by transfor- mation (58). Hynes et al. (59) showed that multiple copies of some cis-acting regulatory sequences titrate away their corresponding trans-acting transcriptional regulators, leading to an inability to induce genes in the regulon. This approach permits identification and mapping of cis-acting regulatory sequences and identification of genes that are subject to control by common trans-acting factors. Titrations are not expected to be useful in those instances where there is a large excess of trans-acting factor or where the trans-acting regulatory gene is autogenously controlled. Genetic rearrangements. Genetic rearrangements can be encouraged by directed genome manipulations. For example, an exogenous copy of a gene may be introduced on the same chromosome arm and in the same orientation as the endogenous copy, but at some distance away from it. During meiosis, this can lead to pairing and unequal crossing over, which results in loss of the DNA between the duplicated sites (31, 33, 60). Similarly, duplications of sequences on different chromosomes may lead to an increased translocation frequency as a result of recombination between the repeated se- quences (61). These approaches have not yet been extensively explored with filamentous fungi, but could be of considerable value in genetic engineering projects where major chromosomal alter- ations may be desirable. Future Prospects Basic science. Filamentous fungi can be manipulated by sophisticat- ed modern genetics to study a wide variety of eukaryotic regulatory mechanisms. Gene systems encoding enzymes for carbon and nitro- gen utilization are subject to general (for example, ammonium or catabolite repression) and pathway-specific controls whose interac- tions are of substantial interest (21). There are many examples of gene clustering in filamentous fungi, and this pattern of organiza- tion may be related to mechanisms regulating gene expression (21, 62). These organisms are exceedingly well suited for studies of multicellular development (63), cell-cell communication and cell interactions (64), organelle and chromosome movement (65) and thigmo-, gravi-, chemo-, and phototropic responses (66). They are also excellent subjects for investigations of recombination, mutagen- esis, DNA repair, and population dynamics. They will continue to serve as convenient models for larger eukaryotes. Medicine. Fungi are medically important as pathogens and as A C Plasmid Linear DNA fragment Chromosome Chromosome R S; 3' ecombinant _ - R ecombi nant chromosome chromosome B Linear DNA fragment Circularized DNA fragment '{ + Fig. 4. Targeted chromosomal in- sertions. Representation of DNA ~~ sequences is as in Fig. 2. (A) Dis- i ruption of the yA gene by transfor- mation with an internal restriction Chromosome -- fragment The recombination event j shown results in formation of a Recombinant d li f A 'h n h ( f ~ d chromosome up ca on o y wi e e c ar t t tt copy lacking the gene's 3' end and the rightward copy lacking the 5' end. (B) Recombination between a circular plasmid containing one mutant allele and the chromosome contain- ing a different mutant allele. Only recombination in the interval between the two mutations leads to formation of a wild-type allele. (C) Recombination between a linear DNA fragment containing one mutant allele and the chromosome containing a different mutant allele. The rightward crossover can occur anywhere distal to the chromosomal mutation. 1316 SCIENCE, VOL. 244 20470"51980
Page 81: brs52e00
RePlication-competent, infectious but nonpathogenic forms of vec- tors will probably also find eventual use for gene delivery in vivo in cases when delivery to a single organ may not be sufficient and when body-wide gene expression would be necessary. The Problem of Faithful Gene Regulation No matter how efficient and stable the techniques of gene delivery and expression may become, most potential clinical applications are likely to require faithfi.il regulation of the foreign gene expression. Too much, too little, and inappropriately timed gene expression will make disease correction difficult. Although great strides have been made recently in dissecting regions of genes responsible for regulat- ing the levels of gene product, there is still much to be learned about the many additional levels of transcriptional and translational con- trol exerted on genes before medically relevant genetic complemen- tation can become commonplace. Ethical Considerations and Human Experiments As is true with all other new procedures in medicine, therapeutic studies of gene therapy in human patients will be performed with imperfect knowledge when technical uncertainties and imperfec- tions are outweighed by clinical needs (110-112). The balance between uncertain harm and desired benefits has been examined carefully by a number of religious, ethical, and public policy bodies, including Pope John Paul II in an address to the 35th General Assembly of the World Medical Association, the World Council of Churches, the Parliamentary Assembly of the Council of Europe, the Presidential Commission for the Study of Ethical Problems in Medicine and Biomedical Research, the Office of Technology Assessment, the National Council of Churches, the medical research councils of Canada and Australia, the governments of Denmark and the Federal Republic of Germany, and others. All.have agreed that somatic genetic manipulation for the purpose of ameliorating disease should be pursued (113). Other observers have disagreed (114). The long-awaited first applications of gene transfer techniques to ~ human disease were expected to involve a therapeutic restoration of a disease-related enzyme activity. Approval has recently been given by the NIH Recombinant Advisory Committee, by the director of NIH, and by the Food and Drug Administration for a study of the fate of tumor-infiltrating lymphocytes (TIL cells) (115, 116) after in vitro infection with a retrovirus expressing neo (as a selectable marker) and subsequent reimplantation into donor cancer patients. Information from this study is intended to guide further studies on the implantation of vector-infected cells, but the results from this study are likely to be highly specific for the TIL cells, the vector, and the transgene. Similar studies should eventually be carried out for other combinations of genes, target cells, and vectors before large- scale human clinical studies can be undertaken. Deliberate or inadvertent modification of human germ line cells can presumably occur by many of the same methods described here. The potential role of germ line manipulation for the prevention of genetic disorders is far less clear than is somatic cell modification, and one response to the possibility of germ line genetic modification has been to suggest that it is so full of technical and ethical uncertainties that it should not be performed. However, it seems unwise and premature to take such a severe position, and it has been suggested that the need for efficient disease control or the need to prevent damage early in development or in inaccessible cells may eventually justify germ line therapy. This most problematical of all issues in gene therapy requires much more examination. Summary The development of viral and other methods to transfer functional genes stably into human and other mammalian cells continues to make progress, and a logically consistent technical and ethical basis has been established for the application of these techniques to the amelioration of human disease. Efficient gene transfer in vitro and in vivo and genetic correction by site-specific targeting of many disease-related genes are becoming feasible. Many problems remain to be solved, and continuing responsible and informed scientific and public discussion is required to identify suitable applications. An- swers to the commonly asked technical questions, "When can we expect to see the first successftil human clinical applications?" and "Which disease is the best candidate?" are of minor importance compared with the realization that this conceptually new approach to the treatment of disease is a response to a medical need and is achieving increasing medical, scientific, and ethical acceptance. REFERENCES AND NOTES 1. T. Friedmann and R. Roblin, Science 175, 949 (1972). 2. D. Jackson et al., Proc. Natl. Acad, Sci. U.S.A. 69, 2904 (1972). 3. T. Friedmann, Ann. N.Y. Acad. Sci. 265, 141 (1976). 4. Gene Therapy: Fact and Fiction (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983). 5. W. F. Anderson, Science 226, 401 (1984). 6. M. J. Cline, Am. J. Med. 83, 291 (1987). 7. S. H. Orkin and D. A. Wiliams, Prog. Med. Genet. 7, 130 (1988). 8. M. J. Cline et al., Nature 284, 422 (1980). 9. K. E. Mercola et al., Science 208, 1033 (1980). 10. T. Doetschman et al., Nature 330, 576 (1987). 11. M. Jasin and P. Berg, Genes Dev. 2, 1353 (1988). 12. S. L. Mansour, K. R. Thomas, M. R. Capecchi, Nature 336, 348 (1988). 13. M. A. Frohman and G. R. Martin, Cell 56, 145 (1989). 14. I. Date, K. Kawamura, H. Nakashima, 6zp. Brain Res. 73, 15 (1988). 15. F. L. Graham and A. J. Van der Eb, Virology 52, 456 (1973). 16. P. L. Felgner et al., Proc. Nad. Acad. Sci. U.S.A. 84, 7413 (1987). 17. R. Fraley et al., Blood 20, 6978 (1981). 18. R. Fraley and D. Papahadjopoulos, Curr. Top. Microbiol. Immunol. 96, 171 (1982). 19. H. Potter, L. Weir, P. Leder, Proc. Natl. Acad. Sci. U.S.A. 81, 7161 (1984). 20. M. Capecchi, Cell 22, 479 (1980). 21. T. M. Klein, E. D. Wolf, R Wu, J. C. Sanford, Nature 327, 70 (1987). 22. M. M. Gebara et al., Mol. Cell, Biol. 7, 1459 (1987). 23. Y. Gluzman and S. H. Hughes, Viral Vectors (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988). 24. D. H. Hamer, in Genetic Engineering: Principles and Methods, J. K. Setlow and A. Hollaender, Eds. (Plenum, New York, 1980), vol. 2, pp. 83-101. 25. K. L. Berlmer, BioTechniques 6, 616 (1988). 26. J. E. Morin et al., Proc. Natl. Acad. Sci. U.S.A. 84, 4626 (1987). 27. C. J. Tabin et al., Mol. Cell. Biol. 2, 426 (1982). 28. K. Shimotohno and H. M. Temin, Cell 26, 67 (1981). 29. C. Wei, M. Gibson, P. G. Spear, E. M. Scolnick, J. Virol. 39, 935 (1981). 30. H. M. Temin, in Gene Transfer, R. Kucherlapati, Ed. (Plenum, New York, 1986), Pp• 149-187. 31. M. Emerman and H. M. Temin, Cell 39, 449 (1984). 32. E. A. Dzierzak, T. Papayannopoulou, R. C. Mulligan, Nature 331, 35 (1988). 33. D. J. Jolly, R C. Willis, T. Friedmann,,Wo(. Cell. Biol. 6, 1141 (1986). 34. J. C. Stone et al., Somatic Cell A1ol. Genet. 12, 575 (1986). 35. C.-C. Shih, J. P. Stoye, J. M. Coffin, Cell 53, 531 (1988). 36. J.-K. Yce, D. J. Jolly, J. C. Moores, J. G. Respess, T. Fricdmann, Cold Spring Harbor Symp. Quant. Biol. 51, 1021 (1986). 37. S.-F. Yu et al., Proc. Natl. Acad. Sci. U.S.A. 83, 3194 (1986). 38. R. Mann, R. C. Mulligan, D. Baltimore, Cell 33, 153 (1983). 39. W. R. A. Osborne and A. D. Miller, Proc. Natl. Acnd. Sci. U.S.A. 85, 6851 (1988). 40. M. A. Bender et al., J. Virol. 61, 1639 (1988). 41. D. Markowitz, S. Goff, A. Bank, ibid. 62, 1120 (1988). 42. O. Danos and R. C. Mulligan, Proc. Natl. Acad. Sci. U.S.A. 85, 6460 (1988). 43. J. Ellis and A. Bernstein, Gene Targeting with Retrovira! Vectors (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988). 44. B. E. H. Coupar, M. E. Andrew, D. B. Boyle, Gene 68, 1 (1988). 45. B. Moss and C. Flexner, Arutu. Rev. Immunol. 5, 305 (1987). 46. P. L. Hermonat and N. Muzvczka, Proc. Natl. Acad. Sci. U.S.A. 81, 6466 (1984). 47. S. K. McLaughlin et al., J. Virol. 62, 1963 (1988). 1280 SCIENCE, VOL. 24-} 2047~51914
Page 82: brs52e00
occuz ac limited tegions of homology. Heterologous integration can be used to mutagenize and tag genes physically, as with transposons, thereby facilitating their cloning. Rearrangements in integrated plasmids may occur at readily detectable frequencies. The frequency with which the various types of integration events occur varies according to the plasmids and recipient strains or species used. Genomic integration of linear molecules also occurs, often by a process formally equivalent to a double crossover event (Fig. 3A) (31, 32). However, circularization of linear molecules prior to integration can produce tandem duplications (Fig. 3B) (31). Integrated plasmids are mitotically stable. For example, a tandem duplication of the A. nidulans argB locus separated by plasmid sequences, containing or lacking a yeast centromere, was not detectably lost during growth for ?50 generations (30). This high degree of mitotic stability is desirable for genetic engineering of industrial strains, because introduced gene copies will be retained during large-scale fermentations. By contrast, introduced DNA sequences are often meiotically unstable. For example, in A. nidulans, tandemly repeated sequences are lost at variable, but readily detectable, frequencies after selfing or out-crossing (17, 33). During selfing, loss of sequences appears to result at least partially from unequal crossing over, because progeny with additional copies of the reiterated sequences are also obtained. In N. crassa, introduced sequences are often hypermethylated. Duplicated sequences are eliminated at high frequency during the sexual phase by a process called repeat-induced point mutation (RIP) (34). This process has been used to inactivate functional genes in N. crassa where more traditional methods for gene disruption are inefficient (35). Most economically important filamentous fungi lack a sexual phase. Thus, with many species the behavior of inserted DNA sequences in meiosis is irrelevant. Current Applications of Transformation Technology Transformation technology has led to new ways of altering the biological characteristics of fungi and has been used extensively in basic studies of the mechanisms controlling growth, metabolism, and development (36) and for isolation and manipulation of genes of potential importance in medicine, industry, or agriculture. Gene cloning. Efficient techniques for cloning genes by genetic complementation of mutations have been developed for A. nidulans and N. crassa. A. nidulans plasmid (37) and cosmid (33) vectors have been constructed that permit (i) cloning of random chromosomal DNA fragments, (ii) transformation of mutant strains by primary selection for prototrophy or drug resistance, and (iii) testing for complementation of mutations identifying genes to be cloned. Complementing DNA molecules can be recovered in two ways. First, with cosmid clones, genomic DNA is treated with a bacteri- ophage lambda in vitro packaging extract, and cosmids are recov- ered by transduction of E. coli (33). Second, with either cosmid or plasmid clones, genomic DNA is partially digested with a restriction enzyme, ligated at low concentration, and used to transform Esche- richia coli cells. A rapid procedure for mapping mutation-comple- menting DNA fragments in cloned inserts has been developed (38). These approaches have been used to clone and map numerous A. nidulans genes that were previously identified only by their mutant phenotype. Cosmid vectors have also been used to clone many genes from N, crassa. Problems with DNA rearrangements have impeded the direct complementation-recovery approach used with A. nidulans, but may be overcome by use of E. coli strains that are tolerant of methylated DNA (39). Alternatively, ordered collections of genomic clones 16 JUNE 1989 A B Linear DNA Plasmid ~ fragment Chromosome Chromosome j R bi Recombinant ~~ ecom nant ~ 7---~r chromosome chromosome Fig. 3. Transformation with linear DNA fragments. Representation of DNA sequences is as in Fig. 2. (A) Double crossover or gene conversion event at the homologous chromosomal site. (B) Single crossover event ofcircularized DNA at the homologous chromosomal site. constructed with drug resistance cosmids (40) may be used. In this case, DNA from dichotomously divided pools of clones is tested for its ability to complement a mutation until a single complementing clone is identified (sib selection). The method is quite rapid and efficient once DNA has been isolated from the many subcollections needed. Cloned DNA fragments may complement a mutation by expres- sion of the wild-type function or by extragenic suppression. With A. nidulans, proof of cloned sequence identity can be made by genetic mapping or complementation analysis in diploids or merodi- ploids (33, 41). In N. crassa, which does not form stable diploids, gene identity can be inferred from tight linkage of the complement- ing DNA fragment and the target gene. Such mapping is simplified by a set of polymorphic strains constructed by Metzenberg (42). RIP-mediated gene inactivation can also be used to establish gene identity. Analogous techniques should be possible with less well characterized species. Cosmid rescue has also been used to clone genes from one species by detecting their expression in a different species. For example, a disease-determinant gene, pisatin demethylating ability (PDA), from the phytopathogenic fungus Nectria haematacocca was cloned by detecting its expression in A. nidulans (43). It should be possible to use identical or related strategies to isolate genes of interest from many other fungal species. Targeted insertions and directed mutatioru. Insertion of plasmids at specific chromosomal sites is important for analysis of mutations generated in vitro (to avoid or test for chromosome position effects) and for making targeted in vivo mutations. Convenient techniques exist for selection of plasmid integration events at predetermined sites. For example, in A. nidulans, yA is required for production of spore pigment, and mutants produce yellow instead of green spores (44). An internal yA restriction fragment can be incorporated into transformation plasmids so that homologous integration results in formation of readily selectable yellow-spored mutants (Fig. 4A) (45). Alternatively, a strain containing one mutant allele can be transformed with a plasmid containing a different mutant allele (Fig. 4B) (46). In this case, only homologous recombination events regenerate a selectable wild-type allele. In a related approach, a linear DNA fragment containing one mutant allele linked to a sequence to be inserted can be used to transform a strain containing a different mutant allele (Fig. 4C) (47). Transformants containing a regenerat- ed wild-type allele frequently contain the linked sequence. Directed inactivation of preselected genes can be accomplished with many filamentous fungi. For example, Miller et al. (31) showed that direct and indirect gene replacement techniques modeled after the yeast procedures of Scherer and Davis (48) and Rothstein (49) are effective with A. nidulans. As in yeast, linearization of circular plasmids by cutting within the target sequence increases the fre- quency of recombination at the desired site. These techniques have been used to prove the identity of newly cloned genes (41) and in attempts to determine the physiological functions of cloned genes with unknown functions (50). With yeast it is possible to make a directed mutation of an essential gene in a diploid and then to prove it is essential by tetrad 204'7-0 5 19i'9 ARTICLES 1315
Page 83: brs52e00
I Stop filing index cards and misplacing references! Organize them \nstead, with a specially designed database pro- gram called Pro-Cite•. Pro-Cite makes it easy to manage references. Now you can sort, search, or index refer- ences from journal articles, books, or any other source. Keep references organized, include long abstracts or notes, and for- mat bibliographies in any style. Pro-Cite puts references in order. Call (313) 996-1580 today. Pro- Cite is available for IBMO PCs and the Macintosha and the programs are data compatible. Other PBS prod- ucts include Biblio-Links" (compan- ~~ ion programs that transfer records into ~ci, Pro-Cite) and Pro-Search' (a specialized communications program for searching BRS and DIALOG (IBM only)). Pro-Cite is now NOTcopy protected. liii 10 Personal P.O. Box 4250 Bibliographic Ann Arbor, MI 48106 Software, Inc. (313) 996-1580 In Canada, contact Phipps & Assoc 512 Speedvale AveE. Guelph, ON N1E 1P4 (519) 836-9328 Ttu rolow9np ue traiamarlcs a reyistered tra0emarks. ProCtle, &bfa-Latk Pro-Search d Persanal B~hkographic SofP~me, Ir!c.. I&N d Intemationm 8usineBa 1Aaa6u. Cap , Maaintosh d App4 Comp.Mf. Inc. Circle No, 214 on Readers' Service Card Circle No. 259 on Readers' Service Card And the PIPs. NewPIP2 New PIP '~ ~ )~ V'-' ' AMP RIA ! New C clic S Y ~ . New Cyclic GMP RIA ) 01 ~ Just watch them perform. Advanced Magnetics presents the PIPs, the first immunoassays for PIP, and PIP. Highly sensitive, enzyme-labeled immuno- blots, the PIPs are easy to set up and run, and require no incubation with radioactive materials. 'Ibgether with new Cyclic GNiP and AhiP RUs, they are major attractions in our growing line of For research only. Notfor use in human clinical diagnosis. SECOND ANNUAL NIH/ADAMHA-INDUSTRY COLLABORATION FORUM October 3, 1989 Naflonai Institutes of Health Bethesda, MD The purpose of the Forum Is to promote research collaboration between government scientists and Industry, as encouraged by the Federal Technology Transfer Act of 1986. These collaborations may lead to mutually advantageous license agreements. Registration fee for the forum is 5100. For further information, call or write: Ms. Judy Gale Social & Scienllfic Systems 7101 Wisconsin Avenue, Sulte 610 Bethesda, MD 20814 (301) 986-4886 second messenger assays. Satisfaction is guaranteed. Take a closer look at all our high performance assays, including eicosanoids and cytokines. Call or write today for our 1989 catalog. Advanced ;ti•fagnetics Inc. 1-800-RL1-KITS 61 Mooney Street 1-800-343-1346 Cambridge, N11=102138 617-497-2070 FAX 617-497-6927 16 JUNE 1989 Circle No. 73 on Readers' Service Card 1321
Page 84: brs52e00
l C enetic Engineering of Filamentous Fungi WILLIAM E. TIMBERLAKE AND MARGARET A. MARSHALL I Filamentous fungi are important in medicine, industry, agriculture, and basic biological research. For example, some fungal species are pathogenic to humans, whereas others produce (3-lactam antibiotics (penicillin and cepha- losporin). Industrial strains produce large amounts of enzymes, such as glucosamylose and proteases, and low molecular weight compounds, such as citric acid. The ~ largest and most economically important group of plant ~ pathogens are fungi. Several fungal species have biological ~ properties and genetic systems that make them ideally ~ suited for basic biological research. Recently developed techniques for genetic engineering of filamentous fungi ~ make it possible to alter their detrimental and beneficial activities in novel ways. T HE FUNGI ARE A DIVERSE GROUP OF ORGANISMS WHOSE beneficial and detrimental biological activities have a major impact on human affairs (1). For example, fungi are used to produce the important antibiotics penicillin and cephalosporin. By contrast, some fungal species synthesize and excrete highly toxic metabolites, such as aflatoxins. Fungi are used as food (for example, mushrooms) and in food preparation (for example, bread), produc- tion of food additives (for example, citric acid) and fermentation of beverages (for example, beer and wine). However, billions of dollars of crop losses are annually attributed to diseases and post-harvest food spoilage caused by fungi. Crop devastation by fungi has led to starvation of large populations and to major social displacements, as during the potato famine in Ireland. Fungal pathogens have gained in medical importance as the number of immunologically compro- mised patients has climbed as a result of AIDS and owing to increased use of chemical and radiation therapies in the treatment of cancer and in association with organ transplants. Because of their relative simplicity, several fungal species have been used as "model" biological systems. The importance of fungi in medicine, industry, agriculture, and science has led to their intensive investigation for many years with the aim of understanding and controlling their desirable and undesirable activities. Fungi grow as either unicellular yeasts or multicellular filaments. Yeasts multiply vegetatively by budding, as in Saccharomyces cerevisi- ae, or by fission, as in Schizosaccharomyces pombe. By contrast, filamentous fungi form multinucleated, tubular filaments called hyphae that are functionally coencytial and grow by apical extension (Fig. 1). Solutes and macromolecules are transported more or less freely between cells through perforate septa, but organellar move- ment may be restricted. Multicellular structures are formed during the asexual and sexual reproductive phases of filamentous fungi. The filamentous growth habit of fungi underlies their ability to compete in nature with other microorganisms. Fungi can quickly colonize large areas and secrete chemicals to favor fungal growth. As nutrients are depleted near the center of a fungal colony, hyphal tips extend to exploit new resources. Hyphae can extend considerable distances over non-nutritive substrates by using endogenous stores. The extension of hyphal tips generates a mechanical force capable of disrupting even complex polymeric substrates such as wood. Extra- cellular hydrolytic enzymes secreted by fungi release low molecular weight, readily metabolized compounds from polymers. The meta- bolic diversity of fungi is extraordinary, making it possible for them to degrade even many refractory man-made compounds. The most intensively studied fungus is the unicellular yeast S. cerevisiae. However, filamentous fungi, most notably Neurospora crassa and Asperigillus nidulans, have been used for fundamental physiological, biochemical, and genetic studies that have contribut- ed to our understanding of the mechanisms controlling eukaryotic growth, differentiation, and development. The molecular genetic systems of these organisms have served as the basis for development of similar systems in less tractable but economically important species. In this article, we review the development of DNA- mediated transformation procedures for filamentous fungi, focusing on N. crassa and A. nidulans. We describe the ways in which these procedures have been used to modify the genetic compositions of target organisms and discuss how they may be used to modify the biological activities of economically important fungi. Getting DNA into Cells Genetic engineering of filamentous fungi depends on genomic incorporation of exogenously added DNA. DNA-mediated trans- formation procedures have been modeled after those developed for S. cerevisiae (2). Cell walls are usually removed by treatment of germinated spores or hyphae with cell wall-degrading enzymes to produce osmotically sensitive cells (OSCs) (3). Digestion of fungal cell walls has sometimes been difficult, but the introduction of Novozym 234, a commercially available hydrolytic enzyme mixture secreted by the filamentous fungus Trichoderma harzianum, has largely eliminated this problem. The hyphae of most fungi are highly susceptible to this enzyme preparation, which has been widely used to produce OSCs. Once cell walls have been perforated or removed, transforming DNA is added in the presence of CaZ+, and OSCs are induced to fuse by addition of polyethylene glycol (PEG). DNA molecules are apparently internalized during fusion, as no transfor- mation occurs when PEG is omitted (4). Fused OSCs are plated on an osmotically balanced regeneration medium that selects for cells expressing the functions supplied specifically by the added DNA The authors are in the Depacmiens of Genetics and Plant Pathology, University of Georgia, Athens, GA 30602. 16 JUNE 1989 ARTICLES 1313
Page 85: brs52e00
1 r, genes from the T-DNA region, thereby eliminating the ability of the bacteria to induce aberrant cell proliferation (6). Modem plant transformation vectors are capable of replication in Escherichia coli as well as Agrobacterium, allowing for convenient manipulations (7). The general features of these vectors and the process of transfer to plant cells are outlined in Fig. 1. Recent technological advances in vectors for Agrobacterium-mediated gene transfer have involved im- provements in the arrangements of genes and restriction sites in the plasmids that facilitate construction of new expression vectors. Vectors in current use have convenient multilinker regions, which may be flanked by a promoter and a polyadenylate addition site for direct expression of inserted coding sequences (8). Agrobacterium constitutes an excellent system for introducing genes into plant cells, since (i) DNA can be introduced into whole plant tissues, which bypasses the need for protoplasts, and (ii) the integration of T-DNA is a relatively precise process. The region of DNA to be transferred is defined by the border sequences; occasion- al rearrangements do occur, but in most cases an intact T-DNA region is inserted into the plant genome (9). This contrasts with free DNA delivery systems in which the plasmids routinely undergo rearrangment and concatenation reactions before insertion and can lead to chromosomal rearrangements during insertion in both animal (10) and plant (11) systems. Sequencing of insertion sites shows that only small duplications or other changes occur in flanking sequences during T-DNA integration (12). The stability of expression of most genes that are introduced by Agrobacterium appears to be excellent. Published studies have shown that integrat- ed T-DNAs give consistent genetic maps and appropriate segrega- Fig. 1. Agrobacterium-medi- A Inserted Gene ated plant transformation. l IG 1 End-Border (A) Generalized plant trans- formation vector (PTV). The plasmid contains an ori- gin of replication that allows Start-Border it to replicate in Agrobacter- ium (Ori-Agro), and a high copy number origin of repli- cation functional in E. coli (Ori-E. coli). This allows for easy production and testing of engineered plasmids in E. coli prior to transfer to Agro- bacterium for subsequent in- troduction into plants. Two resistance genes are usually carried on the plasmid, one for selection in bacteria, in this case for spectinomycin resistance (Spc`), and the other that will express in plants; in this example en- coding kanamycin resistance (Kan'). Also present arc sites for the addition of one or more inserted genes (IG) and directional T-DNA bor- der sequences which, when recognized by the transfer functions of Agrobacterium, 9 B E. colt Agrobacterium delimit the region that will be transferred to the plant. (B) Diagram of the plant transformation process. The PTV constructed in E. coii is transferred to an engineered Agrobacterium by a "triparental" mating procedure (6). The engineered Agrobacterium contains a "disarmed" Ti plasmid (D-Ti) from which the genes necessary for pathogenesis have been removed (6). Viru- lence functions on the D-Ti interact in trans with the border sequences on the PTV mobilizing the region between them into a plant cell and inserting it into one of the plant's chromosomes within the nucleus. The kanamycin- resistant phenotype conferred by the Kan` gene allows the selection of transformed plant cells during plant regeneration. 1294. tion ratios (1, 13). Introduced traits have been found to be stable over at least five generations during cross-breeding and seed increase on genetically engineered tomato and oilseed rape plants (14). This stability is critical to the commercialization of transgenic plants. The list of plant species that can be transformed by Agrobacterium has been greatly expanded and now includes several of the most important broadleaf crops (Table 1). Advances in other transformation technologies. In those systems where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer. Few monocotyledonous plants appear to be natural hosts for Agrobacterium, although transgenic plants have been produced in asparagus with Agrobacterium vectors (15) and transformed tumors have been observed in yam (16). Cereal grains such as rice, corn, and wheat have not been successfully transformed by Agrobacterium, despite encouraging evidence for T-DNA transfer in corn (17). Extensive efforts have consequently been directed toward the devel- opment of systems for the delivery of free DNA into these species. The first of these systems to give demonstrable transformation of plant cells relied on physical means similar to those used in the transformation of cultured animal cells. Transformation has been achieved in plant protoplasts through facilitation of DNA uptake by calcium phosphate precipitation, polyethylene glycol treatment, electroporation, or combinations of these treatments (18). These methods have allowed the production of transgenic cells for the study of gene expression in systems that cannot be transformed by other means (19). The applicability of these systems to the production of transgenic plants is limited by the difficulties involved in regenerating plants from protoplasts. There have been significant advances in the regeneration of cereals (traditionally one of the most recalcitrant groups) from protoplasts. Several laboratories have succeeded in regenerating fertile rice plants from protoplasts (20). This advance was rapidly followed by the production of transgenic rice plants through the delivery of free DNA to protoplasts followed by regeneration (21). Progress in regeneration of com has been more limited; one group demonstrated regeneration of mature plants from protoplasts and succeeded in producing transgenic plants (22, 23). However, all plants were sterile, apparently as a result of the necessary period in culture or the regeneration procedure. While this progress is encouraging, limitations remain in the application of this technology to cereal crop improvement. In corn and rice, the ability to form regenerable protoplasts appears to be primarily confined to a small number of varieties. Even if the fertility problems are overcome, introduction of the transferred genes into the broad range of commercial varieties in use today would require a lengthy period of backcrossing. In parallel with the work on protoplast transformation, efforts to find novel ways to introduce DNA into intact cells or tissues have been emphasized. Regeneration of cereals from immature embryos or from explants is relatively routine (24). One of the most significant developments in this area has been the introduction of "particle gun" or high-velocity microprojectile technology. In this system, DNA is carried through the cell wall and into the cytoplasm on the surface of small (0.5 to 5 µm) metal particles that have been accelerated to speeds of one to several hundred meters per second (25-27). The particles are capable of penetrating through several layers of cells and allow the transformation of cells within tissue explants. Production of transformed corn cells (28) and fertile, stably transformed tobacco (26) and soybean (27) plants with particle guns has already been demonstrated. By eliminating the need for passage through a protoplast stage, the particle gun method has the potential to allow direct transformation of commerical genotypes of cereal plants. Intensive efforts to produce transgenic cereals by the 2047651958 SCIENCE, VOL. 2q.4.
Page 86: brs52e00
Table 7. Effects of MTbGH expression on relative organ weight in transgenic pigs. Eight sex- and age-matched (range, 4.5 to 10 months) transgenic and control G2 animals from line 37-06 were used. Values are adjusted mean organ weights as a percentage of body weight. Sample means from control and transgenic groups were compared for significance by covariance analysis to adjust for age. Organ Control MTbGH SEM P Heart 0.35 0.44 0.02 0.013 Liver 1.69 2.53 0.15 0.002 Kidneys 0.37 0.61 0.03 0.0001 Adrenals 0.0048 0.0101 0.0007 0.0002 Thyroid 0.011 0.016 0.001 0.016 Table 8. Effects of MTbGH expression on bone measurements in transgenic pigs. Bone weight is a percentage of total body weight. Values are least- squares means and SEM for four control and four transgenic pigs except for femur weight where data are for eight control and eight transgenic pigs. V l i ht W Length Circumference a ue g e (cm) (cm) Control 0.31 Humerus 18.75 8.90 'vITbGH 0.41 18.25 10.40 SEM 0.02 0.58 0.23 P 0.025 0.57 0.006 Control 0.34 Femur 20.93 8.75 MTbGH 0.44 20.13 10.38 SEM 0.02 0.60 0.41 P 0.003 0.39 0.04 other cell types, thereby not interfering with the B cell function. Although expression of immunoglobulin genes of defined specificity would represent a general strategy, other approaches that would take advantage of pathogen receptors, mode of replication, or production of specialized gene products can be envisaged. The third approach that has received attention is that of using animals to synthesize proteins of medical value. This would be particularly valuable for the production of proteins that cannot be synthesized in their active form by microorganisms, such as blood- clotting enzymes that require covalent modifications for activity. These proteins might be produced either in blood or milk under the control of regulatory elements from genes that are expressed in liver or mammary gland, respectively. Low levels of human ti'ssue plasminogen activator and coagulation factor IX have been secreted into the milk or blood of transgenic mice (46) and most recently into the milk of transgenic sheep (47). Further improvements in the gene constructs could result in improved levels of gene expression that might make this a viable proposition. One problem will be the purification of the human protein from contaminating animal proteins: this could be particularly difficult if the human protein needs to be separated from the animal equivalent. Another potential problem is that the human protein produced in animal cells might not have exactly the same covalent modifications, such as glycosyla- tion, as those produced in human cells. These differences might render the human protein immunogenic and thus restrict its pro- longed use. These problems are not unique to protein production in transgenic animals and may be circumvented by appropriate engi- neering of the transgene. If high levels of protein production can be achieved in transgenic animals, this could be a very cost-effective means of producing medically important proteins. Each of these ideas has inherent problems, and our experience to date is that in the process of making transgenic animals many other problems will become apparent. However, from the point of view of 16 JUNE 1989 basic research, we anticipate that many aspects of genetic control and animal physiology will be unraveled as a consequence of trying to understand the results obtained when expressing novel gene constructs in transgenic animals: In addition, the continued extrapo- lation of these techniques to farm animals will ultimately result in more productive and healthier livestock. REFERENCES AND NOTES 1. R. D. Palmiter and R. L. Brinster, Annu. Rev. Genet. 20, 465 (1986); R. L. Brinster and R. D. Palmiter, Harvey Lectures, Series 80 (Liss, New York, 1986), pp. 1-38; R. Jaenisch, Science 240, 1468 (1988). 2. R. D. Palmiter et al., Nature 300, 611 (1982). 3. O. Isaksson, C. Binder, K. Hall, B. Hokfelt, Eds., Growth Hormone: Basic and Clinical Aspects (Excerpta Medica, Amsterdam, 1987). 4. R. E. Hammer, R. L. Brinster, R. D. Paltniter, Cold Spring Harbor Symp. Quant. Biol. 50, 379 (1985). 5. C. D. Nancarrow, K. A. Ward, J. D. Murray, Aust. J. Biotech. 2, 39 (1988). 6. R. D. Palmiter, G. Norstedt, R. E. Gelinas, R. E. Hammer, R. L. Brinster, Science 222, 809 (1983). 7. J. M. Orian, C. S. Lee, L. M. Weiss, M. R. Brandon, Endocrinology 124, 455 (1989). 8. R. E. Hammer, R. D. Palmiter, R. L. Brinster, in Endocrinology, F. Labrie and L. Proulx, Eds. (Elsevier Science, Amsterdam, 1984), pp. 267-270. 9. R. E. Hammer, R. L. Brinster, M. G. Rosenfeld, R. M. Evans, K. E. Mayo, Nature 315, 413 (1985). 10. L. S. Mathews et al., Endo~.-rinology 123, 2827 (1988). 11. R. E. Hammer et al., Nature 315, 680 (1985). 12. G. Brem et al., Zuchthygiene 20, 251 (1985). 13. R. E. Hammer et al., J. Anim. Sci. 63, 269 (1986). 14. V. G. Pursel et al., Vet. Immunol. Immunopathol. 17, 303 (1987). 15. R. J. Wall, V. G. Pursel, R. E. Hammer, R. L. Brinster, Biol. Reprod. 32, 645 (1985). 16. R. L. Brinster, H. Y. Chen, M. E. Trumbauer, M. K. Yagle, R. D. Palmiter, Proc. Natl. Acad. Sci. U.S.A. 82, 4438 (1985). 17. R. L. Brinster et al., unpublished data. 18. P. D. Vize et al., J. Cell Sci. 90, 295 (1988). 19. K. M. Ebert et al., Mol. Endocrinol, 2, 277 (1988). 20. K. F. Miller et al., J. Endocrinol. 120, 481 (1989). 21. R. D. Palmiter, H. Y. Chen, R- L. Brinster, Cell 29, 701 (1982). 22. T. Lf. Wilkie, R. L. Brinster, R. D. Palmiter, Dev. Biol. 118, 9 (1986). 23. V. G. Pursel et al., J. Reprod. Fertil. Suppl., in press. 24. J. P. Hughes and H. G. Friesen, Annu, Rev. Physiol. 47, 469 (1985); L. S. Mathews, G. Norstedt, R. D. Palmiter, Proc. :V'atl. .9cad. Sri. U.S.A. 83, 9343 (1986). 25. L. S. Mathews, R. E. Hammer, R. L. Brinster, R. D. Palmiter, Endocrinology 123, 433 (1988). 26. K. E. Mayo et al., Mol. Endocrinol, 2, 606 (1988); L. A. Frohman et al., Ann. Meeting Endocrine Soc. (1988), p. 661. 27. C. M. Fraser and A. Mays, Eds., The Merck Veterinary Manual (Merck, Rahway, IvJ, 1986), pp. 1059-1062. 28. R. E. Hammer, R D. Palmiter, R. L. Brinster, in Advances in Gene Technology: Human Genetic Disorders, F. Ahmad et al., Eds. (ISCO Press, Miami, 1984), vol. 1, pP• 52-55. 29. D. M. Durnam and R. D. Palmiter, J. Biol. Chem. 256, 5712 (1980). 30. C. J. Quaife et al., Endocrinology 124, 40 (1989). 31. T. Doi et al., Am. J. Pathol. 131, 398 (1988). 32. R. E. Hammer, R. D. Palmiter, R, L. Brinster, Nature 311, 65 (1984). 33. A. Bartke et al,, J. Exp. Zool. 248, 121 (1988). 34. C. M. Evock, T. D. Etherton, C. S. Chung, R. E. Ivy, J. Anim. Sci. 66, 1928 (1988). 35. J. J. O'Brien, in Diseases of Swine, A. Leman et al., Eds. (Iowa State Press, Ames, ed. 6, 1986), pp. 725-737. 36. R. F. Ross, ibid., pp. 469-483. 37. S. Reiland, N. Ordell, N. Lundeheim, S. Olsson, Aaa Radiol. Suppl. 358, 123 (1978); W. R. Perrin, F. X. Aberne, J. P. Bowland, T. Hardin, Can. J. Anim. Sd. 58, 129 (1978); C. S. Carlson, H. D. Hilley, D. J. Meuten, J. M. Hagan, R. L. Moser, .9m. J. Vet. Res. 49, 396 (1988). 38. C. S. Chung, T. D. Etherton, J. P. Wggins, J. Anim. Sri. 60, 118 (1985). 39. R. G. Campbell et al., ibid. 66, 1643 (1988). 40. B. T. Shea et al., Endocrinology 121, 1924 (1987). 41. R. H. McCuskcr and D. R. Campion, J. Anim. Sri. 63, 1126 (1986). 42. R Grosschedl, D. Weaver, D. Baltimore, F. Costantini, Cell 38, 647 (1984). 43. S. Rusconi and G. Kohler, Nature 314, 330 (1985). 44. U. Storb et al., J. Exp. Med. 164, 627 (1986). 45. K. A. Ritchie, R. L. Brinster, U. Storb, Nature 312, 517 (1984); D. Weaver, F. Costantini, T. Imanishi-Kari, D. Baltimore, Cel142, 117 (1985); A. Iglesias, M. Lamers, G. Kohler, Nature 330, 482 (1987); M. C. Nussenzweig et al., Science 236, 816 (1987); J. Manz, K. Denis, O. White, R. L. Brinster, U. Storb, J. Exp. Med. 168, 1363 (1988); M. S. Neuberger, H. M. Caskey, S. Petersson, G. T. Williams, M. A. Surani, Nature 338, 350 (1989). 46. K. H. Choo, K. Raphael, W.1bfcAdatn, M. G. Peterson, Nucleic Acids Res. 15, 871 (1987); K. Gordon et al., Bio/Technology 5, 1183 (1987); C. W. Pittius et al., Proc. Nat1. Acad, Sri. U.S.A. 85, 5874 (1988). 47. A. J. Clark et al., Bio/Technology 7, 487 (1989). 2047 0" 519.51 ARTICLES 1287
Page 87: brs52e00
of compounds having structural elements or subsrituents rarely found in nature (41). Critical to the evolution of new metabolic activities is the relaxation of substrate specificity of enzymes and regulators without a concomitant loss in function (41, 44). Labora- tory selection can speed up this process and provide control not available under natural conditions (42). Metabolic pathways can be engineered in the laboratory by (i) long-term batch incubations, (ii) soil perfusions, (iii) chemostat selection, (iv) in vivo genetic trans- fers, or (v) selection for the evolution of new catabolic or regulatory functions or the assembly of a new pathway in vitro (41, 42, 44). The first four techniques have been used to derive bacteria able to degrade a variety of xenobiotic and toxic wastes (Table 1). The first multiplasmid-containing strain constructed in the laboratory (45) was capable of oxidizing aliphatic, aromatic, terpenic, and lower molecular weight polynuclear aromatic hydrocarbons. This strain grew faster on crude oil than any of the parental isolates, and although it was patented in a landmark case, which recognized for the first time that man-made microbes were patentable (45), it has not been used commercially. The metabolic diversity of this strain was fairly limited compared to the actual number of compounds present in crude oil (>3000), and it did not degrade higher molecular weight, condensed, or substituted hydrocarbon com- pounds, which tend to persist in the environment. In vitro strain constructions require detailed genetic and biochem- ical information on the degradative pathways, which is nonexistent for many xenobiotics (42). When sufficient biochemical and genetic information has been available, genetic engineering of metabolic pathways for recalcitrant compounds was successful (42, 44). For example, broad-specificity enzymes were recruited to extend the chlorocatechol pathway in several bacteria so that the degradation of chlorinated compounds through the tricarboxylic acid cycle was enhanced. Pseudomonas B 13 has a pathway for the complete degrada- tion of chlorocatechols, but the first enzyme of its chlorobenzoate pathway, which is encoded by chromosomal genes, has narrow substrate specificity (44). Recruitment of a broad-specificity dioxy- genase from a toluene catabolic plasmid enabled this strain to degrade a wider range of chlorobenzoates and additional chloroaro- matics after deleting an enzyme that misrouted intermediates to the meta-ring cleavage pathway rather than to the normal ortho-ring cleavage pathway (44). Biodegradation processes at contaminated waste sites may be limited if complex mixtures of xenobiotics are present, if the inducer of the degradative pathway is not present, or if the pathway is blocked by inhibitors. Although individual chemicals can be com- pletely degraded in soil and wastewater treatment plants, mixtures sometimes cannot (41). For example, dead-end metabolites result when chlorocatechols are cleaved by a meta-fission pathway and when methylcatechols are cleaved by an ortho-fission pathway. This nonproductive routing of degradation products during simulta- neous degradation of chloro- and methyl-substituted aromatics can actually destroy the functioning of the biodegrading community (41). Enzyme recruitment overcame this problem by constructing catabolic routes with only one ring-fission mechanism (ortho- pathway) for chloro- and methylaromatics (41). The control of catabolic pathways can also be modified by placing key biodegrada- tive enzymes that require inducers, some of which are pollutants themselves, under the control of new regulatory regions. For example, genetic engineering has been used to uncouple the Pseudo- monas mendocina toluene monooxygenase genes from toluene induc- tion, to derive Pseudomonas transconjugants that constitutively ex- press the 2,4-dichlorophenoxyacetic acid degradation pathway, and to derive E. coli recombinant strains with enhanced polychlorobi- phenyl degradative activity in the presence of exogenous catabolite repressor substances compared to the wild-type Pseudomonas donor strain (38, 46). The cloning of genes for modified enzymes that have useful catabolic properties (such as relaxed substrate-specificities or enhanced induction capabilities) provides an important repository of genetic diversity for future research (Table 2). Production of Chemicals and Fuels Recombinant DNA technology is having an impact on the microbial production of industrial chemicals and fuels (47). Plans have been announced for the production of amino acids on a commercial scale with recombinant bacteria including Bacillus amylo- liquefaciens and Lactobacillus casei (47). Genetic engineering has been applied to fermentation processes to enable bacteria to use a wider variety of feedstocks, to biosynthesize new products, to accumulate intermediate metabolites via blocked pathways, or to increase product yields by enhanced synthesis of special enzymes. In many commercial fermentation processes the cost of raw materials is the most expensive component (47). Industrially useful bacteria can be modified to use cheaper feedstocks such as D-xylose, lignocellulose, or cellulose. Zymomonas mobilis transconjugants were able to use lactose when they contained the E. coli lactose operon under the control of a Z. mobilis promoter and the genes for galactosc utilization from E. coli (48). The activity of cellulase synthesized in Z, mobilis was increased sixfold by placing a cellulase gene from Cellulomonas uda under the control of a strong Z. mobilis chromosomal promoter (48). An alternate approach for improving the economics of ethanol production has been to transfer Z. mobilis genes encoding the appropriate enzymes into other organisms, such as E. coli or Klebsiella (49). The genes encoding essential enzymes of the fermentative pathway for ethanol production in Z. mobilis were expressed at high levels in E. coli. The recombinant strain metabo- lized glucose and xylose to give almost the maximum theoretical yield of ethanol with significant decreases in the yields of formate, acetate, lactate, and butanediol (49). Similar results in strains of Klebsiella planticola have been obtained (49). There are many bioprocessing applications for thermotolerant microbes and enzymes (47, 50), but genetic approaches with ther- mophiles have only recently been initiated (Table 2). The isolation of a highly transformable thermophile, Bacillus stearothermophilus, may facilitate advances in cloning thermophilic traits (50). Thermo- stable enzymes may also be produced by cloning their genes from thermophiles, provided selection for enzy tne function can be achieved (50). Mineral Processing Most major copper mining companies use microbial extraction technology to obtain 10 to 20% of the world copper supply; microbial leaching of uranium is also used in Canada (51). Leaching rates are generally slow and metal recovery from the leachate is expensive. Commercial bioleaching operations in the mining indus- try are typically conducted outdoors with ores in heaps or pits, so many of the problems regarding introduction and establishment of improved bacterial strains apply to mining applications of biotech- nology. Microbes responsible for the solubilization of metals tend to be acidophilic (51). Many are chemolithotrophs and obtain energy from the oxidation of iron or sulfur found in ores such as pyrite, arsenopyrite, or chalcopyrite. Thiobacillus ferrooxidans is thought to play the main role in most metal-leaching operations (51). Genetic technology as applied to this group of microbes is not as advanced as for other species largely because of the unusual conditions required to grow them (51). Recently, plasmids have been constructed that ARTICLES 1303 i
Page 88: brs52e00
turn and random coil or extended p regions. It appears that the water-inserted segments can adopt virtually the entire spectrum of the contiguous conformations in the ~), ~ space. The 21 segments with 4- 1 hydro- gen bonds represent the classical reverse turns, namely, types I, II, and III, and are centered at any of the four possible adjacent pairs of residues (i, i+ 1; i+ 1, i+ 2; i + 2, i + 3; and i + 3, i + 4) in the penta- peptide segments. The type-III turns occur most frequently, followed by the type-I and 18 0 60 3- -sa ,. ++ + ++ + + ++* ++ f + - + + ++ -180 -8o 60 180 0 Fig. 3. The plot of the ~), LP angles (indicated as crosses) of the water-inserted local pentapeptide segments, superimposed on a Ramachandran map. The distribution of the ~), ty values indicates the considerable conformational flexibility dis- played by these segments ranging from the vari- ous types of reverse turns to the open turn and the extended (3 strand. The water-inserted segments show a propensity for the "neck" region, compris- ing the type-I and type-III turns, indicating that the pathway in the conformational transition of the folding-unfolding process involves the turns. The crosses in the outlying regions are glycines. Fig. 4. Representative hydrated segments observed in protein crys- tal structures. (A) Water molecule bound externally only to helix car- bonyl 0 atom (1ECD, residues 102 to 106,d1=2.8A,d2=2.9 A, 01 = 124°, and 02 = 163°). (B) Water molecule bound to both the carbonyl and the amide groups, where the amide proton is involved in a three-center hydrogen bond (4TNC, residues 86 to 90, d 1= 2.7 A, d2 = 2.8 A, d3 = 3.2 A, 01 = 114°, 92 = 170°, and 03 = 116°; 02 + 63 + 04 = 348°). (C) Insertion of a water molecule disrupting the helix hydrogen bond and the formation of a type-III turn (5CPA, residues 283 to 287, dl = 3.1 A, d3 = 3.0 A,91 = 140°, and 83 = 172'). (D) Same as (C), D type-II turns. The type-III and type-I re- verse turns require onlv small perturbations in the (~, qr values from an a helix. The type- II turns are restricted to the peptide seg- ments with Pro-Gly sequences and require large conformational changes from an a helix. The remaining 12 segments that did not contain the 4-> 1 hydrogen bonds are open turns (11). These segments showed considerable conformational diversity that depended on the hydrogen-bonding geome- try between the backbone carbonyl and am- ide groups and the bridging water molecule. In other words, the nature of the conforma- tion adopted by the segments depended on the degree of "penetration" of the water molecule into the helical segment or on the "bite," that is, the distance of separation of the carbonyl and amide groups. The confor- mational states of the representative hydrat- ed segments are shown in Fig. 4. The internal and external solvation of a helices is quite common in protein struc- tures. The water-inserted segments, most interestingly, display virtually the entire range of conformations from the a helix to the extended G3 strand connected by the turns in the "neck" region of the 4), t!r space (Fig. 3). A comparison of the amino acid composition of the inserted segments (12) with that of reverse turns, a-helix termini, and a-helix middles (13) showed that the inserted segments are more similar to an a helix (termini or middle) (correlation coeffi- cients, 0.81 and 0.78) than to reverse turns (correlation coefficient, 0.57). Thus these hydrated segments are potentially a helical and the series of conformations that they display could represent intermediates in the unfolding-folding process of a helices. Re- 0 0.0 q i +3 0 D a B 0 0 E 0 0 F but forming a rype-I turn (3GRS, residues 442 to 446, dl = 2.9 A, d3 = 3.1 A, 01 = 144°, and 03 = 164°).E) Same as (C) and (D), but forming a type-II turn (2PTN, residues 172 to 176, dl = 2.8 K d3 = 3.0 01 = 139°, and 03 = 166°). (F) Insertion of a water molecule into the helix resulting in the disruption of the helix and turn hydrogen bonds and forming an open turn (2AZA, residues 54 to 58, dl = 3.1 A, d3 = 3.0 ~, 61 = 143', and 83 = 153°). The above hydrated segments may be regarded as "snapshots" of the intermediates involved in the folding. cent two-dimensional nuclear magnetic res- onance studies (14) of a synthetic peptide (19 residues) having the sequence of the C helix of myohemerythrin in aqueous solu- tion have indicated the presence of a set of turnlike structures in the carboxyl-terminal half, which were found to be rapidly inter- converting between the folded and unfolded states. Our analysis identifies a role of water in the transition of the a helix to the random chain through various hydrated reverse turns and suggests that these reverse turns represent incompletely folded helical seg- ments or trapped intermediates. The gamut of water-mediated segments suggests ideas about the possible "confor- mational reaction coordinate" of the pro- gressive unfolding of a helices in aqueous solution. The reaction coordinate may be represented by the structures that differ least in conformation, and therefore in energy, lying in the contiguous regions of the rb, ~ space that are both stereochemically and energetically permitted. It can be envisaged that a helices are initially solvated at the carbonyl 0 atoms (Fig. 4A) and three- center hydrogen bonds are formed (Fig. 4B). The water molecule could then pry open the helix hydrogen bond by inserting between the amide and carbonyl groups (Fig. 4, C through F). In this process the 5--+ 1 hydrogen bond is broken and a 4--* 1 hvdrogen bond is formed that leads to reverse turns. The type-III turn, by virtue of being closest to the a helix in conforma- tional space, would be expected to be the initial intermediate encountered in the un- folding (Fig. 4C), followed by the type-I (Fig. 4D) or type-II (Fig. 4E) and the open turns (Fig. 4F). The reverse of this order would represent the folding process. The dynamics of unfolding may involve many water molecules, other interactions, and one or more of the above intermediates. Howev- er, the inserted water molecule seems to play a critical role in the folding or unfolding of the helix. Thus the conformational transi- tion from the a helix to the extended chain or random coil perhaps traverses through various types of turns. Consequently, the family of hydrated reverse turns appears to play a central role in the formation of pro- tein secondary structures. Thus the turns, besides being involved in the familiar chain reversal (15), also appear to be involved in the formation of the "linear" secondary structures driven by water molecules. In the framework model of protein fold- ing (16), the secondary structures are be- lieved to be formed first and are then brought into proper interacting positions to form the tertiary structure through chain reversals involving loops and reverse turns, which are distinguished from the local re- r336 2 0 q C SCIENCE, VOL. 244 ~'7p,,2000
Page 89: brs52e00
nentofmanT p)anr pests,lncludng fungi and irzsects. Marty bacteria, notably species within the genera Serratia, Streptomyces, and Vibrio, produce extracellular chitinases. Biological control of some soil- borne fungal diseases by soil-borne bacteria has been correlated with the production of chitinases (7). Inactivation of a chitinase gene in a soil bacterium reduced the ability of the bacterium to lower the incidence of fungal disease (8). Chitinases have been cloned from several strains of Serratia marcescens and from other bacteria (8, 9) and have been transferred into efficient plant colonizing bacteria such as P. fluorescens. However, the effectiveness of the recombinant strains in controlling fungal disease has not yet been reported. Some bacteria possess traits that make them harmful to plants. When the genetic determinants for such traits are cloned, it may be possible to replace the native gene with a homologous gene that has been inactivated in vitro. This approach has been successfiilly applied to the control of frost injury to plants. Ice nucleation (Ice+) strains of Pseudomonas syringae are common on the leaves of many plants that cannot tolerate ice formation and are therefore an important cause of frost damage to these plants (10). The gene conferring ice nucleation in P. syringae was cloned, and internal deletions within the structural gene were produced in vitro (11). Reciprocal exchange of the modified ice gene for the native chromo- somal gene was accomplished by homologous recombination. The resultant Ice- mutants of P. syringae showed no difference in colonizing ability or survival on plants, or in other habitats, relative to the parental Ice+ strains (12, 13). In both laboratory and field studies, the population size reached by Ice' P. syringae strains on leaves that had been previously colonized by Ice- mutant strains was much lower than that reached on leaves without such competitors (13, 14). Preliminary results indicate that significant control of plant disease by avirulent mutants of pathogens is also possible (15). Preemptive competitive exclusion of deleterious bacteria by bacteria of similar genotype (and thus similar habitat resource requirements) may be a useful general method for biological control. Molecular genetic studies should enable researchers to analyze the relevance of antibiotic production by plant-associated bacteria in the biological control of deleterious bacteria and fungi. Inoculation of plant parts with certain bacterial strains can disrupt the plant- associated microbial communities and subsequently enhance plant growth or reduce the incidence or severity of plant diseases (16). Many bacteria used as inoculants produce antibiotic-like substances that are inhibitory to plant pathogens in vitro. Antibiotic-nonpro- ducing mutants (generated by insertion of the transposon Tn5 or by chemical mutagenesis) of several bacterial strains have a reduced ability to antagonize deleterious fungi or bacteria on plants (17, 18). Similar genetic evidence for the inhibition of deleterious microorga- nisms by the production of efficient iron-sequestering agents (sider- ophores) has been obtained (19). In several cases, physical "tagging" of antibiotic biosynthesis genes by insertion of Tn5 has permitted their cloning (17, 20); in other cases, the genes have been identified in cosmid clones that complemented chemically induced mutants (18). The regulation and the temporal and spatial patterns of antibiotic biosynthesis in natural environments, such as on leaves or roots, can be investigated by fusing antibiotic genes with "reporter genes" such as lacZ, lux, cat, and gus, whose products can be measured in vitro (21). A lacZYA reporter gene has been used to determine the transcriptional activity of an antifungal antibiotic operon of a P. fluorescens strain in response to the nutritional status in culture, and lux fusions with this operon have been used for the same purpose on seeds (22). A promoterless ice gene may prove to be a sensitive indicator of transcriptional activity of bacterial genes in complex natural environments such as plant tissue or soil (23). Reporter genes can also be used in cloning studies to identify those gene promoters of indigenous plant•associated bacteria that arc induced by a particular set of environmental conditions, such as in response to root exudates that may precede fungal infection of roots. Most bacteria are not pathogens of higher organisms. Plants possess defense mechanisms that are rapidly activated in response to attempted infection and only a few microbes have the complex sets of genes encoding attributes that enable them to (i) establish a successful parasitic existence with the host (basic compatibility), (ii) to produce pathogenicity and virulence factors, and (iii) to avoid, or overcome, defense responses of the host (24, 25). Among the factors required for bacterial pathogenesis on plants are (i) enzymes, such as pectate lyases, proteases, phospholipases, and glycosidases produced by soft rot Erwinia species, some Xanthomonas species, and a few other pathogens, (ii) toxins such as those produced by some pseudomonads, and (iii) plant growth hormones, such as indoleace- tic acid and cytokinins, produced in large quantity by pathogens that cause plant hyperplasias (24). Genes for several of the above enzymes, for the phytohormones, and for several toxins have been cloned and their specific role in pathogenesis had been established (24). A number of "pathogenicity genes" exist whose functions are not yet known. In Pseudomonas, Xanthomonas, and Erwinia amylovora, large contiguous clusters of genes (hrp) and other unlinked loci are required for pathogenicity (24, 25). Many of these genes also are required in conjunction with avirulence genes (avr) for triggering the hypersensitive reaction, which is not a pathogenic response but is connected with the expression of resistance to heterologous pathogens or to avirulent (incompatible) pathogen races that nor- mally cause disease on other cultivars of the same host species (25). Other genes are responsible for symptom production but not for the elicitation of the hypersensitive response (24, 25). Many of these genes seem to be conserved within taxa of phytopathogens (24). Defensive reactions of plants include the production of the antimicrobial agents termed phytoalexins and the rapid necrosis of plant cells (the hypersensitive response), which is closely associated with the accumulation of phytoalexins (24). The nature of bacterial substances that can elicit defense-related processes is unknown. Such substances do not generally have the same biological specificity as their producers, some of which have a broad host range, although most are highly specialized, infecting only a limited number of host plants or only one or a few cultivars of a given species. This specificity is much better understood at the genetic level. Although both negative and positive factors in bacteria and plants may collectively define host range, avr genes appear to be the main host range determinants in various pathovars of P. syringae and Xantho- monas campestris (25). These genes are genetically dominant in merodiploids and act in conjunction with functionally correspond- ing plant resistance genes (R), which in most cases are also genetically dominant. Such R-avr gene pairs control the activation of host resistance. Several avr genes have been cloned, and four have been sequenced (25). An extension of this concept concerns the genetic basis of nonhost resistance to pathogens (26). Interspecies transfer of genomic libraries of bacterial pathogens has revealed cryptic avr genes that restrict bacterial pathogenesis on nonhost species. The presence of these genes could not have been inferred from classical genetic studies because different species of pathogens or plants cannot be easily crossed. These findings suggest a common basis for resistance in host cultivars and nonhost species. Understanding the molecular basis of microbial pathogenesis, elucidation of resistance mechanisms, and cloning of native plant resistance genes may have an impact on crop protection strategies in the long term. However, some short-term applications have been considered: nonpathogenic mutants of P. syringae for frost control; similar mutants of Pseudomonas solanacearum that may also degrade fusaric acid, a putative toxin produced by vascular wilt Fusaria, as I 16 JLTNE 1989 , ARTICLES 1301
Page 90: brs52e00
ven Data Bank HELLK records. The search was performed over the length of the helices from N - 3 to C+ 3 to extract Lhe penta- peptide segments with externally bound wa- ters, CO,... 'vH,+4 and CO;•••Ow hydrogen bonds; the three-center transition state, CO;•••NHi, a, CO;•••Ow, and NH;-a•••Ow hydrogen bonds; and internally bound wa- ters, CO;•••Ow and NH,+4 •••Ow hydrogen bonds. The hydrogen bonds were identified by the distances dl, d2, d3, d2', and d3', and the angles 01, 02, 03, and 04 (Fig. 2A) involving CO;, N;+4, H,+4, and Ow atoms. The distances and angles involving the am- ide proton were obtained by fixirlg the proton at 1.0 A from the amide N atom along the bisector of the angle C'N Ca. The water molecule was considered to hydrogen- Table 1. The 19 proteins* that contain water-inserted and three-centered segments [see (12)]. Protein Code` Helis$ Sequence§ Waterll d2R d3 Azurin 2AZA 55-67 54-58 (A S Q I I) 167 5.5 3.0 55-67 59-63 (V A T D G) 138 2.8 3.3 Bacteriochlorophyll-A protein 3BCL 183-190 184-188 (F A A I N/D) 60 4.3 3.1 183-190 181-185 (G P A F A) 47 4.7 3.0 284-297 291-295 (G M T G K) 114 4.4 2.9 284-297 287-291 (L T H H G) 35 2.9 3.0 Carboxvpeptidase A 5CPA 215-231 230-234 (L K S L Y) 444 4.6 2.8 285-306 283-287 (A S Q I I) 491 4.8 3.0 Dihydrofolate reductase 3DFR 78-89 86-90 (A K N H L) 240 3.1 3.4 Hemoglobin lECD 117-133 116-120 (G A E A A) 88 5.9 3.0 117-133 115-119(A G A E A) 85 5.0 3.1 76-88 75-79 (N I E A D) 55 5.9 3.4 Glutathione reductase 3GRS 444-453 441-445 (D E M L Q) 1 5.3 2.9 299-304 296-300 (K D L S L) 158 6.1 3.0 444-453 442-446(E M L Q G) 24 5.7 3.1 56-86 80-84 (D E M L Q) 248 5.4 2.9 56-86 79-83 (M H D H A) 185 5.0 3.2 444-453 451-455 (V K Iv1 G A) 408 4.3 3.3 Mvoglobin (oxy) IIviBO 20-35 22-26 (A G H G Q) 122 3.0 3.1 58-77 ,'0-74 (T A L G A) 131 3.1 3.4 58-77 62-66 (K K H G V) 122 3.2 3.4 3-18 14-18 (W A K V G) 281 2.9 2.5 3-18 15-19 (A K V E A) 281 3.7 3.4 Phospholipase A2 1BP2 89-108 94-98 (F I C N C) 37 3.1 3.4 Protcinase K 2PRK 244-256 246-250 (A S A C R) 96 5.9 3.2 244-256 245-249 (A A S A C) 53 5.1 2.9 Ribonuclease A 1RM 24-34 23-27 (S N Y C N) 250 5.2 3.0 Thermolysin 3TLN 260-274 258-262 (1 G R D K) 528 4.9 3.2 233-246 231-235 (H I N S G) 398 5.1 3.3 Tonin ITON 231-244 233-237 (L K S L Y) 33 5.7 2.8 231-244 232-236 (I K F T S) 91 5.2 3.4 176-179 173-177 (K D N V T) 19 4.3 2.9 Lvsozvme 2LZM 108-113 106-110 (M G E T G) 214 4.0 2.9 93-106 103-107(V F Q M G) 354 2.7 2.8 Cytochrome c peroxidase 2CYP 42-54 41-45 (G Y G P V) 345 5.4 3.1 Troponin c (chicken) 4TNC 41-48 39-43 (T K E L G) 240 4.9 3.1 75-105 86-90 (M K E D A) 175 2.8 3.2 75-105 88-92 (A D A K G) 183 3.2 3.4 117-125 120-124 (E I L R A) 224 3.1 3.4 Citrate synthase 3CTS 373-386 375-379** 46 4.9 2.7 373-386 376-380 , 47 5.9 3.1 163-195 164-168 28 5.0 3.0 221-236 221-226 83 3.3 3.2 37-43 41-45 3 4.9 3.2 n-Glvceraldehvde-3-phosphate 1GD1 210-215 209-213 (G A A K A) 467 2.7 3.3 dehvdrogenase 210-215 208-212 (T G A A K) 352 5.7 3.2 10-18 7-11 (G F G R I) 356 6.0 3.4 Myohemervthrin 2MHR 71-84 74-78 (K K M H K) 184 3.0 3.4 93-108 102-106 (W L V N H) 125 2.8 3.4 Cvtochrome c2 3C2C 63-83 73-77 (N P K A F) 196 2.9 3.2 •The following 16 proteins do not contain the inserted segm ents: evtochrome c (3CYT), ferredoxin (4FD1), L7/L12 nbosomal protein (ICTF), ovomucoid third domain (lOVO), papain (9PAP), plastocyanin (SPCY), ubiquirin (1UB~, acid proteinase (2APR), actinidin (2ACT), scorpion neurotoxin (1SN3), trp repressor (2WRP), cyto- chrome c3 (2CDV), insulin ( 1LtiS), rrvpsin inhibitor (SPTI), cytochrome c(prime) (2CCY), and ribonuclease T1 1R'1T). tBrookhaven Protein Data Bank (PDB) code. #Helix residues as in PDB. §Pentapeptide segment containing the water molecule. IIAs numbered in PDB. 1!In the three-centered cases, d2 < 3.4. ":Amino acid sequence unknown. bond to the helix carbonyl 0 atom when dl <- 3.4 A and 01 > 90°, and to the amide group when d3 s 3.4 A and 83 > 90°, in accordance with established criteria (9). Likewise, the helix hydrogen bond was con- sidered to be present if d2 <- 3.4 A and 02 > 90°. The average values of the angles were 01 = 122° ± 9° and 02 = 156° ± 12° in the external cases, 01 = 127 ± 110, 02 = 1550 ± 16°, and 93 = 1080 ± 13.0° in the three-centered cases, and 01 = 135°t15°and83=152°±19°inthein- ternal cases (the errors represent the stan- dard deviations). In the three-centered cases where the amide proton is shared by both the carbonyl and the water 0 atoms, the absolute value of the pseudodihedral angle Hr+4 - Nr+4 - Ow - O; was 11° = 8° and the sum of the angles 02 + 63 + 04 around the amide proton was 325° ± 17°, implying the near planarity of the N,, 4, H,+4, Ow, and COj atoms (9). The distances dl, d2, and d3 were plotted in ascending magnitude of d3 (Fig. 2B) to determine the influence of the approach of the water molecule to the amide group on the helix hydrogen bond. To the left of the transition state (Fig. 2B), there are a total of 50 cases. In 66% of these cases, the water molecule is inserted and hydrogen-bonded to both the carboxyl and the amide groups (d3 < 3.4 A) and the helix hydrogen bond is broken (d2 > 3.4 A) (Fig. 2B). In the re- maining 34% of the cases, the heiix hy- drogen bond is not disrupted (d2 < 3.4 A and d3 < 3.4 A) and represents the three- centered cases. The structures with three- center hydrogen bonds can be regarded as intermediates in the transition between the externally and internally bound states. Of the 35 proteins, 15 contained water-inserted segments, 11 contained three-centered cas- es, and 27 contained externally bound seb ments. In all of these 35 proteins, there were 312 cases of hydrated segments, of which 262 were external, 17 were three-centered, and 33 were internal segments. Among the internally bound segments, 26 occur at the amino termini (CO; located between N - 3 and N + 3), 4 at the carboxyl termini (CO; located between C - 3 and C), and 3 within the helix (CO; located between N + 3 and C - 3). Thus the water molecules can be inserted at any position along the helix, although they show a preference for the amino terminus. The insertion of a water molecule into the helix generally results in a kink or a directional change in the helix. The disposition of the external, three-center, and internal water molecules with respect to the carbonvl group of the peptide is shown in Fig. 2, C through E. The external and three- centered waters show a propensity for the outer lone-pair orbital and the internal wa- I334- SCIENCE, VOL. 244 2047u5100g
Page 91: brs52e00
plagmids. Selection for tet`, carried by the gnuttle, and kanamycin resistance tkan`), carried by the pushout plasmid pML21 (7), resutts in the loss of both cointegrates and resolved F plasmids, allowing purification of the shuttle (step III). We have used the reverse building process in our work with DNA from the bithorax complex. The segments combined in this way are indicated in Fig. 2. Buildi.ng from Phage Often DNA from the locus under study has been collected as a set of overlapping clones in a X phage vector. If so, DNA can be transferred by recombination from X phage to the shuttle plasmid, without in vitro biochemistry. We have implemented this strategy for the X vector Charon 4 (11), but it should be applicable to other phage vectors. The strategy relies on a modified shuttle vector, carrying the E, coli lacZ gene flanked by portions of the left and right arms of the X vector Charon 4 (Fig. 4b). These X sequences are normally found immediately adjacent to the DNA insert in the recombinant i phage. These two segments of homology allow a pair of recombination events between the modified shuttle and Charon 4, exchanging lacZ for the phage insert. Two X pickup shuttle vectors, pMBO99 and pMBO100 (7), differ in the orientation of the right and left arm fragments, allowing us to recover the phage insert in either orientation on the shuttle. The transfers are done in three steps. First, the recombinant phage is integrated into the bacterial chromosome, via recombination with a preexisting wild-type lysogen (Fig. 4b). Double lysogens arise in 10-2 to 10-3 of the infected cells and they are selected by colony hybridization. Next, the pickup shuttle is introduced into the cell. Transformants are streaked out at 42°C in the presence of tetracy- cline. The shuttle is lost unless it is integrated into the chromosome by recombination with one of the segments derived from the ), arms. To resolve this chromosomal cointegrate, the cells are streaked on a abx deletions CAC4- lactose indicator (MacConkey) plate at the 30°C, still selecting for tef. The host cells are lac-, but the shuttle plasmid carrying lacZ makes them lac+. At 30°C, the plasmid begins replication and is excised from the chromosome by a second homologous recombina- tion event. Half of the time the recombination occurs at the other arm from the initial event, resulting in loss from the shuttle plasmid of lacZ and its replacement by the insert of the recombinant phage. In this process, the chromosome picks up lacZ. This gene can be lost, however, through further recombination, giving rise to lac- (white) colonies. One-half of the white colonies carry the desired plasmid. The other half result from recombination between the shuttle and the wild-type X lysogen. These can be distinguished by restriction digests. We have used this process during the incorpo- ration into the shuttle plasmid of those DNA segments marked with a X inFig.2. Crossing on Mutations and Marker Switching Another variation of the building strategy makes it easy to mutate completed constructs. The introduction of a deletion into an already assembled plasmid is illustrated in Fig. 4c. First, a deletion is made in a small piece of DNA. This fragment (designated B-JC-D) is cloned onto the shuttle; it must be homologous to the DNA on the F plasmid (A-B-C-D-E) on both sides of the deletion, and the regions of homologv should be close in size (B = D). Both plasmids are joined as in the standard building strategy. Cointegrates are selected and stabilized in a rec- cell. Cointegrates are analyzed by restriction digests to identify the ones that have recombined on the side where the homology is the smallest. Those cointegrates are then transformed back into a rec+ background, with selection for camr at 42°C. The resulting transformants are restreaked for single colonies Strong bxd breaks Intermediate bxd b d ~ x bx insertions 1 1 1 1 j 1 1~ 11 p 111111 pbx deletions ~~ -1 U •110 •102 -64 • 66 -76 -70 -62 •54 •46 -36 •30 •22 •14 •6 .2 .10 i 7.2 },3 10,} f.6 3.5 6.1 7.5 3.6 4.0 6.$ 3.3 }.i 6.7 I f.9 3.3 2. 5.1 6.6 2.6 _ 2.2 2.2 2 S I[ 1.7 2.2 2292 t Start of build 2261 2274 Ubx Flg. 3. Hybridization profile of the Ubx 125-kb build. A sample of plasmid pMBO1235 DNA (this is pMBO132 + 125 kb of bithorax DNA, from -113.5 to +11.5) was cut with Eco RI and separated by electrophoresis in each of ten lanes on two 1% agarose gels. After blotting to a nylon filter, the membrane was cut into strips, and each strip was separately hybridized to one of ten different 'ZP-labeled phages that contained DNA from the chromosomal walk in the bithorax complex (9). The DNA segments carried in each phage are shown at the top portion of the figure, relative to a coordinate scale for the complex (in kilobases, as in Fig. 2). The positions of Eco RI restriction sites are shown by vertical hatch marks below the coordinate line; the sizes of the larger Ecn RI fragments are shown. The bars and arrows above the coordinate scale indicate sites of various mutant lesions; the transcription map of the Ubx mRNA is shown below the phage maps (transcription is from right to left). Above each lane of the autoradio- graph is shown the number of the phage used as a probe for that lane. On the left and right sides of the autoradiograph are shown the sizes of plasmid 7z - W 4.1 - 3.3 - 1.7- fragments that show hybridization to phages 2292 and 2206, respectively. o.s- LJ and RJ indicate the left and right junction fragments, respectively, between the Drosophila sequences and the vector sequences. The three lanes on the right were from a separate gel, and therefore the molecular weight scale is different from the other lanes. 1310 -y 3---i i 2260 2228 2212 ~ ~ 226 2236 2218 2206 End of build W N N -11RJ SCIENCE, VOL. 2¢¢
Page 92: brs52e00
W. J. J. van den Tweel, ibid., p. 677; E. Dom, M. Hellwing, W. Reineke, H.-J. Xtracktrtuu; An* aW,,rodrol. 99, 61 (1974); J, Latorre, W. Reinekq H,-J. Y~ackm.us, ibid. 140, 1S9 (1984) , M. A. RWbio, K.-H. Engesser, H.-J. Knack- muss, ibid. 145, 116 (1986); ibid., p. 123. 71. S. W. Pirages, L. M. Curran, J. S. Hirschhorn, in Impact of Applied Genetics in Pollution Control, C. F. Kulpa, Jr., R. L. Irvine, S. A. Sojka, Eds., Symposium, Universitv of Notre Dame, 24 to 26 Mav 1982 (Univ. of Notre Dame Press, Notre Dame, IN); G. Schraa et al., Appl. Environ. Microbiol. 52, 1374 (1986); J. C. Spain and S. F. Nishino, ibid. 53, 1919 (1987); E. Schmidt, G, Remberg, H.-J. Knackmuss, ibid. 46, 1038 (1983). 72. A. K. Koch, J. Reiser, O. Kappeli, A. Fiechter, Bio/Technology 6, 1335 (1988); L. Wender, Ed., Bioprocesa. Technol. 10, 3 (1988). 73. H. J. Gilbert et a/., J. Gen. Microbiol. 134, 3239 (1988). 74. M. Emori, T. Tojo, B. Maruo, Agric. Biol. Chem. 52, 399 (1988). 75. V. L. Seligy et al., Biotechnol. Adv. 2, 201 (1984). 76. G Ganter, A. Boeck, P. Buckd, R. Mattes, J. Biotechnol. 8, 301 (1988). 77. J. D. Windass er al., Nature 287, 396 (1980): Imperial Chemical Industries, Ltd., European Product Number 35831 (1981); European Product Number 66994 (1982). 78. D. J. Drahos, B. C. Hennig, S. McPherson, Bio/Technology 4, 439 (1986); D. J. Drahos et al., in The Release ofGenetically-Engineered.Wicro-Organisms, M. Sussman et al., Eds. (Academic Press, London, 1988), pp. 181-191. 79. We thank our colleagues M, N. Schroth, B. J. Staskawicz, J. Loper, and E. Clark for comments, suggestions, and criticism during manuscript preparation. We also thank H. J. Evans and F, Cannon for useful comments and personal communica- tions. Cited work in the authors' laboratories has been supported by grants DBM- 8706129, DBM-8409723 PC2tii-8313052 from the NSF and grant DE-FG03- 86ER13518 from the Department of Energy. Construction of Large DNA Segments in Escherichia coli MICHAEL O'CONNOR,* MARK PEIFER, WELCOME BENDER Recombinant DNA clones containing large pieces of DNA are useful in the study of large genetic units, but these are difficult to make in most bacterial cloning vectors. A strategy is described that uses general and site- specific recombination to construct large pieces of eukary- otic DNA from smaller cloned segments. The large clones are propagated on F factor-based plasmids in Escherichia coli. They can be easily modified to introduce mutations or rearrangements. These techniques were applied to the construction of large DNA segments from the bithorax complex of Drosophila. G ENES IN HIGHER EUKARYOTES ARE SURPRISINGLY LARGE and complex. The bithorax and Antennapedia complexes of Drosophila contain transcription units of 75 and 100 kb (1), respectively. Certain mammalian genes are even larger. The current record holder is dystrophin (2), whose transcribed region may exceed 2000 kb. The noncoding DNA of some large loci contains regulatory sequences critical for appropriate spatial and temporal regulation. For example, the Ultrabithorax (Ubx) gene is regulated by sequences up to 50 kb away from the messenger RNA start site, both upstream and within the introns (3). Whereas the human P- globin gene has a transcription unit spanning only a few kilobases, sequences as far as 50 kb upstream appear to be needed to obtain full expression in transgenic mice (4). For such large genes, a method is needed that allows rapid cloning and manipulation of large functional units, so that the whole unit can be tested by transformation into the appropriate organism. Cosmid vectors are limited to a narrow size range, typically 40 to 45 kb of insert DNA. More recently, a new vector system has been developed (5), based on the creation of yeast artificial chromosomes (YAC clones). This allows the cloning of much larger pieces of DNA (up to several hundred kilobases), but the yeast chromosomes are more difficult to work with than bacterial plasmids. We have developed a method, called "chromosomal building," that allows rapid construction in bacteria of large pieces of defined DNA, in F factor-based vectors. It relies on a combination of general and site-specific recombination to join large pieces of DNA from smaller, overlapping cloned segments in vivo. The replication and partition systems of the F factor (6) ensure stable maintenance of the resulting large plasmids. The vectors permit the large clones to be further modified. They can be rearranged, mutations can be introduced, or selectable markers can be added for transformation into various organisms. The product is a supercoiled, circular molecule that is resistant to shearing. Basic Building Strategy The basic building strategy is a process in which the F plasmid serves as the recipient of DNA transferred from the shuttle plasmid by recombination. This transfer is repeated a number of times; with each repetition the F plasmid increases in size by an amount roughly equivalent to the size of the insert in the shuttle plasmid. The process begins with the cloning of a DNA fragment (designated A- B-C in Fig. 1) into a polylinker cloning site in the F plasmid vector, pMBO132 (7). The F factor origin maintains the plasmid at one to two copies per cell, which enhances its stability. The plasmid alsc carries the resolution site for the F factor's site,-specific recombina tion system, rfsF (8). A second DNA segment (designated C-D-E in Fig. 1) is then cloned into the polylinker cloning site of the shuttle plasmid, pMBO96 (7). The second DNA segment is chosen to overlap the first by 500 bp or more, depending on the convenience of restriction sites. The origin of replication for the shuttle plasmid is tempera- ture-sensitive. At 30°C the plasmid can replicate, conferring tetracy- Department of Bio1og~cal Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115. "'to whom reprint requests should be addressed at Department of Molecular Biology and Biochemistrv, University of Califomia, Irvine, CA 92717. 16 JUNE 1989 ARTICLES 1307
Page 93: brs52e00
Fig. 2. Effect of MP on estrous cycles of fat hamsters. Hamsters that had been fed powdered chow for at least 5 weeks received one of the following treatments on days 1 and 2 of the estrous cycle: (i) food-deprived (open bar) (n = 9), (ii) treated with MP (diagonal lines) (n = 4), or (iii) both MP-treated and food-deprived (crosshatched bar) (n = 10). Differences in the frequency of hamsters showing either tordosis or the postovt.tlatory discharge were significant [G(2) = 12.942, P < 0.005]. that blocks glycolysis in hamsters (12). Chow-fed (pellets-in) hamsters that weighed 116.9 ± 3.4 g and had two consec- utive 4-day estrous cycles were divided into five groups that did not differ significantly in mean body weight. They were treated on days 1 and 2 of the estrous cycle as follows: (i) untreated, food restricted so that the caloric intake matched that of group iv, (ii) treated with MP (20 mg/kg) four times a day, (iii) injected intraperitoneally with 750 mg of 2DG per kilogram of body weight in 0.9% saline four times a day, (iv) treated with both IMP and 2DG, or (v) food de- prived. Any group that did not receive MP or 2DG was treated with an equivalent volume by body weight of the appropriate vehicle. A previous pilot study showed that treatment with 2DG and MP slightly de- creased food intake (13). Therefore the food intake of group i was restricted to match the food intake of group iv (2DG plus MP). Furthermore, groups i and iv were fed 1 Inl of a 25% glucose solution by gavage twice daily to ensure that their caloric intake was similar to that of the other groups. In hamsters fed ad libitum (pellets-in), treatment with MP alone or 2DG alone did not block estrous cycles, but treatment with both drugs concurrently significantly de- creased the percentage of hamsters that showed normal estrous cycles (Fig. 3). An- estrus in the MP plus 2DG-treated hamsters cannot be attributed to the small drop in food intake of this group, because normal estrous cycles were seen in 87% of the untreated hamsters that had been food re- stricted so that their caloric intake matched 16 JUNE 1989 that of the hamsters treated with MP plus 2DG. The mean body weight of the MP plus 2DG group was not lower than that of the food-restricted group on any day of the estrous cycle. These results support the hypothesis that changes in reproductive status are signaled by changes in the general availability of metabolic fuels, rather than by the presence or absence of any one specific fuel. The fact that the chow-fed (pellets-in) hamsters showed normal estrous cycles when either fatty acid oxidation or glycolysis was inhibit- ed suggests that neither fatty acids nor glu- cose is critical for normal reproductive func- tion. This suggestion is also supported by the finding that food-deprived hamsters (which are assumed to have a decreased availability of glucose) continue to show normal estrous cycles as long as fatty acids are available for mobilization from adipose tissue (Figs. 1 and 2). Furthermore, ham- sters continue to show normal estrous cycles when fed only a glucose solution (6) or pure vegetable shortening, supporting the idea that the availability of either glucose or fatty acids alone is sufficient for continued repro- ductive function (14). Our data do not support the notion that there is a critical body weight or composi- tion necessary for reproduction. For exam- ple, the hamsters treated with both 2DG 100 80 20 0 Fig. 3. Effect of inhibition of glucose and fatty acid utilization on hamster estrous cycles. Ham- sters fed chow (pellets-in) were treated as follows on days 1 and 2 of the estrous cycle: (i) untreated, food restricted so that their food intake matched that of group iv (open bar) (n = 7); (ii) MP, treated with MP (diagonal lines) (n = 4); (iii) 2DG, treated with 2DG (shaded bar) (n = 5); (iv) MP plus 2DG, treated with both MP and 2DG (crosshatched bar) (n = 7); and (v) food- deprived (solid bar) (n = 7). There were signifi- cant differences in the frequency of hamsters that showed either lordosis or the postoculatory dis- charge [G(4) = 17.1552, P< 0.005]. There were no significant differences among groups i, ii, and iii, nor between groups iv and v. and MP did not lose weight, yet 83% of them were anestrous (Fig. 3). Furthermore, 60% of hamsters that were deprived of food and treated with :bIP became anestrous de- spite their high body weight (Fig. 2). Other investigators also have argued that changes in reproductive status are not brought about by changes in any one dimension of body size per se (4, 15). There is precedence for the control of behavior by the general availability of ineta- bolic fuels. In rats, greater increases in food intake were seen in response to blockade of both glucose and fattv acid utilization than to blockade of either metabolic pathway alone (16). In some ways this may be analo- gous to the mechanism by which metabolic fuels influence estrous cycles: changes in behavior are signaled by the general avail- ability of fuels, rather than by one critical substrate. Paradoxically, treatment with 2DG and MP either alone or together does not increase food intake in hamsters (17). Reproductive responsiveness to metabolic fuels may be part of a general adaptation to changes in energy supply and demand. In manv mammals, the response to energetic challenges is to forgo reproduction in favor of activities that increase the chances of individual survival (3). The availability of oxidizable metabolic fuels may signal pe- ripheral or central mechanisms that either increase food intake, delay reproduction, or both, until sufficient energy supplies are available for successful pregnancy and lacta- tion. REFERENCES AND NOTES 1. R. A. Vigerskv, A. E. Andersen, R. H. Thompson, D. L. Loriaux, :V. Engl. J. Med. 297, 1141 (1977 ); D. C. Cumming and R. W. Rebar, Am. J. lnd. Med. 4, 113 (1983); R. E. Frisch and J. W. McArthur, Science 185, 949 (1974). 2. C. M. Jackson, Am. J. Anat. 18, 75 (1915); L. E. Casida, in Reproductive Physiology and Protein Nutri- tion, J. H. Leatham, Ed. (Rutgers Univ. Press, New Brunswick, NIJ, 1959), pp. 35-45; G. C. Kcnnedy and J. Mitra, J. Physiol. (London) 166, 408 (1963). 3. F. H. Bronson, Biol. Reprod. 32, 1( ,1985). 4. A. R. Glass, W. T. Dahms, R. S. Swerdlo$; Pediatr. Res. 13, 7 (1979); F. H. Bronson, Am. J. Physial. -252, R140 (1987). 5. L. P. Morin, Biol. Reprod, 13, 99 (1975); R. H. Printz and G. S. Greenwald, Endocrinology 86, 290 (1970). 6. L. P. Morin, Am. J. Physiol. 251, R663 (1986). 7. Adult Syrian hamsters, Lak:LVG, 85 to 95 g in body weight, purchased from Charles River Breed- ing Laboratories, Wilmington, MA, were housed in a room maintained at 21° t 2°C on a 16:8 light: dark cycle with lights on at 0700 hours. 8. Purina Laboratory Rodent Chow, no. 5001, 3.4 kcaUg, 28% protein, 60% carbohvdrate, and 12% fat. 9. Two parts Purina Laboratory Rodent Chow, no. 5001 and one part Sweet Life brand vegetable shortening; 5.3 kcallg; 12% protein, 26% carbohy- drate, 62% fat (by calories); G. N. Wade, Physiol. Behav. 29, 701 (1982). 10. Body weights (mean t SEM): High far, 155.6 ± 4.6 g; powder, 142.6 = 2.7 g; pellets-in, 114.4 2047651991 REPORTS I327
Page 94: brs52e00
secondary recipient animals. Because the bone marrows of some secondary recipienr anama)s tivere also repopulated by neomycin- resistant cells, the presumgtion was that only authentic, cycling totipotential stem cells rather than more differentiated progenitor cells could have been responsible (59). Direct demonstration of retrovirus vector infection of authentic totipotential stem cells has not been reported. Rather than stable long-term expression, the common experience in many laboratories has been that expression from retrovirally transduced genes in mouse bone marrow is transient and unstable. The limited experience with larger animals such as dogs and monkeys has so far been equally disappointing (62- 64). Unstable provirus gene expression may result from (i) genetic or epigenetic structural provirus instability, (ii) the possibility that only committed precursor cells and not truly totipotential stem cells can be infected by or can express retrovirally transduced genes, or (iii) the possibility that the repopulated marrow expresses cell lineages cyclically from different precursor cells, some expressing a transgene efficiently, whereas others do not. Retroviral gene expression is known to be poor in some highly undifferentiated cells such as embryonal carcinoma (EC) cells and possibly bone marrow stem cells because of an inability of the viral LTR enhancer to function in such cells (65). However, plasmids containing enhancers isolated from genes that are normally ex- pressed in EC cells, from the rare EC cell successfully infected with a retrovirus vector, or from an infectious myeloproliferative syndrome virus did allow efficient transient gene expression in EC cells (66- 68). Similarly, plasmids containing a reporter gene together with an enhancer sequence isolated from polyoma mutants able to infect EC cells were able to express the gene transiently after transfection into EC cells (67-69). Gene expression from retroviral or other vectors containing these EC-permissive sequences has not yet been report- ed. On the basis of these animal studies, a genetic approach to the treatment of human bone marrow diseases has been proposed. The most suitable and heavily studied current models are those of the immunodeficiency diseases caused by defects of adenosine deami- nase (ADA) and purine-nucleoside phosphorylase (70, 71), chronic granulomatous diseases (72), and Gaucher's disease (73). These and similar disorders are currently treated either symptomatically or, in the case of ADA deficiency, by enzyme replacement therapy or by bone marrow transplantation from histocompatible donors. The recent use of purified ADA stabilized by polyethylene glycol (74) may make effective therapy accessible to more ADA-deficient pa- tients without resorting to gene therapy. Similar advances in traditional therapy have not occurred in Gaucher's disease or chronic granulomatous disease. Among the earliest theoretical targets for gene therapy were erythroid cell disorders of hemoglobin expression, including sickle cell anemia and the thalassemias. However, none of the early gene transfer techniques were capable of bringing globin transgenes under faithful gene regulation, and unbalanced expression of the several globin genes is in itself deleterious. Therefore, it has seemed until recently that these diseases might not be ideal as models for studies of gene therapy. However, the correction of the mouse thalassemia in transgenic mice with vectors that retain regulatory genomic sequences (75) and the recent discovery of regulatory sequences far upstream from the human (3-globin cluster (32, 76) suggest that appropriately regulated and efficient expression of globin genes may indeed become feasible. In the case of sickle cell anemia, the increased intracellular viscosity responsible for erythro- cyte trapping and destruction results more from the presence of the insoluble sickle (3-globin chains than from the mere absence of normal (3-globin chains; therefore simple restoration of normal (3- globin synthesis without a shutdown of S-globin synthesis is unlikely to have any beneficial therapeutic effect (77). Liver. The liver plays a central role in human metabolism and in the expression of many genetic diseases. The adult mammalian liver contains relatively quiescent, differentiated hepatocytes that are refractory to retrovirus infection. However, differentiated rat hepa- tocytes are susceptible to retrovirus vector infection during a de- differentiation phase of growth in vitro (78). Investigators have taken advantage of this finding to develop retrovirus-mediated methods to express a number of genes in primary hepatocyte cultures in vitro, including the disease-related genes for the human receptor for low-density lipoproteins (LDLR) (79, 80), phenylala- nine hydroxylase (81), and ai-antitrypsin (82). The ai-antitrypsin promoter has been incorporated into a phenylalanine hydroxylase retrovirus vector to confer liver specificity to retrovirus gene transfer (83). The tasks now are to develop efficient means of reimplanting genetically modified hepatocytes into recipient animals to restore a genetic defect and, ideally, to develop vectors that can be introduced directly into hepatocytes in vivo without resorting to in vitro genetic manipulation and cell reimplantation. Long-term survival of hepato- cytes implanted into rat peritoneum and spleen has been reported (84, 85), suggesting that implantation of genetically modified hepatocytes to produce a phenotypic change in vivo should be feasible. On the other hand, the awkwardness of isolating a large number of hepatocytes, presumably by liver biopsy, from a patient for in vitro genetic manipulation before autologous transplanation makes direct vector delivery into the liver highly desirable. Central nervous system (CNS)-genetic and nongenetic disease. The neurologically devastating Lesch-Nyhan disease, resulting from defects in the X-linked HPRT gene, has been one of the most useful models for development of general techniques for human gene therapy and of approaches to the genetic modification of CNS functions (86-89). Experience with this disorder and others such as Alzheimer's and Parkinson's diseases has made it clear that genetic approaches to the dysfunctioning mammalian CNS are not entirely straightforward. Useful models for genetic approaches to therapy of CNS disorders are difficult to identify for the following reasons: (i) little is known about normal or abnormal CNS function, (ii) the organ and many of its cells are inaccessible both physically and physiologically, and (iii) most disorders affecting CNS function are likely to be multigenic and multifactorial. Furthermore, most of the presumed target cells for CNS disorders, neurons, are postmitotic and therefore refractory to infection with retroviral vectors. My colleagues and I have proposed a combination of in vitro gene transfer and cell grafting into specific regions of the mammalian brain as an approach to the restoration of function in at least some CNS defects (90) (Fig. 1). It seems preferable for both technical and ethical reasons to design an autologous cell genetically modified to produce the desired product rather than to rely on naturally occurring human donor cells. In a test of that hypothesis, it was recently reported that rat fibroblasts expressing a retrovirally trans- duced mouse nerve growth factor (NGF) cDNA and implanted into a lesioned rat brain protected cholinergic neurons from degenera- tion and death after injury of the fimbria fornix (91). The relevance of this NGF study to any specific human disease remains to be established, although the protected neurons are analogous to those that are correlated with the memory deficit in human patients with Alzheimer's disease. Studies are now under way in many centers to examine the potential role of NGF in the pathogenesis or treatment of Alzheimer's disease (92). Similar approaches to the delivery of useful agents in models of Parkinson's disease are also under way. If such combined gene transfer-implantation approaches were proved effective, they would establish the feasibility for delivering therapeu- tic gene products or metabolites through grafting of genetically modified cells in the treatment of genetic, developmental, degenera- SCIENCE, VOL. 2q.q- 1278 204765194-2
Page 95: brs52e00
tion we have assembled spanning the Ubx gene would encompass the (3-globin cluster (4) or half of the smallest yeast chromosome (5). A size of 136 kb is probably not near the upper limit of the F plasmid, since much larger F factor derivatives have been identified (up to 1.5 megabases) (16). This latter size would cover all but the very largest known genes, as well as many of the yeast chromosomes. Although our primary goal was to clone large and defined fragments, the mechanics involved in building make it very versatile. The shuttle vector constructs can be modified to allow introduction of mutations in any region of a larger construct. The same fragments used to build the entire gene can be subsequently used to make fusions of large regulatory regions to reporter genes or to make mini-genes carrying part but not all of the locus. These building blocks can also be used to rearrange elements within the gene, by moving regulatory regions normally found upstream to the middle or the end of a large gene, or by reversing their orientation. This versatility makes the effort of making the shuttle clones doubly worthwhile. A bacterial vector that can carry large DNA inserts could also be used to make a genomic library. Given the size of known F factor derivatives, DNA molecules of 150 to 200 kb and larger should be stable in our vector. We have seen no instability with any of our derivatives. Natural F' plasmids are relatively stable in recA' cells even when they carry directly repeated insertion sequence (IS) elements (17). A random clone library of large pieces of DNA, 50 to 100 kb, in the shuttle plasmid vector or the F plasmid vector, could be rapidly screened by colony hybridization, and overlapping DNA segments could be assembled in F plasmids by the procedures we have outlined. The building technique complements current technology such as the YAC system (5). The YAC system is preferable to F plasmids for isolating, in a single step, DNA segments of more than 100 kb, since there is currently no efficient method for ligating together such large circles and transforming them into bacteria. However, it is difficult to isolate a large gene without much flanking DNA in the YAC system. There are also differences in the ease of manipulation of the DNA products. YAC clones are linear chromosomes in yeast, whereas our strategy yields circular, supercoiled plasmids in E. coli. Bacterial colonies are easier to screen than yeast colonies. Yeast chromosomes are more difficult to prepare in bulk than bacterial plasmids, and the chromosomes must be handled more carefully to avoid shearing. Our F plasmid vector is designed to allow reintroduction into the Drosophila genome. DNA added to the F plasmid ends up inside a P element, which can then be used to obtain stable germ line transformants carrying the DNA construct (18). We have shown that the P element on the F plasmid transposes successfully into the Drosophila germ line and confers G418 resistance (or ethanol resistance, after the switch of selectable markers to Alcohol dehydro- genase). Both a 35- and a 20-kb P element in the series in Fig. 2 (indicated by the asterisks) have already been successfully introduced into flies (19). We do not yet know how size will affect the rate of P element transposition. The largest P element introduced into flies thus far was a 45-kb transposon carried on a cosmid (20). There appears to be an inverse relation between transposon length and transposition abiliry, but the transposition frequency seems also to be influenced by the DNA sequences involved (18). Further ad- vances in P element-mediated transformation are likely to occur as the biology of P element transposition is worked out in greater detail. Other methods of transformation may be necessary, however, to deliver very large (>100 kb) pieces of DNA. DNA delivery to organisms other than Drosophila can be adapted to the biology of those organisms. The products of the building strategy, supercoiled plasmid DNAs, are compatible with most means of DNA delivery. Transfection of cultured manunalian cetls requires no special vector. The marker switch strategy described above allows addition of a marker, such as the thymidine kinase gene, for work with mammalian cells or suppressor transfer RNA genes for transformation of nematodes (21). Microinjection of large supercoiled plasmids into nematodes or into mammalian eggs should be possible without breakage by shearing, The building technology should allow the testing of large DNA molecules for function in a variety of eukarvotic systems. REFERENCES AND NOTES l. A. Laughon, A. M. Boulet, J. A. Bermingham, R. A. Lavmon, M. P. Scott, a-fol. Cell. Biol. 6, 4676 (1986); V. L. Stroeher, E. M. Jorgenson, R. L. Garber, ibid., p. 4667; M. B. O'Connor, R. Binari, L. A. Perkins, W. Bender, EMBO J. 7, 435 (1988); K. Kornfeld, R. B. Saint, P. A. Harte, D. A. Peattic, D. S. Hogness, Genes Dev. 3, 243 (1989). 2. M. Koenig et al,, Cell 50, 509 (1987). 3. M. Peifer, F. Karch, W. Bender, Genes Dev. 1, 891 (1987). 4. F. Grosveld, G. B. van Assendelft, D. R. Greaves, G. Kollias, Cell 51, 975 (1987), 5. D. T. Burke. G. F. Carle, M. V. Olson, Science 236, 806 (1987). 6. N. Willets and R. Skurray, in E. coli and S. typhimurium Celluar and.Slolecular Biology, F. Ncidhardt, Ed. (American Society for Microbiology, Washington, DC, 1987), pp. 1110-1133. 7. Construction of the vectors involved in the building strategy. Restriction maps are available upon request. pMBO132: the 9.4-kb f5 Eco RI fragment of the F factor (6) was digested with Sal I and Hind III, and the fragment carrying the on and par functions was ligated to a Sal I-Hind III fragment of Tn9 carrving cam' (pMBO130). A 3.2-kb Hind III-Nco I fragment, carrying the normal rf~sF site was deleted, filling in and removing both sites, and creating p'siBO131. Meanwhile, a 450-bp Mlu I-Bam HI fragment from pMBO80 (8), carrying the rjsF site, was filled in and ligated into the filled-in Eco RI site in the polylinker within the P element of CosPneo to generate pMB0120. From this, a Sca I-Sal I fragment, carrying the P element and the rfsF site, was isolated, 511ed in, and ligated into the Sal I site of pMBO131, creating pMBO132. pMB096: pHSl [T. Hashimoto- Gotoh and M. Sekiguchi, J. Bacteriol. 133, 405 (1977)] was digested with Eco RI and Pvu II, filled in, and a Mlu I-Bam HI fragment carrying rfsF was inserted (pMBO93). This can be used as a shuttle for cloning Eco RI fragments. To clone other fragments p'14B096 was created. pMB093 was cut with Eco RI and the Eco RI-Hind III polylinker of pEMBL18 [L. Dente, G. Cesareni, R. Cortese, Nucleic Acids Res. 11, 1645 (1983) ] was filled in and added by blunt-end ligation, creating pMB094. The polylinker is oriented with the Sac I site closest to the rfsF site. pMBO95 has the polvlinker in the opposite orientation. pMB094 was digested with Hind III and Nru I to remove the pSC101 tetr detertninant, and it was replaced with the 2.3-kb Hind III-Bgl II fragment of pRT2 [R. A. Jorgenson and W. S. Ranikoff, J. Bactenol. 138, 705 (1979)] carrYing the tet` detem-dnart of Tn10. This plasmid was then partially digested with Barn HI, and the site outside the polylinker was filled in, generating pMB096. pMB099 and pMBO100: pMB095 was digested with Pst I and Kpn I and the 6.6-kb Kpn I-Hind III fragment of Charon 4A (11) was inserted (pMB097). This fragment carries 1.0 kb of the left arm and DNA of the insert of Charon 4, including the lacZ gene. The 3.4-kb Bgl II fragment of Charon 4, carrying the right arm-insert junction, was inserted into the Bst EII site of pMBO97 (pMBO98). The Kpn I-Xba I fragment carrving the left arm, lacZ, and the right arm was cut out and inserted into the polylinker of either pMBO94 or pMB095 to generate pMBO99 and pMBOl00. DCM 111: A 3.4-kb Bgl II fragment from the F factor coordinates 44.65 to 48.05 was cloned into the Barn HI site of pBR322. The plasmid was a gift of M. Malamy. pML21: J. J. Manis and B. C. Kline, Plasmid 1, 492 (1978). 8. M. B. O'Connor, J. Kilbane, M. H. Malamy, J. Mol. Biol. 189, 85 (1986). 9. W. Bender et al., Science 22, 23 (1983); F. Karch et al., Cell 43, 81 (1985). 10. T. Maniatis, E. F. Frisch, J. Sambrook, adoleadar Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982). 11. F. R. Blattner et a/., Science 196, 161 (1977). 12. J. L. Bos et al., Nucleic Acids Res. 12, 9155 (1984). 13. R. M. Myers, L. S. Lerman, T. Maniatis, Science 229, 242 (1985). 14. D. A. Goldberg, J. W. Posokonv, T. Maniatis, Cell 34, 59 (1983). 15. G. M. Rubin and A. C. Spradling, Science 218. 348 (1982). 16. B. Hollowav and K. Brooks-Low, in E. roli and S. typhimurium Cellular and Nolecular Biology F. Neidhardt, Ed. (American Society for Microbiology, Washington, DC, 1987), pp. 1145-1154. 17. R. C. Deonier and L. Mirels, Proc. .Vatl. Acad. Sci. U.S.A. 74, 3965 (1977). 18. A. C. Spradling, in Drosophila: A Practical Approach, D. B. Roberts, Ed. (IRL Press. Oxford, 1986), pp. 175-197. 19. M. O'Connor, J. Simon, M. Peifer, unpublished results. 20. M. Haenlin, H. Steller, V. Pirrotta. E. Mohier, Cell 40, 827 (1985). 21. A. Fire, EJIBO J. 5,2673 (1986). 22. D. Hanahan, J. a1oL. Biol. 166, 557 (1983). 23. We are gratefiil to M. Malamv for strains, plasmids, and advice; V. Pirrotta for the CosPneo; and A. DeLong and F. Winston for comments on the manuscript. Supported by a fellowship from the Damon Runyon-Walter «'inchell Cancer Fund to M.B.O. and a grant from the NIH to W.B. SCIENCE, VOL. 24-¢ 1312 204'76515'76
Page 96: brs52e00
cline resistance (tetr). At 42°C, however, the plasmid cannot replicate and is diluted out during growth, leaving the progeny cells tetracycline sensitive (tetS). The shuttle plasmid also carries a copy of the rfsF site, as shown (Fig. 1). At the start of each cycle, the F plasmid and the shuttle plasmid are introduced into the same rec+ cell by transformation at 30°C (Fig. 1, step I). At this temperature, both plasmids replicate independently. Next, we streak out these cells at the restrictive temperature, 42°C, selecting for both chloramphenicol resistance (camr) and tetr (step II). At 42°C the shuttle plasmid cannot replicate and most cells become tets. Tetracycline resistance is only maintained if the F plasmid and the shuttle plasmid join by homologous recombination at the overlap (region C), forming a cointegrate with a tandem duplication. This cointegrate replicates by using the F plasmid origin. Cells carrying cointegrates are both tetr and camr and form colonies that grow out of the streak. The rate at which cointegrates arise depends on the size of the overlapping homology between the two plasmids. A single colony streaked out at 42°C will yield three to five cointegrate colonies when the overlap between the plasmids (region C) is 500 bp, and more than 50 colonies with a several kilobase overlap. Plasmid DNA minipreps are made from several cointegrate colonies and are used to transform recA- cells to camr and tetr at the restrictive temperature (Fig. 1, step III). This serves two purposes. First, it purifies cointegrate DNA from the parental plasmids, since only cointegrates can give cam' and tetr at 42°C. Second, a rec- host is necessary for the next steps, because in a rec+ cell cointegrates are unstable, forming and resolving via homologous recombination. Cointegrates resolved by homologous recombination mask those resolved by site-specific recombination. In a rec- host, cointegrates are stabilized. DNA minipreps are prepared at this stage to ensure that the correct cointegrate is present. (Since both plasmids carry the rfsF site, homologous recombination can also occur between these sequences, but such events can be easily distinguished from the correct cointegrates by a restriction digest.) Flg. 1. The basic building strategy. (Step I) Introduce by transformation (22) the F and the shuttle plasmid into the same rec' cell at 30°C, selecting for cam' (30 µg/ml) and tetr (10 µg/ml). The F plasmid contains a cloned fragment of eukaryotic DNA (A-B-C). The shuttle plasmid contains an overlapping segment of DNA (C-D- E) (C 2- 0.5 kb). (Step II) Streak out cells carry- ing both plasmids, selecting for cam' and tet` at 42°C. Replication of the shuttle plasmid stops. The only cells surviving are those in which a cointegrate has formed between the two plasmids, via homologous recombination between the over- lap regions (C). These cells form colonies papillat- ing out of the streak. The cointegrate carries a duplication of C (designated C'). (Step III) Re- streak the cointegrate under the same conditions, and isolate cointegrate DNA by alkaline miniprep procedure (11). Transform a rec' cell (SCS1) (Stratagene) with this DNA, selecting for cam' and tetr at 42°C. Grow these cells at 30°C and check cointegrates by restriction enzyme digests of plasmid DNA obtained by the boiling mini- prep procedure (10). (Step IV) Transform cells containing the cointegrate with the cleanup plas- mid, selecting for camr and amp`. When a cointe- grate and the cleanup plasmid are maintained in the same cell, the F factor site-specific recombin- A ase causes recombination between the two rfsF sites on the cointegrate, resolving it into the shuttle plasmid (which is lost) and the F plasmid, now carrying the enlarged DNA insert (A-B-C-D-E). (Step V) Recover the F plasmid by transformation back into the rec' cell, 1308 Cells carrying the cointegrate are next transformed with the cleanup plasmid (DC141111) (7) (Fig. 1). The cleanup plasmid carries the resD gene of the F factor; resD encodes a resolvase that mediates a site-specific recombination event between two copies of the rfsF site, like those carried on the F plasmid and the shuttle plasmid (8). The F, shuttle, and cleanup plasmids carry different selectable markers and compatible origins of replication, allowing all three to be stably maintained in the same cell. Cells with the cointegrate plasmid and the cleanup plasmid are grown at 42°C with selection for cam' and ampicillin resistance (ampr) (Fig. 1, step IV). During growth, the F factor resolvase mediates site-specific recom- bination between the two rfsF sites on the cointegrate, removing the shuttle plasmid and the duplicated region (C') from the cointegrate. The resolution reaction yields an F plasmid that is unchanged, except for the addition of the DNA segment D-E to A-C. The process can be repeated by using a second shuttle plasmid carrying a DNA segment overlapping E. Successive rounds of building allow one to construct a large defined DNA molecule. A single round of building, as diagrammed in Fig. 1, takes about 5 days. We have used the basic building procedure, along with the variations outlined below, to construct plasmids carrying DNA from the bithorax complex of Drosophila (9). The inserts of these plasmids are illustrated in Fig. 2; they fall into two classes. The first class consists of large segments of the bithorax complex carrying the Ubx and abdA genes, respectively, along with associated regulatory DNA. The insert in the largest of these constructs measured 125 kb (making the whole F plasmid 136 kb). This and the other F plasmids we have generated appeared to be completely stable when propagated in Escherichia coli. DNA blots of restriction digests of the 125-kb plasmid hybridized with probes covering the entire Drosophi- la insert are shown in Fig. 3, and all the expected fragments were present. The second class includes gene fusions with a reporter gene, R-galactosidase, adding either the natural 5' flanking region of the Ubx promoter (the bxd/pbx regulatory region) or a regulatory region normally found in the Ubx gene's intron (the abx/bx regula- Step III. Transfer cointegrate to rec- host Select cam rand tet rat 42°C Step II. Step VI. Repeat with shuttle containing E-F-G C \ Step IV. Add cleanup plasmid Select amp r + cam r D selecting for cam`. Screen for tets and amps to ensure that the shuttle plasmid and the deanup plasmid have been lost during transformation. (Step VI) Repeat with a new shuttle carrying the overlapping segment E-F-G. 20471#03 51971 Resolvase ~ B 'Colntegrate `Rasoluuon I Cleanup (sito-specitlc ' r.combinstlon) A;: I tetr plasmid ' ~camr rfsF'k l1rC, SCIENCE, VOL. 244 IT
Page 97: brs52e00
plasma IGF-1 (Table 3), Unfortunarely, it clied before a line of transgenic MTIGF-L Qigs could be established for an analysis of the biological effects of IGF-I expression. Relatively high mortality in normal young pigs is a complicating factor in transgenic experi- ments. Approximately 30% of pigs do not survive to market weight (90 kg, 6 months of age); about 6% are stillborn and 20% die before weaning (3 to 4 weeks) (27). Transgene Expression in Successive Generations Concentrations of transgene-derived GH in plasma varied widely from one founder pig to another (Table 3), in agreement with earlier results in the mouse (4, 6). In contrast, within successive generations of two lines of pigs the mean bGH levels were maintained at characteristic levels (Table 4). Line 31-04 maintained plasma levels of bGH of about 1300 ng/ml over three generations compared to olasma levels of endogenous pGH of about 5 ng/ml in controls (see legend to Table 3). Line 37-06 maintained plasma bGH levels of about 85 n/ml ran in from 10 to 30 times the level g g g of endogenous pGH over several generations. Circulating levels of bGH were increased about twofold by including 1000 to 3000 ppm of zinc in the diet (23), a regimen that increases plasma transgenic GH concentrations in MTGH mice (28). To ascertain the source of the bGH in plasma, bGH mRNA was measured in eight organs of 6 to 11 pigs from each generation by a solution hybridization assay (29). Although variation among pigs was considerable, the average bGH mRNA levels in line 31-04 ranged from 700 to 1000 molecules per cell in liver, kidney, adrenal gland, and pancreas and 60 to 200 molecules per cell in duodenum, lung, and gonads. By comparison, in line 37-06, which had 1/15 the level of bGH in plasma, bGH mRNA averaged from 15 to 50 molecules per cell in liver, kidney, heart, gonad, and pancreas and 5 to 10 molecules per cell in lung and adrenal gland. These are the same organs that have been shown to express I1ITGH genes in transgenic mice (4, 6). Pattlology In transgenic mice, expression of rGH, hGH, or bGH genes is associated with several notable pathologic changes including hepa- tomegaly and glomerular sclerosis, which shorten life span (30, 31). In addition, female mice expressing transgenic rGH, bGH, and hGH genes are commonly infertile (4, 32); in the case of hGH mice, the infertility is due to an impaired release of prolactin after mating, which alters luteal function (33). Many founding MThGH and bGH transgenic pigs exhibited infirmities similar to those in transgenic mice and died prematurely (Table 3). To assess the deleterious consequences of the long-term presence of bGH, we clinically examined, killed, and carried out necropsies on transgenic and control pigs from the G1 and G2 generations of lines 31-04 and 37- 06 (Table 5). The most common clinical signs of disease associated with transgene expression included lethargy, lameness, uncoordinat- ed gait, exopthalmos, and thickened skin. The following gross and histopathologic changes were noted in some of the transgenic pigs: gastric ulceration, severe synovitis, degenerative joint disease, peri- carditis and endocarditis, cardiomegaly, parakeratosis, nephritis, and pneumonia. In addition, gilts were anestrus and boars lacked libido. The joint pathology known as osteochondritis dissecans was also observed in a MLVrGH-expressing transgenic pig (19) and in groups of pigs subjected to long-term treatment with exogenous pGH (34). As GH is diabetogenic in humans and animals, plasma insulin and glucose levels were measured in overnight fasted, transgcnic MTbGH and control sibling pigs that were G3 offspring of line 37- 06. The bGH pigs were slightly hyperglycemic [plasma glucose levels: 109 ± 13 (mean ± SEM) mg/dl, n = 10; control, 72 ± 5 mg/dl, n = 10; P= 0.01] and were hyperinsulinemic [plasma insu- Table 3. Expression of MThGH, MTbGH, MThGRF, and MThIGF-I in transgenic pigs. MThGH (2.6 kb) consists of the mMT promoter and 5' flanking DNA sequences to the Bst EII site (-350) fused to the hGH gene (11). MTbGH (2.6 kb) consists of the mMT promoter and 5' flanking sequences to Bst EII fused to the bGH gene (4). MThGRF (2.5 kb) consists of the mMT promoter and 5' flanking sequences to Stu I(-750) fused to hGRF minigene (9). MThIGF-I (3.8 kb) consists of the mMT promoter and 5' flanking sequences to Stu I(-750) fused to a human insulin-like growth factor, I(hIGF-I) cDNA (10). DNA fragments were excised from bacterial plasmids, purified by agarose gel electrophoresis, eluted, and microinjected into fertilized eggs (16). NA, not assayed. DNA t Plasma$ Anunal* c°pyll per ce GH (ng/ml) hGRF (pg/ml) IGF-I (ng/ml) Life span 3-06 M 490 22 MThGH NA 7 months 7-03 F 90 104 NA 24 days 11-02 M 1 52 NA 11 months 16-09 M 1 85 NA 9 months 20-02 M 2 52 NA 2 months 20-08 M 110 3 465 -t 106 9 months 23-08 F 7 949 478 ± 141 11 months§ 25-02 F 17 140 350 ± 47 8 months Control 158 ± 13 26-01 F 5 302 MThGH NA 5 days 29-01 M 5 884 378 -~ 18 6 months 31-04 M 28 944 105 :t 30 21 months 32-04 F 2 94 350 ± 75 7 months 37-06 M 3 59 622 ± 43 6 months 39-02 F 1 5 516 ± 58 13 months§ 41-03 F 1 70 322 ± 74 9 months 58-01 F 5 260 NA 4 days Control 134 ± 13 86-04 M 100 11 ± 2 MThGRF 380 NA 2 years 93-01 F 30 16 ± 5 220 NA 2 months§ Control 14 ± 5 <20 NA 111-06 F 10 NA MThIGF-1 311 ± 86 3 months Control NA 122 ± 13 "Only the transgenic animals (GO) that survived more than 1 day and expressed the foreign genes are listed. Three hGH piglets that did not live 1 day also expressed the foreign gene. The total number of transgenic animals produced in each u is indicated in Table 2. tWe estimated the number of copies of MThGH, MThGRF, and MThIGF-I per cell by extracting total nudeic acids from a piece of ear or tail sample and perfomiing quantitative DNA dot hybridization, using probes specific for the various transgenes (16). $Concentrations of plasma hGH were deteniuned at birrh as described (11). Concentrations of bGH were deterrnined at birth using USDA-bGH-B-1 as a standard USDA-bGH-I•1 for radiolabeled ligand and HS-T83- anti-bGH antiserum (65); bGH was not detected in plasma from control pigs. Concentrations of plasma pGH in control and MThGRF pigs were dttermined in samples collected weekly, usi'ng USDA-pGH•B-1 as standard, USDA-pGH•I-1 for radiolabeled ligand, and DM•2027 anti-pGH antiserum (66). The mean plasma pGH concentration in two control litrermates of MThGRF pigs were 13 t 22 and 15 t 4 ngiml (mean "_- SEM). The plasma pGH concenrration in control pigs between 7 and 30 days of age was 9.7 t 2.7 ng ml (mean ~ SEM; n= 64) and betwcen 90 and 120 days of age was 2.9 - 0.3 ng mi (n = 117). The plasma pGH concentration in pigs expressing hGH was <0.75 ng/nil. Concentrations of GR.F were determined in plasma collected at 2 to 3 months of agc as described (67). Concentradons of IGF•I were detemuned using rccombinant human IGF•I (Amgen, Thousand Oaks, Califomia) as the standard and radiolabeled ligand and CH549/805C anti•human IGF-1 serum (68). Plasma samples were ex'tracted with acid-ethanol before assay (69). IFG•I levels (mean ± SEi14, n= 3 or 4) for hGH and bGH transgenic and httermate controls (n = 8 or 23) are from samples collected from between 90 and 150 days of age. IGF-I levels (n = 2) for hIGF-I rransgenic and littermate control are from samples collected at 2 and 2.5 months of age. §Animals that were killed to obtain tissues for assay. MThGRF pig 86•04 is alive and is approximately 2 years old. SCIENCE, VOL. 24¢ I284 20470`51.945
Page 98: brs52e00
trials that resulted in a substantial (A~) > 4 hour) shift of the endogenous circadian temperature cycle (26 of the 45 trials). Even after substantial phase-advance or phase- delay shifts (Fig. 3), the average waveforms of circadian rhythms in plasma cortisol and urine output continued to bear the same phase relation to the endogenous circadian temperature cycle as they had during base- line CR's. This indicates that each of these rhythms was shifted by an equivalent amount and suggests that the cyclic bright light stimulus has shifted a master circadian pacemaker driving all three of these rhythms. The phase shifts induced by the three- cycle stimulus used in these experiments were primarily dependent on the timing of exposure to bright light. We compared the results of our 23 resetting trials in which the subjects' daily exposure to bright light oc- curred midway through their daily 16-hour exposure to room light with trials in which the midpoint of the daily bright light expo- sure either preceded (11 trials) or followed (11 trials) that of the room light. We found that the timing of exposure to ordinary room light (-150 lux) compared to dark- ness (and sleep) can affect the magnitude and direction of phase shifts induced by bright light stimuli applied at peak light Fig. 1. Circadian phase resetting induced by light. (A) Before the initial phase assessment, the sleep (black bar) and wake (open bar) episodes of subject 706 (20-year-old male) were scheduled at their habitual times. The initial phase assessment consisted of a constant routine (CR) (hatched bar) in room light (averaging 150 lux) (8). En- dogenous circadian phase (ECP) was assessed by fitting a two-harmonic regression model (dotted line) to the core body temperature data (solid line) from the CR (9). The resultant phase refer- ence marker (ECPmi„) is indicated by an encircled cross and a vertical dashed line; tl indicates the clock hour (8:10 a.m.) when the initial ECPmin occurred. (B) The light stimulus consisted of three cycles of exposure to a repeating daily pattern of illuminance: ordinary indoor room light (100 to 200 lux) throughout scheduled waketimes; bright light (7,000 to 12,000 lux, comparable in intensity to natural sunlight just after dawn) (38) for 5 hours per day, bracketed by 15 minutes of transitional illumination; and dark- ness (<0.02 lux) throughout scheduled sleep episodes. The average daily illuminance pattern (solid line) for subject 706 is plotted on a cube- root scale (39). The initial ECPmi„ (tI) has been assigned a reference value of 0 on the initial phase scale. On that scale, ~); indicates the initial circadi- an phase at which the midpoint of the overall light exposure occurred (1.0 hour after the initial ECPmi„). On the final phase scale, the final ECPmin (t2), observed after the intervention, has been assigned a reference value of 0; c~f indicates sensitivity (13) (Fig. 4). Therefore, we have incorporated the timing of exposure to both bright light and ordinary room light into the definition of the stimulus by calculating a brightness-weighted average of the mid- points of exposure to bright light and room light (14). We have used the phase of that brightness-weighted midpoint of the overall light exposure to denote the initial circadian phase ((~i) at which we applied the light stimulus in all of the resetting trials. The magnitude and direction of the phase shifts induced by the three-cycle light stimu- lus were dependent on the initial circadian phase at which the light exposure occurred (Fig. 5A). The largest phase shifts were observed when the stimulus occurred during the subjective night, reaching a maximum when the midpoint of the light stimulus was centered on the initial ECPmin. Advances to an earlier phase tended to occur when the light stimulus was centered late in the sub- jective night (after the initial ECP,I,1n) while species (2) and support our use of t~ temperature cycle measured during CR a; an accurate assay of pacemaker phase. 1 To summarize our data, we have sought a~ mathematical representation, characterized by relatively few parameters, which approxi- mates our understanding of essential circadi- an pacemaker properties. On the basis of our initial demonstration of a direct action of light on that pacemaker (6), Kronauer has recently proposed a mathematical model for A 12:00 - T 0 5 delays to a later phase occurred when the B light stimulus was centered early in the subjective night (before the initial ECPm;n) (Fig. 5A). Only small shifts were observed when the stimulus was centered within the subjective day. These results are consistent with the general properties of phase re- sponse curves to light described in all other CI U ~ 37.0 ~ A Final phase -• !8 5 6:00 12 36.0 Time of day 00 8:00 24~ 6:00 ' t A6 = +8.0 hours t j2 2:00 m 1 0 ~ 12:00 t= Relative clock hour 18:00 24:00 6:00 1 , I t2 t, f' so=+t---07n ~ 18:00 24:00 6:00 , I c 7Z 12:00 I 12:00 _~o = NS 18 Fig. 2. Response of the circadian pacemaker to inversion of the sleep-wake schedule in an 18- year-old man (subject 720) exposed to either bright light (A) or darkness (B) centered around the uutial ECPR,;n. (A) Rest-activity pattern plot- ted in a raster format, with successive days plotted beneath each other, illustrating a displacement of the sleep-wake cycle equivalent to that required for a 10.8 hour westward time-zone change. Symbols as in Fig. 1A, except that (i) constant routines are indicated by open bars; (ii) the time scale is defined relative to the subject's initial ECPW;a, assigned a reference value of 05:00 (cor- responding to the usual clock hour at which the ECPm.,, would occur in a healthy young man living in his home environment who sleeps from midnight to 8:00 a.m.); and (iii) the open box represents three cycles of daily exposure to a 5- hour episode of bright light (averaging 9843 lux) during the subject's scheduled daytime. After exposure to bright light centered around the subject's initial ECP,,,i,,, the subject's final ECPmi, (tZ = 18:18) was substantially phase advanced (0d~ =+10.7 hours) relative to the initial refer- ence value (n = 05:00). Using a Monte Carlo technique, our estimate of the standard error of each phase measurement is ±1.1 hours, or ±1.5 hours for the phase shift. (B) Control study of the 16:00 same subject during a sleep-wake schedule dis- the circadian phase of the light stimulus with respect to the final phase scale, where A(~ is the phase shift and d~f =~); + pd) (11). In this case, cbf occurred 9.0 hours after the final ECP,,,i,,. (C) After the intervention, the final ECPa,i„ (t2) occurred at 00:11 a.m., 8.0 hours earlier than the initial ECP,,,;,, (rl). This indicates that an 8-hour phase-advance shift (0~) = +8.0 hours) was induced by the three-cycle intervention protoc-ol, placement equivalent to that in (A). Stippled box represents three cycles of daily exposure to 5-hour episodes of darkness (< 0.02 lux) during the subject's scheduled daytime. Despite inversion of his sleep-wake schedule, the difference between the subject's final ECPmi„ (t, = 05:45) compared to its initial reference value (t! = 05:00) was not significant (NS). 16 lUNE 1989 REPORTS 1329 204Mi993
Page 99: brs52e00
pressing cells, and enzymatic release of lumi- nal cells from the graft material for cyto- chemical characterization in vitro. Six of seven dogs had bilaterally patent grafts at 5 weeks. Scanning electron microscopy showed a lining of cells with endothelial-like morphology on the luminal surface of 10 of Fig. 1. In situ analysis of grafts for virus-transduced cells. A longitudinal section of the genetically engineered implant from animal 6 was analyzed for cells that ex- press virus-directed (3-galac- tosidase. Grafts were cut longitudinally into thirds and a third was fixed for 5 min in phosphate-buffered saline (PBS), pH 7.4, con- taining 0.5% gluteralde- hyde, washed in PBS three times, and incubated in X- gal solution for 2 hours (4). The grafts were visualized en face through a Leitz dis- secting microscope and two representative fields are presented in (A) and (B) at x 30 magnification. Flow of blood is from top to bottom. Selected areas in (A) and (B) are presented at higher magnifications (x 100) in (C) and (D), re- spectively. 12 patent grafts; however, the endothelial cell monolayer was variably disrupted along the peaks of the crimped grafts during the harvesting process. Each patent and repopulated graft that had been seeded with infected endothelial cells contained (3-galactosidase-positive cells Table 1. Summary of implantation experiments. Autologous endothelial cells were harvested from external jugular veins of mongrel dogs (20 to 25 kg) by previously described methods (3), plated into fibronectin-coated flasks, and maintained in M199 medium supplemented with 5% plasma-derived equine serum, penicillin, streptomycin, porcine heparin (100 µg/ml), and endothelial cell growth factor during two serial passages over a 10- to 14-day period. During this time period, the cells were exposed to fresh stocks of virus supplemented with polybrene (8 µg/ml) every 3 days (18 hours per exposure). At the end of the second passage, cells were harvested and samples were analvzed directly, cyropreserved, or used to seed 6 cm by 4 mm knitted Dacron grafts (CR Bard, Billerica, MA) according to the four-step method of Yates in which 0.75 x 106 endothelial cells were added to the autologous blood during the second and third steps (8). Animals were anesthetized, and 6-cro segments of both carotid arteries were replaced with the seeded grafts as described (3). Each animal received an implant seeded with infected endothe(ial cells and a contralateral graft seeded with mock-infected cells. Five weeks later the animals were anesthetized and the grafts were removed and analyzed as described in the legend to Fig. 1. Efficiency is the efficiency of infection of endothelial cells used for seeding, as determined by the in situ cytochemical stain for (3-galactosidase. Coverage represents the percentage of luminal surface area lined with endothelial cells as determined by scanning electron microscopy; this represents a conservative estimate of actual coverage since portions of the monolayers were detached during the fixation of the explant. NA, not analyzed. Analysis of explants Retroviral infection Animal Virus Efficiencv 1 BAG 15% 2 BAG 5% 3 BAG 5% 4 BAL 40-60% 5 BAL 40-60% 6 BAL 40-60% 7 BAL 40-60% *Not analyzed becaase the graft was thrombosed. Patency Coverage Infected Mock Infected Mock Yes Yes >85 >85 Yes Yes >85 >85 Yes Yes >85 >85 No No NA NA* Yes Yes > 15 > 15 Yes Yes 50-60 >85 Yes Yes >85 >85 on the lumen of the vessel (Fig. 1). Contra- lateral grafts seeded with mock-infected en- dothelial cells showed no stained cells. Re- gional variation in the density of genetically modified cells was seen in each graft but was independent of proximity to distal or proxi- mal anastomosis. Sections of the graft that were completely devoid of genetically modi- fied cells usually corresponded to areas in which the monolayer had detached during explantation. Cells were enzvmaticallv harvested from the luminal surface of selected grafts to permit more detailed characterizations of cellular composition and function. Primary cultures of cells were established and ex- panded in vitro for approximately 2 weeks before being analyzed for endothelial cell- specific function and expression of viral- directed 13-galactosidase. Most of the cells that were harvested from explants and ex- panded in vitro retained differentiated endo- thelial cell functions; however, smooth mus- cle cells eventually overgrew one of the cultures. Cells expressing viral-directed /3- galactosidase were detected in all cultures established from genetically modified grafts. Genetically modified cells from explant-de- rived cultures were detected at 25% to 50% of the amount used for seeding. The lower number of genetically engineered cells re- leased from the explant can be explained by a selective disadvantage conferred onto endo- thelial cells by retroviral transduction, by partial repopulation of the seeded graft with endogenous endothelial cells, by nonrepre- sentative expansion of the cells isolated from the graft surface, or by shutoff of expression of ~-galactosidase in a portion of the cells. Although these explanations are not mutual- ly exclusive, partial repopulation with en- dogenous endothelial cells is most likely in light of the composition of the grafts (6). In this study, we demonstrated the feasi- bility of implanting vascular grafts seeded with autologous genetically modified endo- thelial cells. The cells are present on the lumen of the graft for at least 5 weeks and the transferred gene continues to function. This technology has potential applications for the treatment of atherosclerotic disease and the design of new drug delivery systems. Retrovirus-mediated transduction of endo- theliai cells could be used to improve the function of vascular grafts in ways not previ- ously possible. Endothelial cells could be genetically modified to secrete proteins ca- pable of preventing thrombosis or inhibiting neo intimal smooth muscle cell hyperpla- sia, two common pathological mechanisms of graft failure (2). Our results also suggest that endothelial cells may be an appropriate target cell for gene transfer when designing drug delivery systems. Because of their prox- ~ REPORTS I3¢$ I6NNEI989 rG.O`tdb,~?V~~
Page 100: brs52e00
T9b(e Y. In vivo engineering of bacteria for the degradation of xenobiotic and toxic wastes. Bacterium Pseudomonas cepacia P. putida and Pseudomonas spp. P. putida and Pseudomonas alcaligenes Pseudomonas sp. Alcaligenes sp. Acinetobacter sp. Substrate 2,4,5-trichlorophenoxyacetic acid (6,") 2,2-dichloropropionate (68) Chlorobenzenes (69) Chloroaniline, chlorosalicylate, chlorobenzoate, dichlorobenzene, amino-naphthalene sulfonates, hvdroxy-naphthalene sulfonates, and other chlorophenols (70) Dichlorophenoxyaceric acid, mixed chlorophenols, 1,4-dichlorobenzene (71) 4-chlorobenzoate (41) biological control agents of vascular wilts; and the construction of transgenic plants that express phytotoxin immunity genes derived from toxin-producing pathogens (15, 27). Leguminous crops form symbiotic associations with Rhizobium, Bradyrhizobium, and Frankia species that fix atmospheric nitrogen in a form that can be used by the plant. The genes from these bacteria on which attention has focused include (i) the nif genes, which encode nitrogenase components, (ii) genes designated by various acronyms (nod, hsn, fix, syr) that collectively determine Rhizobium host range and nodule development and function, (iii) the dct genes, which are responsible for the energy-yielding metabolism of dicar- boxylic acids in the nodule, (iv) the hup genes, which mediate the capture of hydrogen released as a consequence of nitrogenase function, and (v) genes for the biosynthesis of the phytotoxin rhizobitoxin by Rhizobium japonicum. In the free-living nitrogen-fixing bacterium Klebsiella pneumoniae, 17 nif genes are organized into eight transcriptional units and occur as a cluster in a 24-kb region of the chromosome (28). Transfer of this cluster to Escherichia coli, a close taxonomic relative, confers nitrogen-fixing ability (28). Similarly, transfer of either Sym plas- mids, which carry nod and host-range genes as well as nif, or certain cloned nod or hsn genes between rhizobia can extend, restrict, or have no effect on host range (29). Such a transfer also enables Agrobacterium to initiate nodulation on nonlegumes (29), which suggests that host range may be extended to nonleguminous hosts. Attempts have been made to improve legume yields by modifying the expression of two specific genes in N-fixing symbionts. Strains of B. japonicum and R. meliloti that expressed the dicarboxylate transporter protein (DctA) and the nif activator protein (NifA), respectively, under nitrogen-regulated promoter control gave great- er than 10% increase in biomass production on their respective hosts under greenhouse conditions (30). A subset of nod genes form the nodABC operon, common to all Rhizobia, which is positively regulated by the nodD gene in the presence of plant-derived phenolic substances (flavones or isofla- vones (31). Some phenolic components in the root exudate antago- nize nodD-mediated activation of nodABC and some rhizobia have several copies of nodD with apparently different specificities for phenolic inducers (31). These findings can be exploited in useful ways; for example, the nodulation of legume varieties, or progeny obtained in breeding programs, will be able to be more rapidly screened (32). Interstrain exchange of nodD alleles with different inducer or anti-inducer specificities, modification of other host specificity genes, and engineering of the Nod protein arc also envisioned. In other experiments, a plasmid carrying the R. meliloti da genes enhanced dicarboxylate uptake and nitrogenase activity under mi- croanaerobic conditions in vitro (33). About 25% of natural isolates of R. japonicum are Hup+ and can grow autotrophically on H2 and CO2, whereas other strains are phenotypically Hup-. When isogen- ic Hup+ and Hup- strains were allowed to nodulate soybean roots in a contained N-free system, both the amount of total fixed NZ and plant biomass produced were 10% greater in the Hup+ strain (34). Finally, inactivation of phytotoxin biosynthesis by site-directec mutagenesis significantly improved strain performance (35). The difficulty of introducing rhizobial strains into environments in which resident rhizobia are already present is a problem. New1v introduced strains encounter strong competition from resident strains (36). To establish effective nodulation in the rhizosphere, the inoculant must outnumber the indigenous population by at least 1000-fold. When indigenous Rhizobium populations in soil are high. this requirement leads to high inoculant costs. Little is known of the biochemical determinants of Rhizobium competitiveness, although a toxin (trifoliin) produced by the Rhizobium leguminosarum pathovar trifolii seems to be required for this strain to compete efficiently (37). Ultimately it may be possible to manipulate both host and rhizobial genes to obtain maximum efficiency of nodule formation and function and to tailor strains for unusual soil environments (36, 37). Biodegradation of Xenobiotics and Toxic Waste Transformations Genetic tools can be used to develop specific catabolic pathways for the degradation of xenobiotics in bacteria that can function under a wide range of environmental conditions. For example, the ability to degrade toluene was transferred from a mesophilic bacteri- um into the psychrophilic Pseudomonas putida, which could degrade toluate at temperatures as low as 0°C (38). Currently, the biodegra- dation effectiveness of recombinant bacterial strains at sites contam- inated with toxic and hazardous waste has not been demonstrated; however, both successful (39) and unsuccessfui (40) experiments with nonrecombinant bacteria have been reported. Some toxic chemicals may have structures that are resistant to microbial attack or may be present in mixtures that are incompatible for effective degradation, or in too low or too high a concentration. Successful biological treatment in situ will depend on (i) the introduction and establishment of microbes in the environment, (ii) an improvement in the rate and extent of xenobiotic degradation, and (iii) the resolution of problems inherent in heterogenous spatial distribu- tions of pollutants, nutrients (including oxygen), and microorga- nisms (39, 41). The need to develop environmental processes to treat hazardous wastes is underscored by the fact that there are more than 900 designated hazardous waste sites in the United States, although the actual number is estimated to be closer to 10,000 (40). Many bacterial genes for xenobiotic degradation have originated from strains isolated from contaminated waste sites and are often found on plasmids (41, 42). For plasmids encoding incomplete catabolic pathways, the degradation of recalcitrant chemicals as sole carbon and energy sources may require complementation of plasmid genes by host chromosomal genes to link the plasmid pathway with energy-yielding metabolism. Gene clusters subject to operon control are characteristic of most catabolic plasmids, and two or more regulons have been identified in some cases. Almost all of the plasmids characterized to date that have genes for xenobiotic catabolism are from gram-negative bacteria, predominantly Pseudo- momas species (43). Natural selection processes can be extremely slow in yielding improved xenobiotic degraders, especially when the acquisition of multiple catalytic activities is necessary, such as for the metabolism 1302 20476b 5 1g 6 6 SCIENCE, VOL. 2¢4.
Page 101: brs52e00
6 32 Bound AII (pmol/mg) Fig. 2. Changes in AII receptor concentration in skin during development as shown by Scatchard analysis of the binding data in membrane-rich fractions. Points are the means of duplicate incu- bations in a representative experiment. B/F, Bound to free ratio. Fetus (0), 1(*), 7(11), and 14 (L) days after birth. The data are repre- sentative of three similar experiments. was maintained from day 18 to 21 of gesta- tion, but within 1 day of birth showed a dramatic overall decrease. Quantitation of the decrease in AII receptors after birth was performed by binding of 125I-labeled [Sar1, Ile$]AII to membranes from skin and lingual skeletal muscle, tissues that contain the highest concentration of binding sites in the fetus. AII receptors in skin membranes were reduced only 1 day after birth by 80% compared with the 19-day fetus (Scatchard plots, Fig. 2) (44,400 ± 8,980, n= 5, and 9,110 ± 480 finol/mg, n= 3, mean ± SD). Receptor content continued to decrease to 8.8% and 6% at 7 and 14 days after birth and became undetectable in the adult. The affinity (Kd) of the AII receptor was 6.2 x 10-9M in fetal skin and remained at similar values after birth. In the tongue, used as a representative tissue for skeletal muscle, AII receptor content also decreased after birth but to a lesser extent compared with skin (24,430 ± 7,390 finoUmg in the fetus to 11,390 ± 1,390, and 3,930 ± 190 fmoUmg at 5 and 14 days after birth, respec- tively, and was still detectable in the adult, 46 ± 2.4 fmol/mg, mean ± SD, n = 3). The dramatic decrease in AII receptor con- centration in skin and skeletal muscle after birth was in contrast to the persistent high receptor levels observed in vesicular smooth muscle, adrenal, kidney, and pituitary, known target tissues for AII in the adult (9). To determine whether these unique fetal AII binding sites are functional receptors, we investigated their coupling to intracellu- lar messenger systems using cultured cells prepared from fetal skin. Binding and activa- tion experiments were performed on first and second passage cultures, which on light microscopic examination appeared as a ho- mogeneous cell population with fibroblast- like characteristics (10). These cells con- tained abundant AII receptors with affinity and specificity identical to those in eviscerat- ed fetuses (6), fetal skin and skeletal tissue membranes and primary fetal skin cultures, thus providing a model to study functional aspects of the fetal AII receptor. Scatchard analysis of the binding data in three experi- ments revealed a single class of receptors with a Kd of 2.2 ± 1.1 x 10-9M and a binding capacity of 483 ± 15 flnol per 106 cells (mean ± SD). The properties of these receptors were similar to those described in recognized AII target tissues (3). The cultured skin fibroblasts were used to investigate whether occupancy of fetal AII receptors results in phospholipid breakdown and calcium mobilization (11), as occur in other target tissues (12, 13). Endogenous phosphoinositide pools were labeled by pre- incubation of the cells for 18 hours with ['H]inositol and incubated with AII. As shown in other systems (13), treatment of the cells with 10 nM AII resulted in rapid increases in inositol 1,4-bisphosphate [Ins- (1,4)PZ] and inositol 1,4,5-trisphosphate [Ins(1,4,5)P3] as determined by high-per- formance liquid chromatography (HPLC) (Fig. 3). Ins(1,4,5)P3 attained peak levels in 10 s and decreased to control values by 5 min, consistent with rapid metabolism to higher and lower inositol phosphates (14). Ins(1,4) Pz also reached peak levels in 10 s, but declined more slowly, remaining elevated at 300% above the basal value at 10 min. 6 Fig. 3. Stimulation of inositol phosphate forma- tion of AII in cultured fetal skin fibroblasts. Cells were prepared by trypsin digestion of dorsal skin of 18-day-old rat fetuses as previously described for rat pituitary cells (9). Cultures at the first or second passage were prelabeled for 18 hours with ['H]inositol and stimulated with 10 nM AII for the times indicated, and inositol phosphate metabolites were analyzed by HPLC as previously described (14). Ins(1,4)P2, inositol 1,4-bisphos- phate (0); Ins(1,4,5)P3, inositol 1,4,5-trisphos- phate (0). Similar results were obtained in two additional experiments. Since lns(1,4,5)P3 formation results in calcium mobilization from intracellular stores associated with the endoplasmic retic- ulum (11), the effect of AII on cytosolic calcium was measured in cultured fetal fi- broblasts with the fluorescent indicator, Fura-2 (15, 16). Perfusion of Fura-2-loaded cells with 10 nM All resulted in a rapid increase in fluorescence 20 s after the levels of All started to rise, and reached maximum after 100 s of exposure to the peptide (Fig. 4A). The calculated concentration of AII in the cuvette was 1 nM at the time of the initial increase in fluorescence and 5 nlll at the peak. This effect of AII was completely abolished by simultaneous perfusion with the AII antagonist [Sar',IleB]AII (1 µ~11) commencing 5 min before exposure of the cells to All (Fig. 4B). The demonstration that AII increases ino- sitol phosphate formation and cytosolic cal- cium indicates that the fetal AII binding sites are functional receptors for the peptide. Since the calcium-phospholipid pathway has been proposed as a common route in the A 1.5 L~ J1.3 100 s Fig. 4. Changes in cytosolic calcium in fetal skin fibroblasts perifused with AII in the absence (A) and in the presence (B) of 1 µM [Sar', AlaB]AII commenced 250 s before addition of AII. Intra- cellular calcium was measured with the fluores- cent indicator Fura-2. Second passage fetal cells were plated on glass cover slips (13 x 10 mm, no. 1, Coming) coated with 0.05% poly-D-lysine (Sigma). At 90% confluency cells were incubated in fresh media containing I µM Fura-2 AM for 30 min, washed twice in assay buffer (Medium 199_containing 25 mM Hepes and 0.01% bovine serum albumin) and kept on ice, in the dark, until intracellular calcium was assayed. Fluorescence was measured under dual excitation with wave- lengths of 340 and 390 nm in a spectrofluorome- ter (8000C SLM Instruments, Urbana, Illinois) with a thermostatically controlled cuvette holder. The cover slip was inserted diagonally in a quartz cuvette modified from that described for muscle cells (15), in which two tubes were attached to enable perfusion of the cells at a rate of 1 ml/min with assay buffer containing reagents. The con- centration of AII in the cuvette was calculated in separate experiments from the fluorescence mea- surement during perifusion with calcium-saturat- ed Fura-2. The data are representative of three similar experiments. 1 I 16 JUNE 1989 REPORTS 13q.I
Page 102: brs52e00
It is a masterwork of versatility, bringing all chal- lenges within your reach. It is the Olympus AHS- a rare fusion of compre- hensive advanced research and photomicrographic capabilities. All performed with consummate ease and precision. In its absolute mastery of photomicrography, the AHS defines a new genre- the photoresearch micro- scope. Format selection is exhaustive, ranging from Polaroid to cine to 8"x10'.' Operations from focusing to exposure control are automated. Sophisticated technologies from a com- pany renowned for photo- graphic achievement provide unprecedented simplicity and performance. To this impressive func- tional capacity, the AHS couples engineering of exquisite precision and optics of stunning clarity to give you the one thing a microscope must provide- superior vision. : The AHS Photoresearch Microscope from Olympus -it will change the way you look at things. For a hands-on demon- stration, call toll-free: 1-800-446-5967. Or write for literature to Olympus Corporation, Precision Instrument Division, 4 Nevada Drive, Lake Success, NY 11042-1179 Lz Cawda: 6'6: Carscn Cc.. Ltd. On:ario.
Page 103: brs52e00
t What you see is not all you get. When you look at FPLCm System, you see a first- class tool for high-performance separation of large biomolecules. But what you see is not all you get. When you buy FPLC, you get the benefit of more than 30 years of experience in protein separation; the security of knowing thousands of FPLC Systems are in place around the world; our promise of continu- ous new development. You also get access to handbooks and workshops on new techniques and methodologies developed both in our own labs and in partnership with the research and industrial community worldwide. Who better to support your instruments, columns, media and software than the one supplier that produ- ces all of its own components? Reliability is our trade- mark. If you need advice, you know where to call. Rest assured that FPLC is flexible enough to meet future demands. It can be as unique as is your require- ments. Scale-up, if needs require, from micrograms to grams. And FPLC offers the possibility of full auto- mation. That means multi-step and multi-sample chromatography with column switching. Clean the columns without changing them. Program FPLC on the basis of either time or volume, greatly simplifying your method development, and store up to 50 meth- ods for future recall and use. Contact your local representative and ask to see FPLC System. We think you'll agree that it offers a great deal more than meets the eye. We hel p you manage biomolecules. © ~ Pharmacia ~ Pharmacia LKB Biotechnology Circle No. 104 on Readers' Service Card Head office Sweden Tel 46 (018) 163000. Australia Tel (02) 8883622. Austria Tel (0222) 6866250. Belpium Tel (02) 2424660. Brazii Tel 55-11284581512898987. Canada Tel (514) 4576661. Denmark Tel (02) 265200. East Europe Tel 43 (0222) 921607. Federal Republic of Germany Tel (0761) 49030. F(nland Tel (90) 5021077. France Tel (01) 30643400. Great Britain Tel (0908) 681101. Holland Tel (031) 348077911. Indta Tel (0812) 29634. Italy Tel (OZ) 2532844l26700475. Japan Tel (03) 4929181. Norway Tel (02) 549095. Soviet Union Tel 46 (08) 7998000. Spain Tel (34}36754411. Sweden Tel (08) 7998000. Switzerland Tel (01) 821 1816. United States Tel (201) 4578000. Far East Tel 852 (5) 8148421. Middle East Tel 30 (1) 8947396. Other count.rtes Tel 46 (08) 7998000. (8904)
Page 104: brs52e00
tnm. Physiol. Opt. 60, 278 (1983); National Institute for Occupational Safety and Health, Critena for a Recommended Standard, Occupationa[ Exp-re to Ultra- violet Radiation (National Technical Information Ser- vice, Rockville, MD, 1972, Government Publication No. PB-214 268)]. Our subjects now wear UV- excluding clear Ultra-spec 2000 safety glasses (Uva Winter Optical, Inc., Smithfield, RI) during bright light exposure, confirming that UV light is not responsible for the phase resetting observed. 39. Kronauer (15) suggests that the illuminance of light (as measured in 1ux) is related nonlinearly to its biological influence on the endogenous circadian pacemaker, and that the experimentally determined [S. S. Stevens, Snence 133, 80 (1961)] relation between illuminance (1) and perceived brightness (B), B= CIt'3, might apply here. This has proved effective in the model simulation of laboratorv bright light protocols [R. E. Kronauer and J. V. Frangioni, Sleep Res. 16, 622 (1987)]. 40, We thank the subject volunteers; the student re- search technicians; A. E. Ward, M. J. Matule, A. M. Sinz and M. P. Johnson for direct supervision of the studies; K. Whitmarsh and J. W. Je.vcrt for subject recruitment; J. L. Anderson and S. A. Amira for psychological evaluations; S. Rogacz, J. Steinberg, and R. Mortensen for clinical evaluations; J. Swain, R. Salvador, and M. McCullough for the metabolic diets; L. Thorington for advice on designing the light banks; B. Potter and J. Norwood for hormonal assays; A. E. Ward, D. Sieburth and S. Lawson for the illustrations; M. Dumont, W. O. Freitag, J. Miner and S. H. Strogatz for suggestions on the manuscript; and G. H. Williams for his overall support of this work. Supported in part by grants NIA 1-RO1-AG06072, IN'IH DRR GCRC 5-M01- RR00888, NIH DRR BRSG 2-S07-RR-05950; by NIDDK training grant 5-T32-OK-07529 (E.N.B.); and by the Center for Design of Industrial Sched- ules. C a.C. is a Sandoz Scholar in Medicine. 15 October 1988; accepted 4 May 1989 Water-Inserted a-Helical Segments Implicate Reverse Turns as Folding Intermediates IVI. SUNDARALINGAu'K* AND Y. C. SEKHARUDU Information relevant to the folding and unfolding of a helices has been extracted from an analysis of protein structures. The a helices in protein crystal structures have been found to be hydrated, either externally by a water molecule hydrogen bonding to the backbone carbonyl oxygen atom, or internally by inserting into the helix hydrogen bond and forming a hydrogen-bonded bridge between the backbone carbonyl oxygen and the amide nitrogen atoms. The water-inserted a-helical segments display a variety of reverse-turn conformations, such as type III, type II, type I, and opened out, that can be considered as folding intermediates that are trapped in the folding-unfolding process of a helices. Since the a helix, most turns, and the extended j3 strand occupy contiguous regions in the conformational space of (~, i{r dihedral angles, a plausible pathway can be proposed for the folding-unfolding process of a helices in aqueous solution. A LL OF THE INFORMATION RE- quired for the tertiary folding of a protein is contained in its primary sequence (1). However, protein folding is a fast process that makes characterization of the folding intermediates difficult (2, 3). We have examined native protein structures for hints of what may have happened during their folding. We have found that a water molecule binds to an a helix, either external- ly to the backbone carbonyl 0 atom (Fig. 1A) or internally by prying open the helix hydrogen bond and lodging between the backbone carbonyl 0 atom and the amide group (Fig. 1B). The local conformations of the internally solvated a helices adopt an ensemble of classical reverse-turn conforma- tions (4), types I, II, III, and open turns including the 310 helix, that could represent trapped intermediates in the unfolding or folding of a helices. These intermediate structures occupy either common regions or Deparanent of Biochemistry, University of Wisconsin- Madison, Madison, WI 53706. *To whom correspondence should be addressed. are proximal to each other in the Ramachan- dran conformational space (5), and allow us to propose plausible folding pathways of a helices. The impetus for this work began with our observations on the modes of hydration of a helices in troponin C (6), in which the exposed helix "handle" was surrounded by water molecules that hydrogen-bonded to the backbone carbonvl O atoms and the first turn of the B helix was disrupted by the insertion of water molecules into the helix hydrogen bonds. A similar binding of water molecules was simultaneously found in the structure of a small molecule, a synthetic oligopeptide analog containing a-aminoiso- butyric acid residues (7). We surmised that these hydration schemes represent steps in the unfolding of a helices (6). The water- inserted segments displayed reverse-turn conformations, which suggested that the turn could be an incompletely folded helical segment that was trapped during the fold- ing-unfolding of the a helices. Additional evidence for this arose when we noted the interchangeable occurrence of the helical segments and reverse turns in structures of the same protein from different sources: for example, phospholipase A2 residues 58 to 62, bovine (1BP2) (helical) versus porcine (1P2P) (turn); lysozyme 112 to 115, hu- man (1LZ1) versus chicken (1LZT); acid protease residues 128 to 130, 161 to 163, and 176 to 178, penicillium (2APP) versus rhizopus (2APR). In the similarly folded chymotrypsin family of serine proteases, the helix content and the number of water- inserted segments differ, 2ALP (one helix), 3EST (two helices and one inserted seg- ment, 233 to 237), 3RP2 (three helices and one inserted segment, 233 to 237), 2PTN (three helices and two inserted segments, 172 to 176 and 233 to 237), 4CHA (three helices and one inserted segment, 232 to 236), and 1TON (four helices and three inserted segments, 173 to 177, 232 to 236, and 233 to 237), again revealing the inter- changeability of helical and nonhelical seg- ments. In troponin C, there are four ho- mologous calcium-binding helix-loop-helix motifs, namely, A, B; C, D; E, F; and G, H, but onlv the B helix contained inserted waters, whereas the other helices did not (6). We collected hydrated a-helical segments from 35 protein structures (Table 1) that have been refined at a resolution of 1.9 A or better from the Brookhaven Protein Data Bank (8). Only one structure from a family of proteins was included in our analysis. In serine proteases, one each from chymotryp- sin and subtilisin families was used. We used the criterion that the hydrated "helical" seg- ment should contain at least two residues in common with a helix, inclusive of the termi- nal residue, and also be compatible with retention of the adjacent helical conforma- tion as visualized on a PS300 system using FRODO. Hence, we used N - 3 and C+ 3 as helix boundaries, where N and C are the positions in the sequence of the helix terminal tersidues, as found in the Brookha- ,oCa Fig. 1. The local pentapeptide segment of an a helix (A) with an externally bound water to the backbone carbonvl 0 atom, and (B) with an internally bound water bridging the backbone carbonvt O; of the ith residue and the amide nitrogen atom Nt1a. 'J t 16 JUNE 1989 REPORTS I333
Page 105: brs52e00
I Ffg. 1. Growth habit of fila- mentous fungi. A. nldutans hvphae were grown in agar- ose-solidified medium and photographed at x 100 by using differential interfer- ence contrast optics. molecules. OSC viability ranges from <0.1% to >30%. Even though very low viabilities may be encountered, large numbers of OSCs can usually be obtained without difficulty. DNA can also be introduced into OSCs by electroporation (5). In addition, intact cells can be treated with Li' or Cs+ before addition of DNA and treatment with PEG (6). Transformation procedures involving particle bombardment (7) or partial cell breakage by blending with glass beads (8) could also be useful with filamentous fungi. Selectable Transformation Markers Selection of transformants from the background of nontrans- formed cells depends on expression of genes conferring readily selectable dominant phenotypes. Transformation of a filamentous fungus was originally reported by Mishra and Tatum in 1973 (9). They treated an inositol-requiring N. crassa mutant strain with DNA from the wild type and obtained inositol-independent colo- nies. However, molecular techniques were not available for charac- terization of the putative transformants. Case et al. (10) first confirmed DNA-mediated transformation of N, crassa by using the qa-2 gene, which had been cloned by virtue of its expression in Escherichia coli (11). Transformants were shown to contain chromo- somally integrated plasmid molecules. Subsequently, many Neu- rospora genes have been recruited as selectable markers for transfor- mation (12), including pyr-4 (13), trp-1 (14), am (15), and Bml (benomyl resistance) (16). Transformation of A. nidulans was first reported by Ballance et al. (13), who used the N. crassa pyr-4 gene to complement an A. nidulans pyrG mutation. Shortly thereafter, Tilburn et al. (17) used the A. nidulans amdS gene, encoding acetamidase (18), and Yelton et al. (19) used the A. nidulans trpC gene for transformation. In each case, transforming DNA became integrated into the genome, often at homologous sites. Subsequently, other A. nidulans genes were used as transformation markers, including argB (20), prn genes (21), pyrF (22), pabaA (4), niaD and niiA (23), and BenAR (benomyl resistance) (24). Transformation frequencies and the types of integration events obtained vary with the selective marker used. Transformation of many other fungal species, including medical- ly, industrially, and agriculturally significant species, rapidly fol- lowed the successes with N. crassa and A. nidulans (25). However, appropriate auxotrophic mutant strains do not exist for most fungal species. Thus, transformation with plasmids containing metabolic genes is usually not feasible and dominant selectable markers that do not require corresponding mutant strains are therefore of particular value. The Bml (BenAR) and amdS genes have been useful in this context. Similarly, plasmids containing hvgromycin or bleomycin resistance genes fused to fungal promoters have been incorporated into a number of transformation plasmids (26). The existence of these plasmids means that most fungal species, even those that have not previously been subjected to laboratory investigation, can now be genetically modified by transformation. I3I4. Fates of Selective Markers Transforming DNAs could in theory be maintained extrachromo- somally, and autonomously replicating fungal transformation vec- tors have been reported (27). They have not found wide use as molecular cloning vectors, however, perhaps because it is difficult to maintain the vectors in the extrachromosomal state. Genetic selec- tions cannot be applied to individual nuclei, because the fungal thallus is coencytial. Nuclei lacking the plasmid carrying the selective marker continue to divide by cross-feeding with nuclei that contain the plasmid. As metabolically incompetent nuclei accumulate in the common cytoplasm they are expected to become a drain on the organism, ultimately leading to cessation of growth (28). The appearance of a high proportion of "abortive" colonies in primary transformation plates (13, 17, 19) could result from unstable plasmid replication. No methods are currently available to prevent plasmid integration and thereby to maintain strains carrying autonomous plasmids. Plasmids readily integrate at either homologous or heter- ologous sites, so construction of molecules lacking genomic homol- ogy is of no use. Addition of a centromere to plasmids could increase mitotic stability and prevent chromosomal integration (29). However, centromeres have not yet been isolated from filamentous fungi and S. cerevisiae centromeres do not display detectable activity (30). Genomic integration of circular plasmids occurs in several ways. Some transformants appear to arise from simple gene conversion or double crossover events, in that no integrated plasmid sequences are detected (Fig. 2A) (19, 31). In other transformants, however, plasmid molecules are incorporated into the genome. Integration sometimes occurs at homologous sites, leading to formation of tandem reiterations of the target region separated by plasmid sequences (Fig. 2B). Integration also occurs at heterologous sites, with insertion of single or multiple plasmid copies (Fig. 2C). It is not known whether nominally heterologous integration events A Plasmid Chromosome Recombinant chromosome Recombinant plasmid B Plasmid Chromosome Recombinant chromosome ~ -~ C Plasmid -- _^ ~ Chromosome--~-~ °T~ - Recombinant cnromosome Fig. 2. Transformation with circular plasmid DNA. Thin lines represent plasmid DNA and thick lines represent chromosomal DNA. Shaded rectan- gles represent genes. Vertical lines within genes represent mutations. (A) Double crossover or gene conversion event at the homologous chromosomal site. (B) Single crossover events at the homologous chromosomal site. Integration of multiple plasmid copies could result from recombination events occurring before (upper right) or after (lower left) plasmid integra- tion. (C) Heterologous integration event. Recombination within the gene sequence is exper*-i to lead to its inactivation. 204'70 5 19'78 SCIENCE, VOL. 24-4.
Page 106: brs52e00
There is no de6rutire statement of the precision of the bcoadcase epF.emecides. Our experienc.e suggests that they are accurate at about the 5-m level, or -0.25 ppm. We obtained the same results (at the millimeter level) when we processed selected Park- field observations with improved orbits. 10. M. Chin, GPS Bull. 1, 1(1988). 11. We used a coordinate svstem derived from VLBI and satellite laser ranging coordinates [M. Murray and R. King, b4as,. Irut. Tech. Intern. Memo. (11 March I988)]. The coordinates of station 10JDG in this system were determined from GPS observations to the VLBI station Fort Ord. 12. S. S. Schulz et al,, J. Geophys. Res. 87, 6977 (1982). Because the creep rate varies along strike in this area, some interpolation is required in comparing the rates of instnunents that are not collocated. 13. J. C. Savage and W. H. Prescott, ibid. 78, 6977 (1973). 14. The leveling data were provided by R. Stein, person- Novel Sites of Expression of Functional Angiotensin II Receptors in the Late Gestation Fetus MONICA A. MILI.AN, PII.AR CARVALLO, SHUN-ICHIRO IZUMI, SHARON ZEMEL, KEVIN J. CATT, GRETI AGUILERA In the adult, the peptide hormone angiotensin II(AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional All receptors in the fetus suggest a role for AII in fetal development. E MBRYOGENESIS, FETAL DEVELOP- ment, and growth are controlled by the coordinated action of a number of humoral regulators. In addition to tradi- tional growth factors (1), an increasing number of peptide hormones have been implicated in cellular growth regulation (2). The octapeptide angiotensin II (AII), classi- call,v associated with control of blood pres- sure and electrolyte metabolism (3), stimu- lates cell growth and increases the expres- sion of platelet-derived growth factor (PDGF) and the growth-related proto-on- cogenes c-myc and c fos in cultured smooth muscle cells (4, 5). Abundant binding sites for AII are present in membranes prepared from eviscerated rodent fetuses, indicating the presence of All receptors at sites other than the traditional target in the adult (6). All components of the renin-angiotensin system, including immunoactive and bioac- tive AII, are found in the fetal-placental unit, thus providing the specific ligand for the fetal All binding sites (7). To characterize the topographic distribu- tion of AII receptors in the fetus, we ob- tained female Sprague-Dawley rats at 7 to 21 days of gestation, litters of different ages, and adults from Zivic Miller (Zelienople, PA). Rats were killed and fetuses were im- mediatelv removed and frozen at -40°C. Autoradiographic analysis of AII receptors Section on Endocrine Physiology, Endocrinology and Reproduction Research Branch, National Institute of Child Health and Human Development, National Insti- tutes of Health, Bethesda, MD 20892, in the fetuses was performed by binding of "I-labeled [Sar',Iles]AII to slide-mounted sections (8). Midsagittal and lateral sagittal autoradio- grams from a 19-day-old fetus are shown in Fig. 1, A and B, respectively. All organs are fully formed at this stage, and AII binding 26 al communication. 15. R. S. Stein, Earthqnuke Prediction (Maudce Ewn,q Ser. ,Lfonogr. 4, American Geophysical Union, Washing- ton, DC 1984). 16. The authors thank E. Himwich for providing the VLBI solutions. Part of this work was done while J.L.D. held a National Research Council-U.S. Geo- logical Survey Research associateship. 27 Januarv 1989; accepted 28 April 1989 was readilv detectable in known target tis- sues including the adrenal zona glomerulosa and medulla, kidney, liver, and smooth mus- cle of the bronchi, blood vessels, and gastro- intestinal tract. Particularly striking, howev- er, is the intense AII binding in areas not normally expected to contain AII receptors, such as the subepidermal laver of the skin, mesenchymal and connective tissues, and skeletal muscle, especially the tongue. Little or no binding was detectable by autoradiog- raphy in brain, spinal cord, cartilage, bone, fat, and heart. The observed binding was specific, since all staining was abolished by incubation in the presence of 1 µM unla- beled AII, but was unchanged by excess amounts of the unrelated peptides, cortico- tropin-releasing factor (CRF), arginine vasopressin (AVP), and adrenocorticotropic hormone (ACTH). AII binding was first detected at about day 12, and by the time organogenesis was completed (day 15), its localization and density was as described in Fig. 1. The high receptor density seen by autoradiography Fig. 1. Autoradiographic analysis of 125I-labeled [Sar',Jle$]AII binding to 20 µm of sagittal frozen sections of 19-day-old rat fetus (A) medial section (B) lateral section. Nonspecific binding measured in the presence of I µ14 AII was undetectable (not shown). Topographic distribution of the binding as determined by light microscopic analysis of the sections is indicated by the numbers: 1, pituitary gland; 2, mesenchvmal tissue; 3, tongue; 4, nasal cavity; 5, skeletal muscle; 6, heart; 7, aorta; 8, lung; 9, liver; 10, umbilical cord; 11, spinal cord; 12, small bowel; 13, tail; 14, esophagus; 14, larynx; 16, trachea; 17, soft tissue around the eve; 18, diaphragm; 19, adrenal gland; 20, kidney; 21, inner ear; 22, hind foot; 23, salivarv gland; 24, analgene of vibrissae; 25, rib; 26, vertebral bodies; 27, root of inesenterv; 28, brown fat deposit; 29, thymus; and 30, meninges. The figure is representative of five similar experiments. SCIENCE, VOL. 2-a-1- 1340 204'7o52004
Page 107: brs52e00
The new MICRO-ISOLATOR''System: A revolutionary breakthrough in animal housing. R fl "at %5M le:r:r r.rrrntdrrtcr.nui>,mUrrlheMlCItOI5OLArOR`;yr.l"rrr'•f'nulu0•.,I'nnraIde..:rn, if'uoa~rlruc:Marucd" (:n~rynlld' ItinM~vfu.(;rr~rur:rlwn,I!)fit:r A simple and versatile animal housing system that offers greater microbiological control than complex barrier rooms... but without the incon- venience and inefficiency that barrier rooms impose by limiting the movement of people and animals. The Principle In effect, the MICRO-ISOLATOR System involves the use of durable filter-topped cages that function as "giant Petri dishes," which are only opened within a Class 100 workbench by personnel who observe aseptic technique at all times# There are many benefits to this unique miniaturization strategy For example, ani- mals from multiple sources with different microbiologi- cal profiles have been housed in the same room without cross contamination. Likewise, investigators can experimentally infect animals in different MICRO- ISOLATORS within the same room without interfering with one another's research... and all of this can be accomplished without the inconvenience of requiring personnel to shower into or out of the room. Also, since all manipulations are conducted in a Class 100 work- bench, individuals allergic to animals are protected from dander and therefore are able to work in comfort. The complete MICRO-ISOLATOR System consists of the individual MICRO-ISOLATOR housing units, the STAYCLEAN°" Laminar Flow Workbench, and the service cart. The MICRO-ISOLATOR Units This system consists of an autoclavable plastic cage and plastic filter frame with a static filter (now designed for rapid replacement of the filter material), plus the usual cage accessories. The plastic filter frame over- laps the bottom portion of the cage and effectively forms a giant Petri dish-like structure. Result: there is an effective protection against microbial contamination while still allowing for substantial gaseous interchange. The MICRO-ISOLATOR is, in other words, a protected microenvironment within any insect-controlled macroenvironment. MICRO-ISOLATOR units, fabricated of autoclavable plastic material, are now available for mice, rats, hamsters, and guinea pigs.
Page 108: brs52e00
Table 2. Summary of the estimates of precision of GPS observations from root-mean-s9uare (rms) residuals; N, number of observations. The rms was calculated from the residuals to the best-fitting straight line to all of the data. ' t Station 1 Station 2 N Time span (months) Vector length (krn) North rms (-) East rms (-) Up rms (mm) Length rms (-) CIGNET NCNM1 4 20 0.24 1.5 1.8 4.6 1.4 10JDG 33JDG 27 34 7.0 2.5 5.6 11.8 5.4 10JDG Joaquin 27 34 10.6 3.6 5.8 12.5* 5.9 10JDG Oquin 26 34 11.9 4.4 5.0 17.4 4.4 Loma Prieta Eagle 7 10 31.4 10.7 9.8 17.6 9.1 Loma Prieta Allison 8 10 43.2 11.5 17.7 21.3 10.8 Palos Verdes Vandenberg 6 24 223.1 6.1 10.9 38.8 10.8 !!!~ *One discrepant outlier in this series was omitted in calculating the rms. 43281.15 . Allison Fig. 3. Geodolite (squares) and GPS (circles) data for two Lines observed with both systems; (A) data for the Loma Prieta-Allison line; (B) Loma Prieta-Eagle line. Error bars for Geodolite come from (13) and for GPS from Table 2. 0.03 0.02 0.01 0.00 -0,01 -0.02 -0.03 0 ; 10 20 30 40 Length (km) li 50 Fig. 4. Difference between Geodolite and GPS observations. Circles are differences of one Geo- dolite and one GPS observation of the same line at Hebgen Lake, Montana. Squares are differ- ences of the the means of data shown in Fig. 3. Error bars are computed from (13) and Table 2. data suggest that there is no significant difference between the two systems at the level of 0.2 ppm. The four stations of the Parkfield network are part of a line that is leveled to first-order standards annually (14). The elevation dif- ferences obtained from the leveling (Fig. 2) are well within the scatter in the GPS obser- . VLBI o GPS 1985 1986 1987 1988 1989 Fig. 5. Length of Palos Verdes-Vandenberg line measured by VLBI (solid circles) and by GPS (open circles); GPS error bars are from Table 2; VLBI error bars were calculated by propagation of error estimates through the solution. vations. Because we are considering only changes of elevation difference, the distinc- tion between orthometric and ellipsoidal heights is irrelevant. In addition to the two leveling observations that are contempora- neous with the GPS measurements, there are two earlier level surveys. The rms of all four level surveys is 4.4 mm for station pair 10JDG-33JDG, 5.2 nun for 10JDG-Joa- quin, and 4.8 mm for 10JDG-Oquin. These values are significantly smaller than the GPS measurements of 11.8 mm, 12.5 mm, and 17.4 mm of the vertical component for the same sites (Table 2). At these distances, relative elevation is determined more pre- cisely with conventional leveling. At longer distances, GPS might provide the more pre- cise measurement because GPS errors ap- pear to grow more slowly with distance than leveling errors [Table 2 and (15)]. The Palos Verdes to Vandenberg line has been observed by very long baseline interfer- ometry (VLBI) four times in the past few years. On the basis of a comparison of GPS and VLBI measurements (Fig. 5), there is no significant offset between the two mea- surements over this >200-km line. The two techniques appear to indicate that there is a different rate of lengthening along this line, but, given the small sample size, this differ- ence is not significant. At its present level of precision, GPS provides a useful signal-to-noise ratio for monitoring plate motion and plate margin deformation at scales from 10 m to at least 200 km over periods of a few years. In order to achieve this precision, it is necessary to have clean, high-quality data from a network of tracking stations and careful (time-con- suming) data processing to improve orbits. For lines less than about 10 km, the current broadcast orbits are adequate, and obtaining high precision is then somewhat less time- consuming. REFERENCES AND NOTES 1. 0.1 ppm/year = 0.3 x 10-14/s; W. H. Prescott, J. C. Savage, 6i'. T. Kinoshita, J. Geophys. Res. 84, 5423 (1979). 2. H. F. Reid, in The California Earthquake of April 18, 1906, Report of the State Earrhquake Investigation Com- mission (Carnegie Institution of Washington, Wash- ington, DC, 1910), voL 2, pp. 16-28. 3. J. J. Spilker, Navigation 25, 122 (1980). 4. The data were collected with dual-frequency TI- 4100 receivers. Each observation session consisted of 4 to 8 hours of satellite tracking. Air pressure, temperature, and humidity near the station were recorded approximately once every hour; GESAR svffivare (5) was used to control the receivers and to record data. The processing was done with Bernese version 3.0 software (6). In addition to solving for any subset of the station coordinates, we also solved for orbital elements (7) for each satellite, atmospher- ic zenirh-delay parameters, ionospheric model coef- ficients, and cycle ambiguity terms (8). For short cectors (12 km or less), our results include only Lt processing (9) with broadcast satellite ephemerides. Cycle-count ambiguities were first estimated, then set to integers and removed from the solution. For longer vectors, it was necessary to estimate satellite orbit parameters as well as station coordinates, because the orbits become a primary source of error at longer distances. Thus, the data from stations in the local networks were supplemented with all avail- able simultaneous data from a network of fiducial stations in North America (10), and orbit parame- ters were adjusted as part of the solution. In model- ing the satellite orbits, we used arcs of several days, even if the local observations were made during a single day. For longer vectors, the difference be- tween the Lt and L2 phase observations was used to estimate and to remove the ionospheric delay, creat- ing the so-called ionosphere-free observable (8); satellite cycle ambiguities were estimated and not fixed to integers. 5. R. Darnell and L. Hawkins, User's Guide to GESAR Version 1.0 (Applied Research Laboratory, Universi- tv of Texas, Austin, 1986). 6. W. Gurmer, G. Beutler, I. Bauersima, T. Schild- knecht, in Proceedings of the First International Sympo- sium on Precise Positioning with the Global Positioning System, Rockville, MD, 15 to 19 April 1985 (Na- tional Geodetic Information Center, Rockville, MD, 1985), vol. 1, p. 363. 7. G. Beutler, W. Gurtner, I. Bauersima, R. Langley, ibid., p. 99. We have made a few modifications to the algorithms and implemented the software on Macin- tosh microcomputers. 8. R. W. King, E. G. Masters, C. Rizos, A. Stolz, J. Collins, School of Surveying Monogr. 9(University of New South Wales, Kensington, Australia, 1985). 9. On these short vectors, much of the difference between Lt and L, is random. Neglecting the ionospheric correction reduces the scatter at the expense of introducing a bias (0.3 to 0.5 ppm, or 2 to 6 mm, for the three vectors at Parkfield); a similar bias of about 0.5 ppm was found by Y. Georgiadou and A. Kleusberg [Manusc. Geodaet. 13, 1 (1988)]. 16 JUNE 1989 2O470',_ 2_03 REPORTS 1339
Page 109: brs52e00
I Announcing a unique RIA technology-. it's in closer proximity than you think • No liquid scintillation cocktails required •Time saving • Cost saving • I ncreased safety • High performance Amersham introduces Scintillation Proximity Assays • No separation of bound from free required • Simple to use; convenient protocol • Readily automatable Full details on the theoretical and technical aspects of scintillation proximity assays are given in our technical booklet 'Scintillation Proximity Assays - principles and practice', available on request. Products available • Generic reagents - for the development of in-house assays Ordering code Scintillation Proximity Assay (SPA) reagent, anti-rabbit RPN 140 Scintillation Proximity Assay (SPA) reagent, anti-mouse RPN 141 Scintillation Proximity Assay (SPA) reagent, anti-sheep RPN 142 Scintillation Proximity Assay (SPA) reagent, protein A RPN 143 • Assay systems 6-Keto-prostaglandin F1Q [3Hl Scintillation Proximity Assay (SPA) system TRK 952 Thromboxane B2 [3Hl Scintillation Proximity Assay (SPA) system TRK 951 Amersham Intemational plc Amersham UK UK Sales Aylesbury (0296) 395222 Amersham Australia PTY Ltd Sydney 888-2288 Amersham Belgium SA/NV Brussels (02) 770 0075 Amersham Buchier GmbH & Co KG Braunschweig West Germany (05307) 8080 Amersham Canada Ltd Oakville, ONT (416) 842 2720 Amersham Corporation Arlington Heights, IL USA (312) 364 7100 Amersham Denmark ApS Birkered 02-82 02 22 Amersham France SA Paris (1) 69.28.83.00 Amereham Japan Tokyo (03) 816 6161 Amersham Nederland BV Houten 03403 03 76660 Amersham Norway Sandvlka 02-54 63 18 Amersham Sweden AB Solna 08-734 08 00 Circle No. 181 on Readers' Service Card
Page 110: brs52e00
A Eco RI 1 2 3 4 5 6.8 - *~-- 40 Ms ... 4.9 ~~ 4.8 . 53- 3.7- Taq I 1 2 3 4 5 -M .w .... n NC'} (D O N + CLI B Eco RI 1 2 3 4 5 2.4- co .t o ~ 1.0- -., ,W ~ Z 6 U n ~ + N + ~7 -~ V ~ + ° ~ Fig. 3. Comparison of the sizes, in kilobases, of the exon-containing restriction fragments present in total human DNA and the factor IX and PAI-2 YAC clones. (A) An autoradiogram showing the hybridization of Eco RI and Taq I digests of human and yeast DNA with the factor IX cDNA probe. The fragments in these digests were sepa- rated by size on an agarose gel (9) and transferred to a nylon membrane for hybridization. In both panels, lane 1 contains digests of total human DNA prepared from the lymphoblastoid cell line CGM-1, which was derived from the same indi- vidual whose DNA was used to prepare the YAC library. The remaining lanes contain either yeast DNA from a factor IX YAC clone (lanes 3 and 5) or mixtures of total human DNA, in the same amount used in lane 1, with an approximately threefold molar excess of DNA from a factor IX YAC clone (lanes 2 and 4). Clone A32G5, 650 kb; clone C8B7, 60 kb. (B) Eco RI digests hybridized with the PAI-2 cDNA probe. The layout of the gel is the same as in (A). in the 650-kb YAC, In contrast, the 60-kb YAC contained onlv the 5.5-kb Eco RI fragment, to which the last two exons at the 3' end of the factor IX gene have been mapped (4). Comparable analyses of the factor IX clones with Taq I again show that the 650- kb YAC contains all the hybridizing frag- ments present in human genomic DNA, whereas the 60-kb YAC contains onlv one z ~ m ~ A 1 2 3 4 5 6 7 8 9 1 0 11 B Fig. 4. Srabilirv of the 12 1 2 3 4 5 6 7 8 9101112 650-kh facrnr TX ~1.,.,e wi (~5n ® ..~~..s~ durmg prolonged propa- gauon m reast. (A) Flu- •.00 ~iitilft orescent staining pattern ot a pulsed-field gel showing the separated natural and artificial chromnsnmec frnm r..., subisolates of the 650-kb factor IX clone A32G5 (lanes 2 to 6 and 8 to 12) and an unrelated YAC (lane 1, YY212). The subisolates of A32G5 had been separately cultured for 60 generations in either the rich medium YPD (lanes 2 to 6) or the ura- trp-selective medium AHC' (lanes 8 to 12). (Lane 7 is lambda ladder.) Electrophoretic conditions were as described for Fig. 3A. (B) Hybridization of the 650-kb YAC in the ten subisolates of A32G5 to the factor IX probe after transfer of the DNA to a nylon membrane. The weak hybridization of the YY212 negative control to the factor LX probe is probably due to minor contamination of the factor LY probe with pBR322 sequences that are present both in the factor IX cDNA clone from which the probe was prepared and the YAC vectors. Methods are as those described for Fig. 2. of the fragments (Fig. 3A). In contrast, the 90-kb YAC that hybridized to the factor LY probe (Fig. 2A) gave grossly discordant results in this test. The origins of this clone and the source of its hybridization to the factor IX probe remain uncertain, but pre- liminary data with other enzymes and probes indicate that its restriction map has little in common with the 60- and 650-kb clones. The three PAI-2 clones were also analvzed with Eco RI, Hind III, and Bam HI. Prob- ings of Eco RI digests of the 215- and 310- kb PAI-2 clones, as well as of human geno- mic DNA, with a PAI-2 cDNA probe are shown in Fig. 3B. Both clones contain all the Eco RI fragments that the probe recog- nizes in human genomic DNA. The results for these two clones with Hind III and Bam HI also indicate that both clones contain complete copies of the PAI-2 gene. The results for the 75-kb PAI-2 YAC showed that, like the 60-kb factor IX clone, it breaks in the middle of the gene. Taken together, these data indicate that two of the factor IX YACs and all three PAI-2 YACs are free of detectable rearrangements in the regions of the exons. Comparable analysis on a coarser scale with restriction enzymes that cleave human DNA infrequently is difficult be- cause most or all of these enzymes are sensitive to the methylation of their recogni- tion sites. All the sites for these enz~,mes are expected to be cleavable in veast, which has no known cytosine methylation, whereas only a subset of the sites are cleavable in mammalian genomic DNA. To test another aspect of YAC fidelity, we evaluated the stability of the clones during prolonged propagation in yeast. Sets of sub- clones of the 60- and 650-kb factor IX clones were grown independently for 60 generations. The experiment started with ten single-colony isolates of each clone. These subclones were grown en masse for 35 generations, taken through a second single-cell isolation step, and then grown for another 25 generations. High molecular weight DNA prepared from the cells pro- duced during the second growth phase was analyzed by pulsed-field gel electrophoresis. As shown for the 650-kb factor IX clone (Fig. 4), none of the subclones changed detectably during this procedure. Identical results were obtained for the 60-kb factor IX clone. The cloning of single-copy genes that can be stably propagated in yeast from a YAC library prepared from total human DNA establishes the basic feasibility of using YACs for the initial partitioning of the human genome. Only further experience will indicate what fraction of the human genome can be cloned in this way. Howev- er, a preliminary comparison of the coverage of the nematode genome obtained with cosmids and YACs suggests that many sys- tematic absences in the cosmid library in- volved sequences that could be cloned in YACs (6). We detected the PAI-2 and factor LX clones in a library of 13,000 to 14,000 clones with inserts averaging 225 kb in size, prepared from male DNA. The expected representation of an autosomal gene in this library is 1.0, whereas that for an X-linked gene is 0.5. The probability of finding a particular autosomal gene triply represented (as was observed for PAI-2) is calculated from the Poisson distribution to be 0.06; the probability of finding a specific X-linked gene doubly represented (as was observed for factor IX) is calculated to be 0.08. Because we chose the PAI-2 and factor LX clones for initial characterization after screening the library with a total of 11 probes to single-copy genes, the detection of two multiply represented genes is not unex- pected. Most other probes appeared to give one or zero positives, but the data are too 1350 0~"7 0 5 2 01 ~ SCIENCE, VOL. 244 2
Page 111: brs52e00
Fig. 1. Map of the western United States showing de- tail of all the stations. j Loma Prieta - - - „ network Allison. 20 km Loma Prieta Hebgen Lake network Roof AI / ~\B g \ 'Horse ky Lionh 'Airport j : X~Ptang 20 km AZ t 5 km Parkfield network 10JDG A_ 33JDG Joaquin; ~: Oquin c+ ti Oc+o Vandenberg Palos Verdes (Table 2). For a long series, a nonlinear component of tectonic deformation may be interpreted as part of the noise, resulting in a root mean square (rms) that is an overesti- mate of the errors. With a short series, the entire spectrum of errors may not be sam- pled, resulting in a rms that may be an underestimate. We chose a conservative ap- proach and used the longest possible time span in calculating the rms; in most cases the data spanned more than a year. The values in Table 2 are our best estimate of the current repeatibility of GPS. We have analyzed data for several experi- ments besides Parkfield (Table 2 and Fig. 1), including measurements of the CIG- NET-NCNM 1 line, a 242-m vector from the GPS fiducial station at Mojave, Califor- nia, to a reference mark nearby, two vectors at Loma Prieta, a vector from Palos Verdes to Vandenberg, and several vectors at Heb- gen Lake, Montana. The two Loma Prieta vectors have the shortest observation span with just 10 months from the first observa- tion to the last. The data from these experi- ments suggest that the errors do not grow monotonically with increasing line length. Both the north and east components of the Palos Verdes to Vandenberg vector have smaller errors than the corresponding com- ponents of the much shorter Loma Prieta lines. This effect may be attributed to differ- ences in the observing strategy used in each experiment: receivers at Palos Verdes and Vandenberg tracked satellites 8 hours per day for 3 to 4 days during each experiment, whereas at Loma Prieta each observation consisted of 5 hours of tracking on a single day. , ~ ............... ...........:.\I ` .. . n ...........-- Mojave line : ~ CIGNET ~ 100 m Table 1. Velocities and standard deviations of Parkfield stations relative to 10JDG in a fault- oriented coordinate system derived from data in Fig. 2. Station Parallel* Normalt (mnvyear) (mm/year) 33JDG 11.9 ± 0.9 -1.1 ± 1.0 Joaquin 9.0 ± 1.0 1.9 ± 1.1 Oquin -2.4t 1.1 0.1--* 1.0 *The positive direction is azimuth 140°, approximately parallel to the San Andreas fault. iThe positive direc- non is 230°, approximately normal to the San Andreas fault. The Parkfield, Loma Prieta, and Palos Verdes to Vandenberg vectors have been measured by techniques other than GPS. The length of the Loma Prieta vectors have been measured nearly 100 times since 1981 with a Geodolite, an electromagnetic dis- tance-measuring system (13). The difference between the mean of the GPS observations and the Geodolite observations for the same time period is 9.7 ± 4 mm (0.22 ± 0.09 ppm) for the Allison line and 0.4 ± 4 mm (0.01 ± 0.13 ppm) for the Eagle line (Fig. 3). The Geodolite and GPS length measure- ments both depend on ehe value used for the velocity of light in a vacuum. The velocity used in processing the Geodolite observa- tions was adopted in 1970 and differs by 0.14 ppm from the current value used in GPS processing. In comparing GPS and Geodolite, we corrected the Geodolite ob- servations to make them consistent with the more modem velocity. A second complica- tion with the Geodolite-GPS comparison is that, because of differing visibility require- ments, different stations were used by the 0 100 80 £ 60 fl 40 W 20 0 250 200 100 50 0 $m Q. a ttl` iWuL Y'lllil-N 1986 1987 1988 1989 Fig. 2. Plots of the (A) north, (B) east, and (C) vertical (up) components of the Parkfield vectors as a function of time. Solid circles represent data for station 33JDG, open circles data for Joaquin, and open triangles data for Oquin. Error bars for all GPS data come from the misfit to a linear trend (Table 2). The large open squares on the plot of the vertical component (C) are derived from leveling data (14). two systems. We have corrected for the offset, but it introduces an additional uncer- tainty in the comparison. A comparison that is not subject to eccen- tric-station complications is afforded by eight lines near Hebgen Lake, Montana. These lines were measured with both Geo- dolite and GPS in August and September 1987. The mean difference between Geodo- lite and GPS for all ten comparisons, eight from Hebgen and two from Loma Prieta, is 1.1 - 2.6 mm (Fig. 4). Consequently, the 1338 SCIENCE, vGL. 2¢4 20"'7052002
Page 112: brs52e00
antibiotic producers. Two recent technological advances for some medically important species, transfottnation (6'7) and eleetrophoret- ic separation of chromosomes (68), will make it easier to manipulate their genetic systems. Advances in our understanding of the mecha- nisms of pathogenesis and virulence are expected. The close relation- ship of thoroughly investigated species, such as A. nidulans, and commercial antibiotic producers, such as Penicillium chrysogenum and Cephalosporium acremonium, will facilitate genetic engineering ap- proaches for quantitative and qualitative modification of antibiotic production (69). Industry. Genetic engineering of industrially important fungi may be used to enhance product production-for example, by improving secretion efficiency or by relieving specific rate-limiting steps in selected metabolic pathways. It may be possible to produce new materials by introducing genes encoding enzymes that catalyze novel biochemical reactions into existing production strains. Genetically modified strains that have enzymatic activities derived from several species might be developed to detoxify refractory compounds in industrial effluents and waste dumps. Similarly, large quantities of specific enzymes for use in processes as diverse as food preparation and paper manufacture might be synthesized by genetically engi- neered fungi. Regulatory concerns should be minimized because these strains are generally regarded as safe (GRAS) producers of materials consumed by humans. Agriculture. Fungi, the most important class of plant pathogens, also affect plant productivity in positive ways. For example, symbiot- ic mycorrhizae increase the ability of plant roots to obtain limiting nutrients. Genetic engineering provides a new opportunity to study mechanisms regulating symbiosis and pathogenesis by allowing the isolation and controlled expression of symbiosis- and pathogenicity- related genes. It may even be possible to study the regulation and activities of agriculturally important genes in laboratory models (70). As the mechanisms controlling the biological activities of filamentous fungi become better understood, development of novel approaches toward the control of these activities is expected. REFERENCES AND NOTES 1. C. J. Alexopoulos and C. W. Mims, lntroduaory Mycology (Wiley, New York, 1979), chap. 1; H. J. Brodie, Fungi-Delight and Curiosity (Univ. of Toronto, Toronto, 1978); I. K. Ross, Biology of the F utgi (McGraw-Hill, New York, 1979), chap. 18; J. W. Foster, Chemical Activities of Fungi (Academic Press, New York, 1949). 2. A. Hinnen, J. B. Hicks, G. R. Fink, Proc. Natl. Acad. Sa. U.S.A. 75, 1929 (1978); J. D. Beggs, Nature 275, 104 (1978). 3. J. F. Peberdy, Annu. Rev. Microbiol. 33, 21 (1979). 4. W. E. Timberlake and K. Y. Miller, unpublished results. 5. M. Fromm, L. P. Tavlor, V. Walbot, Nature 319, 791 (1986). 6. H. Ito, Y. Fukuda, K. Murata. A. Kimura, J. Baneriol. 153, 163 (1983); S. S. Dhawale, J. V. Paietta, G. A. Marzlul; Curr. Genet, 8, 77 (1984). 7. T. M. Klein et al., Nature 327, 70 (1987); T. D. Fox, J. C. Sanford, T. W. McMullen, Proc. Natl. Acad. Sci. U.S.A. 85, 7288 (1988); S. A. Johnston et al., Science 240, 1538 (1988). 8. M. C. Costanzo and T. D. Fox, Proc. Nail. Acad. Sci. U.S.A. 85, 2677 (1988). 9. N. C. Mishra and E. L. Tatum, ibid. 70, 3873 (1973). 10. M. E. Case, M. Schweizer, S. R. Kushner, N. H. Giles, ibid. 76, 5259 (1979). 11. D. Vapnek, J. A. Hautala, J. W. Jacobson, N. H. Giles, S. R Kushner, ibid. 74, 3508 (1977). 12. For a more extensive review of selectable markers for fungal transformation, see J. Rambosek and J. Leach [CRC Crit. Rev. Biotechnol. 6, 357 (1987)]. 13. D. J. Ballance, F. P. Buxton, G. Turner, Biochem. Biophys. Res. Commun. 112, 284 (1983). 14. M. G. Schechm:= and C. Yanofsky, J. :Yfol. Appl. Genet. 2, 83 (1983). 15. J. H. Kinnaird, M. A. Keighren, J. A. Kinsey, M. Eathon, J. R. S. Fincham, Gene 20, 387 (1982). 16. M. J. Orbach, E. B. Porro, C. Yanofsky, Mol. Cell. Biol. 6, 2452 (1986). 17. J. Tilbum et al., Gene 26, 205 (1983). 18. M. J. Hynes, C. M. Corrick, J. A. King, .'Lfol. Cell. Biol. 3, 1430 (1983). 19. M. M. Yelton, J. E. Hamer, W. E. Timberlake, Proc. Natl. Acad. Sa. U.S.A. 81, 1470 (1984). 20. B. Berse et al., Gene 25, 109 (1983); M. A. John and J. R. Peberdy, Enzyme Microb. Technol. 6, 386 (1984). 21. H. N. Arst, Jr,, and G, Seazzoechio, in Gene .Ylani'pulations in Fungi, J. W. Bennett and L. L. Lasure, Eds. (Academic Press, New York, 1985), pp. 309-343. 22. B. R. Oaklev et al., Gene 61, 385 (1987). 23. I. L. Johnstone, personal communication. 24. P. A'. Dunne and B. R Oakley, .llol. Gen, Genet. 213, 339 (1988). 25. For example, J. H. Bull, D. J. Smith, G. Turner, Curr. Genet. 13, 377 (1988); K. A. Parsons, F. G. Chumley, B. Valent, Proc. Natl. Acad. Sci. U.S,A. 84, 4161 (1987); R. K. Ben and G. Turner, Curr. Genet. 11, 639 (1987); J. M. Kelly and M. J. Hynes, E:Y1BO J. 4, 475 (1985); Y. T. Hahm and C. A. Baatt, Appi. Environ. Microbiol. 54, 1610 (1988). 26. O. C. Yoder, K. Weltring, B. G. Turgeon, H. D. VanEtten, in Biology and Molecular Biology of Plant-Pathogen Interactions, J. A. Bailey, Ed. (Springer-Verlag, Berlin, 1986), pp. 371-384; B. Tyler, personal communication. 27. L. L. Stohl and A. M. Lambowitz, Proc. Natl. Acad. Sa. U.S.A. 80, 1058 (1983). 28. F. P. Buxton and A. Radford, Mol. Gen. Genet. 196, 339 (1984). 29. L. Clarke and J. Carbon, Nature 287, 504 (1980). 30. M. T. Bovlan, M. J. Holland, W. E. Timberlake, :11ol. Cell. Biol. 6, 3621 (1986). 31. B. L.Miller, K. Y. Miller. W. E. Timberlake, ibid. 5, 1714 (1985). 32. J. A. Kinsc,v and J. A. Rambosek, ibid. 4, 117 (1984). 33. M. M. Yelton, W. E. Timberlake, C. A. M. J. J. van den Hondel, Proc. Nat/. Acad. Sci. U.S.A. 82, 834 (1985). 34. E. U. Selker, E. B. Cambareri, B. C. Jensen, K. R. Haack, Cell 51, 741 (1987); E. U. Selker and P. W. Garrctt, Proc. Natl. Acad. Sa. U.S.A. 85, 6870 (1988). 35. E. U. Selker, personal communication. 36. W. E. Timberlake, Ed., Molecular Genetics of Filamentous Fungi (Liss, New York, 1985); see G. A. Marzluf, K. G. Pernne, B. H. Nahm, ibid., pp. 83-94; N. H. Giles et al.. ibid., pp. 95-116; J. R. S. Fineham, J. H. Kinnaird, P. A. Bums, ibid., pp. 117-126: J. S. Lovett, pp. 187-192; B. R. Oakley, ibid., pp. 225-238. 37. I. L. Johnstone, S. G. Hughes, A. J. Clutterbuck, EMBO J. 4, 1307 (1985). 38. W. E. Timberlake et al., Exp. :14ycol. 9, 351 (1985). 39. M. J. Orbach, W. P. Schneider, C. Yanofsky, Mol. Cell, Biol. 8, 2211 (1988). 40. S. J. Vollmer and C. Yanofskv, Proc. Natl. Acad. Sa. U.S. A. 83, 4869 (1986); B. L. Mann, R. A. Akins, A. M. Lambowiu, R. L. Metzenberg, .Llol. Cell. Biol. 8, 1376 (1988). 41. M. T. Bovlan, P. M. Mirabito, C. E. Willett, C. R. Zimmermann, W. E. Timberlake, .1do1. Cell. Biol. 7, 3113 (1987); G. Turner, D. J. Ballance, M. Ward, R. K. Ben, in Molecular Genetics of Filamentous Fungi, `i'. E. Timberlake, Ed. (Liss, New York, 1985), pp. 15-28. 42. R. L. Metzenberg, J. N. Stevens, E. U. Selker, E. Morzycka-Wroblewska, Proc. Nati. Acad, Sci. U.S.A. 82, 2067 (1985). 43. K. M. Weltring, B. G. Turgeon, O. C. Yoder, H. D. VanEtten, Gene 68, 335 (1988). 44. G. Pontecorvo, J. A. Roper, D. W. Hemmons, K. D. MacDonald, A. W. J. Bufton, Adv, Genn. 5, 141 (,1953). 45. E. B. O'Hara and W. E. Timberlake, Genetics 121, 249 (1989); T. H. Adams and W. E. Timberlake, unpublished results. 46. J. E. Hamer and W. E. Timberlake, :Mol. Cell. Biol. 7, 2352 (1987). 47. M. E. Case, R. Geever, N. H_ Giles, personal communication. 48. S. Scherer and R. W. Davis, Proc. :\tatl. Acad. Sa. U.S.A. 76, 4951 (1979). 49. R. J. Rothstein, Methods Enzymol. 101, 202 (1983). 50. R. Aramayo, T. H. Adams, W. E. Timberlake, Genetics, in press. 51. D. Botstein and R. W. Davis, in The Molecular Biology of the Yeast Saccharomyces: ,i-fetabolism and Gene Expression, J. N. Strathem, E. W. Jones, J. R. Broach, Eds. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983), pp. 607-637. 52. K. Struhl, Nature 305, 391 (1983). 53. A. J. Clutterbuck, in Handbook of Genetics, R. C. King, Ed. (Plenum, New York, 1974), vol. 1, pp. 447-510. 54. S. A. Osmani, D. B. Engle, J. H. Doonon, N. R. Morris, Cell 52, 241 (1988). 55. C.A. M. J. J. van den Hondel, in Molecular Genetics of Fiiamentous Fungi, W. E. Timberlake, Ed. (Liss, New York, 1985), pp. 29-38; R. F. Van Gorcom et al., Gene 40, 99 (1985). 56. T. H. Adams, M. T. Bovlan, W. E. Timberlake, Cell 54, 353 (1988); P. M. Mirabito, T. H. Adams, W. E. Tirnberlake, ibid., in press. 57. D. I. Gwynne et al., Gene 51, 205 (1987). 58. K. Wernars et al., Cun. Genet, 9, 361 (1985). 59. M. J. Hynes, C. M. Corrick, J. M. Kelly, T. G. Littlejohn, Mol. Cell. Biol. 8, 2589 (1988). 60. D. M. Grant, A. M. Lambowitz, J. A. Rambosek, J. A. Kinsey, ibid. 4, 2041 (1984). 61. N. Sugawara and J. W. Szostak, Proc. :Vatl. Acad, Sa. U.S.A. 80, 5675 (1983). 62. B. L. Miller, K. Y. Miller, K. A. Roberti, W. E. Timberlake, Mol. Cell. Biol. 7,427 (1987); R. F. Geever et al., J. Mol. Biol., in press. 63. W. E. Timberlake, in Genetic Regulation of Development, W. F. Loomis, Ed. (Liss, New York, 1987), pp. 63-82. 64. C. A. Raper, in Advances in Plant Pathology, D. S, Ingram and P. H. Williams, Eds. (Academ c Press, New York, 1988), pp. 511-522. 65. N. R. Morris, D. R. Kirsh, B. R. Oakley, Methods Cell. Biol. 25b, 107 (1982). 66. D. H. Gnffin, Fungal Physiology (Wiley, New York, 1981), pp. 199, 201, 290, 212-214, 236, 281, 286, 299, 339, and 344. 67. M. B. Kurtz, M. W. Cortelyou, D. R Kirsch, 3-fol. CeU, Biol. 6, 142 (1986). 68. B. B. Magee, Y. Koltin, J. A. Gomian, P. T. Magee, ibid. 8, 4721 (1988). 69. B. J. Weigel et al., J. Bacteriol. 170, 3817 (1988). 70. R. A. Dean and W. E. Timberlake, Plant Cell 1, 265 and 275 (1989). 71. We thank N. Giles, C. Mims, C. Glover, and our colleagues in the laboratory for critical reviews of the manuscript. Our research with A. nidulans has been supported by grants from the National Institutes of Health, National Science Foundation, and the U.S. Department of Agriculture (CRGO). 16JUxEI989 2047651981 ARTICLES 1317
Page 113: brs52e00
t F Reports Availability of Metabolic Fuels Controls Estrous Cyclicity of Syrian Hamsters JILL E. SCHNEIDER AND GEORGE N. WADE Food deprivation and weight loss inhibit ovulation and estrous behavior in Syrian hamsters. In the present experiments, lean hamsters were more susceptible to starvation-induced anestrus than fat hamsters. However, anestrus was not caused by changes in any dimension of body size per se, but instead by the availability of metabolic fuels. Simultaneous pharmacological blockade of both fatty acid oxidation and glycolysis inhibited reproduction, but, as long as one of these metabolic pathways could be used, estrous cycles continued. Thus, reproduction in female Syrian hamsters is sensitive to the general availability of oxidizable metabolic flzels. A PROPOSED LINK BETWEEN FERTIL- ity and body weight has gained wide ttention, largely because of reports of infertility in professional athletes, danc- ers, patients with eating disorders such as anorexia nervosa, and even recreational jog- gers and dieters who experience only moder- ate weight loss (1). Likewise, in domestic and laboratory animals, estrous cycles are disrupted and puberty is delayed by weight loss caused by food restriction or depriva- tion (2, 3). Although a critical body weight may be one prerequisite for normal repro- duction, a useful model of the mechanisms determining reproductive status must ac- count for factors other than body weight and composition. For example, puberty in rats can occur at significantly different body weights and fat-to-lean ratios, depending on previous food intake and exercise (4). Our results show that although lipid stores can buffer the effects of food deprivation on estrous cycles, reproduction is controlled by the general availability of metabolic fuels, rather than by any dimension of body size. Female Syrian hamsters, Mesocricetus aura- tus, were used because they have a consistent 4-day estrous cycle that is highly sensitive to changes in energy availability (5). Food deprivation on days 1 and 2 of the estrous cycle blocks the next expected estrus, ovula- tion, and the postovulatorv vaginal dis- charge in approximately 80% of females (6). This phasic starvation retards follicular de- velopment, decreases plasma estradiol, and inhibits the luteinizing hormone surge. We used phasic starvation to examine the link between energy balance and fertility. To test the hypothesis that body fat stores Department of Psvcholo~y, and Neuroscience and Be- havior Program, University of Massachusetts, Amherst, MA 01003. can buffer the effects of starvation on estrous cyclicity, we subjected groups of hamsters (7) that differed in body weight, but not in age, to phasic starvation and monitored their estrous cycles. We created heavy, medi- um-sized, and light hamsters by varying the presentation of their diet (8). Hamsters were fed either powdered chow (powder), chow pellets of the same nutrient composition placed inside the cage ("pellets-in"), chow pellets in food hoppers outside the cage ("pellets-out"), or a high-fat diet (9) known to induce obesity in hamsters (high fat). The rank order of both body weight and fat content was high fat > powder > pellets-in > pellets-out (10). After two consecutive 4- day estrous cycles, half of the hamsters in each of the four groups were deprived of food on days 1 and 2 of the estrous cycle; food was available on days 3 and 4; sexual receptivity was determined just before lights-out on day 4; and vaginal discharge and ova in the oviducts were examined the next morning. After phasic starvation, all hamsters in the nvo heaviest groups (powder and high fat) showed lordosis, vaginal discharge, and ovulation (Fig. 1). In the lightest group (pellets-out) none displayed lordosis, and only 10% showed vaginal discharge or tubal ova. The medium-sized group (pellets-in) had an intermediate incidence of lordosis, vaginal discharge, and ovulation. Uterine weight followed the same pattern. All ham- sters that were not phasicallv starved showed lordosis, vaginal discharge, and ovulation. These results show that the effect of pha- sic starvation on estrous ~yclicity depends on the body weight before starvation. We hy- pothesized that the hamsters with higher body weights were protected from the ef- fects of starvation on reproduction by their ability to use fatty acids mobilized from 1326 adipose tissues. To test this possibilitv we used methyl palmoxirate (MP), an inhibitor of fatty acid utilization, which blocks the transport of fatty acids into mitochondria (11). After two 4-day estrous cycles, fat ham- sters fed powdered chow for at least 5 weeks received one of the following treatments on days 1 and 2 of the estrous cycle: (i) MP (20 mg/kg) suspended in 0.5% methvlcellulose twice a day by gavage, (ii) MP plus food deprivation, or (iii) the methylcellulose ve- hicle plus food deprivation. The groups did not differ significantly in body weight at the start of treatment. All hamsters were exam- ined for estrous behavior and the vaginal discharge. In these fat hamsters, food deprivation alone did not interrupt estrous cycles (Fig. 2), as shown in the first experiment (Fig. 1). Treatment with MP alone also did not affect estrous cycles in hamsters fed ad libitum. However, food deprivation interrupted the estrous cycles in 60% of hamsters treated concurrently with MP. The fact that MP treatment did not inter- rupt estrous cycles in hamsters fed the high- carbohydrate chow ad libitum raises the possibility that glucose or other fuels from the diet might have permitted normal repro- ductive function. To test this possibility, we examined the effects of MP and an inhibitor of glucose utilization, both alone and to- gether, on hamster reproduction. We used 2-deo.xy-D-glucose (2DG), a glucose analog 100 100 80 ao ~ a . 60 ~ 60 0 ~ 'II 40 ~ 40 J 0 20 i 20 0 0 100 i ~ / 0.6 C u 80 I ®n m o,a m0.3 c 60L ' 'a 40 02 ~ ~ 2o = 0.1 0.0 ,.~ 1-1 II Fig. 1. Effect of faod deprivation on the percent- age of female hamsters that showed lordosis, postovulatory discharge, and ovulation, and on uterine weight. The hamsters had been fed one of four diets for at least 5 weeks: pellets-out (open bar) (n = 9), pellets-in (diagonal tines) (n = 10), powder (crosshatched bar) (n = 7), and high fat (solid bar) (n = 7). There were significant differ- ences in the frequency of hamsters that showed lordosis [G(3) = 31.326, P < 0.005], the post- ovulatory discharge [G(3) = 18.904, P< 0.005], and tubal ova [G(3) = 22.803, P < 0.005], and in uterine weight [F(3,29) = 11.829, P < 0.001]. 2047v51990 SCIENCE, VOL. 2¢4
Page 114: brs52e00
PRECISE, RELIABLE AND REPRODUCIBLE INJECTIONS - CELL AFTER CELL. AIS MICROSCOPE SYSTEMS. FROM CARL ZEISS. The AIS Microscope Systems from Carl Zeiss make microinjection into living cells easier and more reliable than ever before due to computer control of the injection procedure. The microscope system is operated via a functional software menu; all parameters are entered by means qf the graphic overlay on the TV monitor. The tr{jection program enables fast, precise axial injections with a high injec- tion rate of up to 2000 cells an hour - with maximum protection of the cell. There is no dfficulty in continuing inter- rupted injection tests orp'erforming mul- tiple injections into a single cell. This guarantees standardized and stabilized conditions for ir4jection experiments. Even complex functional analyses are possible in the shortest time possible - with maximum reproducibility and therefore reliable statistical results at all times. Carl Zeiss, Inc. MPM Microscope Photometry LSM Laser Scan Microscopes AIS Automated Injection Systems One Zeiss Drive Thornwood, NY 10594 914•747•1800 Circle No. 165 on Readers' Service Card The new Carl Zeiss Microscope Systems extend the performance and capabilities of the modern light microscope to meet the ever growing demands of science and industry. State-of-the-art light microscopes with unexcelled ICS optics are com- bined with the latest technologies for specimen handling, information retrieval and processing. The results, in terms of resolution, content and reproducibility, far exceed anything previously attainable with con- ventional instrumentation. Now the most sophisticated techniques in micros- copy can become a routine part of your research. The AIS Microscope Systems from Carl Zeiss are the perfect answer to microinjection requirements in cytologi- cal, physiological, molecular-biological and genetic research in biology, medi- cine and pharmacology. For the full story, contact your Zeiss dealer. For the name of the nearest dealer, call the Microscopy Department at (914) 681-7755. ® West Germany CARL ZEISS MICROSCOPE SYSTEMS
Page 115: brs52e00
l'able 1. G3 Galaccosidase activity of he PGK-tacZ fusion gene with an intron cassette. See (15-17, 21) for details of the construction of the PGK- lacZ gene with and without the modified introns. Cells containing CEN plasmids were grown in minimal medium SD (23) supplemented with histidine and leucine for at least 20 generations at the indicated temperature. Assay for the R-galac- tosidase was performed as described (24). Each value represents the average of four experiments and the error was less than 30%. AI, artificial intron; AI-1 and AI-2, AI with inverted repeats; AI-3 and AI-4, cold-sensitive introns. Con- (3-Galactosidase activity (units/mg protein) struct 36'C 23°C 16°C None 750 860 1190 AI 8,'0 920 1150 AI-1 7 6 8 AI-2 8 5 6 AI-3 120 21 11 AI-4 200 54 23 further implies that the artificial intron can be inserted anywhere in a target gene with- out disrupting its function, To determine the efficiency and the accu- racy of splicing, we inserted this intron into the PGK-lacZ fusion gene (15). The P- galactosidase activity produced by the in- tron-containing gene (PGK-1acZ-AI) was about the same as that produced by the intronless PGK-lacZ gene (Table 1). The level of mRNA produced by the PGK-lacZ- .41 gene was also about the same, and a majority of the lacZ transcript was of the mature form (Fig. 2A), indicating that splic- ing of the artificial intron was efficient and accurate. Base pairing between consensus se- quences of an intron and snRNAs is impor- tant for the splicing reaction (5). According- ly, we thought that introduction of a frag- ment complementary to one of the consen- sus sequences would be likely to interfere with this base pairing and thus prevent splicing. If so, by varying the length of the complementary fragments, we might be able to obtain a fragment that interferes with splicing at a low temperature but not at a high temperature. Splicing of the intron containing such a fragment would then be- come cold-sensitive. To see the effect of an inserted fragment that can base pair with one of the consensus sequences, we have added a fragment that contained either the 5' donor consensus sequence (GUAUGU) or the branch point sequence (UACUAAC) into the artificial intron in the inverted orientation. These two constructs contain 33-bp (AI-1) and 38- bp (AI-2) inverted repeats, respectively (16, 17). Yeast were transformed with plasmids containing the PGK-lacZ fusion gene plus one of these modified introns, and the level of P-galactosidase activity was measured. The level of P-galactosidase activity was about 1/100 of that of the parent (Table 1). Mature mRNA was not detected by primer extension (14). These results indicate that splicing is inhibited by an inverted repeat structure at the 5' consensus region or the UACUAAC region. The inverted repeat structure itself was not responsible for this inhibition, since unrelated inverted repeats in the intron did not prevent splicing (14). To obtain cold-sensitive introns, we made Fig. 2. The cold-sensitive A M None AI AI-3 AI-4 B introns. (A) Analysis of 36 PGK-lacZ mRNA by primer extension. Cells were grown as described in Table 1. Total RNA was extracted and primer extension was performed as described (25). M13 se- quencing primer [a 15-nu- cleotide oLigomer (New England Biolabs)] was used as a primer. Precur- sor RNAs are indicated by p. Mature mRNA is indi- cated by m. pBR322 DNA cut with HFa II and labeled with [a-3 P]dCTP and IQenow enzyme was used as a size marker (lane M). (B) Possible structure of the cold-sensitive in- trons. (C) Phenotype of the yeast strains NY6A (MATa, ura3-52, leu2-3, t91 - tit - 77 - / \ / 36nt \ ~ \ G.C U.A A.u u•A A.U A.U 3 A ' A U A G C U A :A u A C i- -m leu2-112, his4-519) con- L i-a 5 taining the URA3 gene with the AI-3 or A1-4 intron on 2µ plasmid (13). Cells were grown overnight at 23°C in minimal medium SD (23) supplemented with uracil and histidine, each spot). Plates were then incubated either at 36° or 23°C for 3 da,vs. 1fi 3E; 16 36 16 36~ tb~ C None AI AI-3 AI-4 36°C 23°C GuAUGU Bal 31 deletions of the Al-I and AI-2 in- trons, starting either from the center of the inverted repeat (for AI-1) (18) or from the outside of the inverted repeat (for AI-2) (19). Introns with various sizes of inverted repeats were isolated and then inserted into the PGK-lacZ fusion gene. We looked for cold-sensitive introns by growing each yeast transformant on X-gal plates at either 36°C or 16°C (20). If the introns were spliced out, the cells would produce active G3-galacto- sidase and form blue colonies; otherwise, white colonies would be observed. We found two deleted introns that led to the formation of blue colonies at 36°C and white colonies at 16°C, one from AI-1, the other from AI-2. We call these cold-sensitive introns AI-3 (13-bp inverted repeat) and Al- 4 (17-bp inverted repeat), respectively (21). The P-galactosidase activities produced by these genes (Table 1) were clearly heat inducible, although even at the highest tem- perature the activities were 15 to 20% of those produced by the intronless gene. Anal- ysis of the mRNAs by primer extension showed that these genes produce the mature size of mRNA at 36°C but not at 16°C (Fig. 2A). The possible RNA secondary struc- tures of these introns are shown in Fig. 2B. In both cases the consensus sequence, GUAUGU or UACUAAC, is in a short hairpin structure. These short hairpin struc- tures may be formed at 16°C (preventing splicing of the intron), but melt at 36°C (allowing the intron to be spliced out) in vivo. We have not ruled out the possibility that other cellular factors are involved. We wanted to show that insertion of the 33 n t r- vACFv~~ J 19 n t}- (43nt } GC A U G•C C.G U•A U•A A•U A•u A.U A. A.U U A G A.U .A J U•A -G C 19nt ® 3' ~---{,~ 3 ' then spotted on SD plates supplemented with histidine (about 5000 cells in I 16 JUNE 1989 , REPORTS 1347 1
Page 116: brs52e00
) i imitv to the blood stream endothelial cells are an obvious candidate for delivering ther- apeutic proteins systemically. Genetically engineered vascular grafts could also be used to target the delivery of a therapeutic pro- tein to a specific organ or limb that is perfused by blood passing through the grafted artery. Specific applications might include the secretion of vasodilators or an- giogenic factors to ischemic mvocardium or the delivery of an antineoplastic agent to an organ riddled with metastatic tumor. REFERENCES AND NOTES 1. U.S. Department of Health and Human Services, Publ. (PHS) 85-1232 (1985). 2. J. C. Statilev et al., in Vascular Surgery, W. S. Moore, Ed. (Grune & Stratton, Orlando, FL, 1986), pp. 365-388. 3. T. J. Hunter, S. P. Schmidt, W. V. Sharp, Trans. Am. Soc. Artif. Intern. Organs 29, 1777 (1983). 4. J. Price, P. Turner, C. Cepko, Proc. Natl. Acad. Sn. U.S.A. 84, 156 (1987). 5. The BAG vector, which expresses (3-galactosidase from a transcript initiated at the 5' long terminal repeat (LTR), has been described (4). The BAL vector is derived from the previously described BA- LDLR vector [J. M. Wilson, D. E. Johnston, D. M. Jefferson, R. C. Mulligan, Proc. Natl. Acad. Sa. U.S.A. 85, 4421 (1988)], except that low density lipoprotein receptor (LDLR) cDNA sequences were replaced with coding sequences for the lacZ gene. Expression of lacZ from this vector is driven from a transcript that it initiated at (3-actin promoter sequences located internal to the viral transcript. Each vector was rransfected into the amphotropic packaging cell line qs CRIP [0. Danos and R. C. Mulligan, Proc. Natl. Acad. Sci. U.S.A. 85, 6460 (1988)], and individual transfectants were analyzed for product on of recombinant virus. V ral titer was measured by exposing subconfluent plates of NIH 3T3 cells to limiting dilutions of viral stocks and subsequently analyzing the confluent fibroblasts for clones of (3-galactosidase-expressing cells (4). Titers of the best virus-producing cell lines were 0.5 X 105 to 1 x 105 colony-forming units (CFU) per millili- ter for BAG-derived virus and 2 x 10' to 5 x 105 CFU per milliliter for BAL-derived virus. Virus- producer cell lines and infected populations of endo- theliai cells were free of helper virus. 6. L. R. Sauvage et al., Arch. Surg. 109, 698 (1974). 7. S. G. Yates et al., Ann. Surg. 188, 611 (1978). 8. We thank M. Grossman and J. Hoysradt for techni- cal assistance, and K. Gould and R. Connolly for helpfiil advice. Supported by the NIH, Whittaker Foundation, and Howard Hughes Medical Insti- tute. 19 January 1989; accepted 28 April 1989 Control of Gene Expression by Artificial Introns in Saccharomyces cerevisiae TADANORI YOSHIMATSU AND FUMIKIYO NAGAWA* Artificial yeast introns that show cold-sensitive splicing have been constructed. These conditional introns can be inserted into a target gene as an`°intron cassette" without disrupting the coding information, allowing expression of the gene to be cold sensitive. Insertion of these intron cassettes rendered the yeast URA3 gene cold sensitive in its expression. The advantage of this intron-mediated control system is that any gene can be converted to a controllable gene by simple insertion of an intron. 0 NLY A SMALL NUMBER OF GENES in Saccharornyces cerevisiae contain introns, which are usually found individually near the 5' end of their genes (1). The role of such rare introns is not clear. The removal of an intron from the yeast actin gene did not affect its expression (2). Nevertheless, they do appear to have a regu- latorv function in some cases. For example, splicing of an intron in the yeast ribosomal gene RPL32 is autogenously controlled by its product (3). Each yeast intron contains three con- served sequences, GUAPyGU (Py, pyrimi- dine) at the 5' donor end, UACUAAC at the branch point, and PyAG at the 3' accep- tor end (4). Base pairing between small nuclear R.NAs (snR.NNAs) and GUAPvGU Molecular Biology Section, Institute for Biotechnology Research, Wakunaga Pharmaceutical Co., Ltd., 1624 Shimokotachi, Koda-cho, Takata-gun, Hiroshima, 729- 64. Japan. *To whom correspondence should be addressed. and UACUAAC sequences is thought to be important for efficient splicing (5). These consensus sequences are similar to those found in higher eukaryotes. However, the sequence requirement is more stringent in yeast than in higher eukaryotes (6). In addi- tion, there are no conserved sequences in the flanking exons of yeast. Sna BI Hind III i' AAGCTTA ~T, TTCGAATQCA Heterologous introns have been success- fiilly inserted into target genes in order to study mRNA splicing (2, 3, 5, 7, 8). The same strategy was also used to studv Ty transposition (9) and activation at upstream sites (10). However, in these investigations, an intron was inserted along with its flank- ing exon sequences. These flanking se- quences can cause inactivation of the target gene. Therefore, we have inserted an artifi- cial intron totally devoid of flanking exon sequences and have used it to control the heterologous gene expression. The intron consisted of 30 bp of the 5' end of the yeast RP51 A intron (7), 30 bp of the 3' end of the yeast S 10 intron (11), and 44 bp of polylinker sequence of an M13 cloning vector (Fig. 1). This intron contains all the necessary sequences for splicing in yeast. In addition, we have placed Sna BI and Pvu II restriction sites at the ends. Since the Sna BI and Ptiv II recognition sequences overlap with the three terminal bases at each intron end, the artificial intron can be cleaved out precisely as a "cassette" without any additional exon sequences. This intron fragment can be inserted into any gene without disrupting its coding information by cutting the gene with a blunt end- producing restriction enzyme and then in- serting the intron fragment. Alternativelv, if the restriction enzyme leaves a protruding 5' terminus, the fragment can be treated at one end with single strand-specific nuclease and at the other end by the Klenow frag- ment of DNA polymerase I. To show that the artificial intron can be inserted into a gene without disrupting its function, we inserted it into the URA3 coding region at Eco RV, Sca I, or Stu I sites (12), which are located 186, 310, and 434 bp downstream of the start codon, respectively. These intron-containing URA3 genes were located on a"2µ plasmid" con- struct (13). This construct was able to com- plement a ura3-52 mutation on the yeast chromosome (14), which suggests that the artificial intron is spliced out precisely and Pst I Sal I Xba I Bam HI AATATGGACTAAAGGAGGCTTTTCTGCAGGTCGACTCTAGAGGAT TTATACCTGATTTCCTCCGAAAAGACGTCCAGCTGAGATCTCCTA I RP51A I Smal Kpnl Sacl CCCCGGGTACCGAGCTCGAATTT GGGGCCCATGGCTCGAGCTTAAA l TITACTAAC TGATTG TGGTATTATTTATAA TTACCATAATAAATATT S10 Pvu II i Eco RI G TGAATTC T CTTAAG I Fig. 1. Structure of the artificial intron. The 5' end fragment and the 3' end fragment were chemically synthesized, and the polvlinker fragment (from Pst I to Sac I) was obtained from plasmid pUC18. The consensus sequences are shown in boxes. This intron was cloned in the Hind III-Eco RI site of pL'C18 to generate pU C-AI. The 5' end fragment of the yeast RP51A intron and the 3' end fragment of the S 10 intron are indicated. IB¢6 2047U~2010 SCIENCE, VOL. 244
Page 117: brs52e00
A C a nylon filter placed in contact with agar growth medium. (B) An autora- ° ; : ,~:~ , --- M diogram of a filter on A27D8 A24E4 which DNA released from lvsed colonies had been hvbridized to a miature of 32P-labeled probes, including a probe specific for the PAI-2 gene. The arrow points to PAI-2 clone A27D8, and the four strong signals in the lower right comer arise from positive control clones. (C) An autoradiogram of a filter on which sets of six single-colony subisolates of two PAI-2 positives (A27D8 and A24E4), as well as two unrelated dones (bottom two rows), had been hybridized to the P 4I-2 probe. The failure of one of the A24E4 subisolates to hybridize is not unusual since the original microtiter plate stocks from which these subisolates were obtained had not been colony purified. Methods are described in (10). with which chromosomal DNA can be ma- nipulated by homology-directed recombina- tion in yeast (3) offers the possibility of making specific changes in large DNA mole- cules cloned as YACs. These and other applications g Fig. 1. Identification of of YAC cloning will require the ability to recover specific cloned sequences from diverse li- braries of YAC clones. We describe here the cloning of single-copy genes from a YAC library prepared from total human DNA. Two independent clones are described for the factor LX gene (4) (mutations in which cause hemophilia B), and three independent clones are described for the gene encoding plasminogen activator inhibitor type 2 (PAI-2) (5). Evidence is presented that these clones, which range in size up to 650 kb, are authentic replicas of human genomic DNA. It is also shown that they can be propagated extensively in yeast without detectable changes. Together with recent reports of YAC cloning of DNA from the nematode Caenorhabditis elegans (6) and from a rodent- human hybrid cell line (7), these results demonstrate the basic practicality of using YACs to subdivide complex genomes. The human genomic library was prepared by ligating human DNA that had been partially digested with Eco RI to vector arms prepared from pYAC4 (1, 8). This procedure produces acrocentric chromo- somes that terminate in short telomere- proximal vector sequences. All but 9 kb of the length of an artificial chromosome is insert DNA. The clones described here were identified in an expanding library that con- tained 13,000 clones at the time of the PAI- 2 screen and 14,000 at the time of the factor IX screen. The average insert size in the library was approximately 225 kb. The clones had been picked individually from transformation plates, grown in small liquid cultures, and stored in the wells of 96-well microtiter plates. YAC clones containing the P.AI-2 gene by yeast colony screening. (A) A grid of yeast colonies grown on the surface of The clones were screened with sZP-labeled DNA-DNA hybridization probes by colo- ny-screening procedures adapted for yeast. Colonies were grown on nylon filters placed on the surface of an agar growth medium. The filters were inoculated by means of a 96-prong replicating device, which allowed all the clones from one microtiter plate to be stamped onto a filter in a single step. Four offset stampings were carried out to produce microtiter plate-sized filters, each contain- ing 384 clones (Fig. lA). After cell lysis and binding of the released DNA to the filter, hybridization was carried out with pools of up to five 32P-labeled probes. An autoradio- gram of a filter containing a clone that was positive for the PAI-2 probe is shown in Fig. 1B. Each potentially positive clone was colony purified on a medium that selects for maintenance of the YAC, and six subisolates were retested with all the probes used in the primary screening. Two clones in which most or all of the colonies picked for second- ary screening were positive with the PAI-2 probe are shown in Fig. 1C. Similar signals were obtained for a third PAI-2 clone and three factor IX clones. The intact artificial chromosomes in clones that continued to give strong signals through the secondary colony screening were analyzed by pulsed-field gel electro- phoresis. When high molecular weight DNA from these strains is separated on pulsed-field gels, the artificial chromosomes can usually be visualized against the back- ground of natural yeast chromosomes by ethidium bromide staining. After the stained gels were photographed, the DNA was transferred to nylon, and DNA-DNA hy- bridization was carried out with the appro- priate gene-specific probe. Data are shown in Fig. 2 for the three factor LY and the three PAI-2 clones that were positive through the primary and secondary screening. The next level of analysis involved com- A 1 2 3 4 5 1 2 3 4 a -650 a. -90 40-60 N N W 0] N Nc~ W m U Q m U ~ U¢ m U "M _- WID - a 140MO ae s 190 w g4 .... ~ a Mall ~ .s ,,., ~ r ....r ~ 00 CO W m U ® 0 ¢ -It LIJ N Q 1 2 3 4 d* -310 drrt -215 -75 Q ~ ~ o ~ w v r- m CO < ¢ Fig. 2. Analysis of factor IX and PAI-2 YAC clones bv pulsed-field gel electrophoresis. (A) A pulsed-field gel showing the separation of natural and artificial chromosomes present in three clones that showed strong hybridization to the factor IX probe (lanes 2 to 4) and an unrelated YAC clone (lane 1). In the left panel, the DNA molecules are visualized by fluorescent staining with ethidium bromide; in the right panel, an autoradiogram is shown of the results obtained when the DNA was transferred to a nitrocellulose membrane and hv- bridized to the factor IX probe. LL, lambda ladder. (B) Analysis of the three clones that showed strong hybridization to the PAI-2 probe (lanes 2 to 4) and an unrelated YAC clone (lane 1) on a pulsed-field gel. Sizes are in kilobases. Meth- ods are described in (11). paring the sequence organization of YAC DNA with that of human genomic DNA by means of restriction enzvmes with 4- or 6- bp recognition sites. Gene-specific probes derived from factor IX and PAI-2 cDNA clones were used to analyze the regions of the YACs containing the exons for these genes. In a tvpical analysis (Fig. 3A), the factor IX probe was used to detect hybridiz- ing Eco RI restriction fragments in digests of human genomic DNA and yeast DNA from the 60- and 650-kb factor IX YAC clones. In addition to the pure human and yeast samples, mixtures containing human DNA and a molar excess of yeast DNA were also analyzed to demonstrate that small dif- ferences in the mobilities of corresponding fragments in the human and yeast lanes were due to differences in the amounts of DNA loaded (9). All four of the fragments detect- ed in human genomic DNA were also found 16 JUNE 1989 REPORTS 1349 204'""452013
Page 118: brs52e00
1989 NEWSPAPERS MAGAZINES RADIO TELEVISION The 1989 contest year is October 1, 1988 through June 30, 1989. All entries must be postmarked before mrdnight, July 15, 1989. For 38 years the AAAS-Westinghouse Science Journal- ism Awards have recognized outstanding reporting on the sciences and their engineering and technological applications, excluding health and clinical medicine. Awards honor science reporting in newspapers and general circulation magazines and on radio and televi- sion. Entries are judged on the basis of their initiative, origi- nality, scientific accuracy, clarity of interpretation, and value in promoting a better understanding of science by the public. Five awards of $1,000 each are made in the categories of: newspapers with daily circulation of over 100,000, news- papers with circulation of under 100,000, general circulation magazines, radio, and television. The 1989 Awards will be presented at the National Association of Science Writers' banquet during the An- nual Meeting of the American Association for the Advancement of Science in New Orleans, February 15- 20, 1990. The Awards are administered by the American Associa- tion for the Advancement of Science under a grant from the Westinghouse Foundation. For further information and entry forms, contact theA.4AS Office of Commu- nications, 1333 HStreet, IVW, Washington, DC 20005, or call (202) 326-6440. AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE 1380 SCIENCE, VOL. 24-4.
Page 119: brs52e00
Put the Future at Your Fingertips Only NuAire brings the f uture of In-Vitro COZ Incubation to the Laboratory today with • Automated MicroComputer Control Precision • Exclusive InfraRed COZ Sensing • Automated Backup Systems • Future Growth The IR AutoFlow Incubators from NuAire are the most advanced incubators on earth-tools for the modern laboratory professional in the most demanding environments. The new IR AutoFlow has a Micro-Computer Based Control System that is programmable for precise control of chamber temperature, COZ, and humidity+. The result is an optimum growth environment. A New InfraRed COZ Sensor senses COZ exclusively, offering significantly better COZ stability and efficiency. Automated Backup Systems of triple redundant temperature sensors, power fault tolerance, self diagnostics, and fail-safe gas shut-off- unique to the IR AutoFlow-provide increased assurance of long term reliability. With the flexibility of available options, and planned expansion I 0 capabilities, the new IR AutoFlow Incubators from NuAire are today's choice for the future. And Nu-Aire stands behind these innovations with an impeccable reputation for quality and dependability. For a detailed look at the features and benefits of the new IR AutoFlow Incubators, call Toll Free for a free color brochure, 1-800•328,3352. Consider the IR AutoFlow Incubators from NuAire carefully. Then put the future at your fingertips. Automated Performance for the Most Demanding Environments 2100 Fernbrook Lane, Plymouth, Minnesota, U.S.A. 55441 Phone: 612-553-1270, FAX: 612-553-0459, Telex: 290781 Phone TOLL FREE in the USA: 800-328-3352 Circle No. 266 on Readers' Service Card
Page 120: brs52e00
lowec ocgatisms (25~. Furthermore, our results are not consis- tent with the suggestion that the human circadian timing system is unperturbed by exposure to ordinary indoor room light (24, 26); they are, however, consistent with earli- er data on the effect of indoor room light on the synchronization of human glucocorti- coid rhythms (27). Light probably exerts its primary action directly on the human circa- dian pacemaker via the monosynaptic ret- inohypothalamic tract (2), although pineal melatonin secretion may also exert some influence on the entrainment process (28). Our results have implications for the treatment of circadian sleep disorders, such as the rapid time zone change (jet-lag) syn- drome, delayed sleep phase syndrome (DSPS), hypernychthemeral (non-24-hour) sleep-wake syndrome, shift work dyssomnia and disrupted sleep in the elderly (29). These syndromes form a distinct class of sleep and arousal disorders and are charac- Fig. 5. Phase-depen- dent resetting respons- es of the human circa- than timing system to light exposure. Reset- ting responses are plot- ted with respect to the initial circadian phase at which the light stim- l d I terized by a misalignment between the sleep-wake schedule and the endogenous circadian pacemaker, which is a major deter- minant of the timing of sleep and sleep stages in humans (30, 31). For example, recent laboratory studies simulating the phase shifts required for adjustment to transmeridian travel or rotating shift work show that even after 9 days, the body tem- perature rhythm is still not fully realigned with the new sleep-wake schedule following a 6-hour phase-advance shift (32). Our re- sults indicate that with properly timed expo- sure to bright light, ordinary indoor room light, and darkness, physiologic adaptation to such a phase shift can be complete within 2 to 3 days. This may explain why transmeridian travelers who spend more time outdoors show quicker adaptation of their psychomotor performance rhythms to the new time zone than those who remain indoors (33), supporting the potential role of bright (outdoor) light exposure in the Initial relative clock hour (¢f + 5h) 17:00 23:00 5:00 11:00 17:00 23:00 5:00 11:00 - 17:00 u n us occurre (wj). - m ~ I '\.: I \. I,. ro o initial - 1 • 1.• 1 •``: f° -' er abscissa u A pp , ECP,;,, is defined as 05:00; in lower abscis- sa, it is defined as 0. (A) Human phase re- Initial I 't . ~ 18 sponse curve induced ECPmin by exposure to the I three-cvcle light stimu- lus. The stippled area ~ 24 1--- - ~ 05:00 indicates the initi ~al 0 W ... e....:..e .,~~.1.. C;.,,. M N .L « ............ ...b..., v .~ 7 the data are plotted in ~~ 18 S23:00 ~e this standard format, + there is an artifactual ~ ~ ~ 12 17:00 > discontinuitv, or "break ~ T point," in the ctuve dur- °- 6 11:00 ~ ing the subjective night LL° c when small differences in 0 05:00 LL the initial circadian phase 12 18 0 6 12 18 0 6 12 of the light stimulus ap- Initial circadlan phase of light stimulus pear to reverse the direc- (0,) tion of the resulting phase shift. (B) Data from (A) are replotted with an ordinate which represents the number of hours between the ECPm;,, after and before intervention, t2 - tl (= -Gd)). This projection reveals that there is not a true discontinuity in the phase response curve. (C) Human phase transition curve to the three- cycle light stimulus. Data are replotted in the format introduced by Winfree (21). Ordinate is ~)f, where ~ f=(¢; + A(~) mod 24. Stippled area represents the final subjective night. There is a 10-hour excluded zone during which (af never occurs, indicating that the light stimulus was strong enough to transform the phase at which the bright light exposure initially occurred (4);) into the subjective day, regardless of whether the initial phase of the stimulus was during the subjective day or subjective night. The mathematical representation in Eq. 1 was fit to the data in (C) with nonlinear least squares and then projected onto (A) and (B) (solid lines). Estimated parameters and their standard errors are: a= 11.06 :t 0.3; ci)~ = 0.05 ± 0.01; a = 0.70 ± 0.1; b = 0.45 ± 0.13; covariance (a, b) = -0.01. Linear transformations of these variables yield the following estimates of the light sensitivity parameters: (a + b) = 1.15 ± 0.06 (maximal effectiveness); (a - b) = 0.25 ± 0.23 (minimal effectiveness). The standard error of the model [the root-mean-square deviations of the points (~)f) from the model curve] is 1.99 hours. Based on the curve in (C), the maximal width of the 95 percent confidence interval for the mean of (~f is t 1.5 hours. phase resetting process. Preliminary clinical data suggest that ex- posure to bright light may be a rapid and practical treatment of both early morning awakening in the elderly and DSPS (34). Similarly, Lingjaerde et al. have successfully used morning bright light therapy to treat patients with an environmentally induced variant of DSPS, insomnia during the "dark period" in northern Norway (35). Exposure to bright light has also been reported to facilitate adaptation to a non-24-hour sched- ule (36), as may bc required for aerospace exploration. Finally, it has been found that seasonal (fall-winter) depression responds to pho- totherapy, although there are several hypotheses as to the mechanism of this effect (22, 37). Our characterization of a human phase response curve to bright light may prove to be important for understanding and effectively treating disorders of circadian regulation. REFFRENCES AND NOTES 1. J. tv. Hastings and B. 1M. Sweeney, Biol. Btdl. 115, 440 (1958). 2. J. S. Takahashi and N1. Zatz, Science 217, 1104 (1982). 3. R. A. Wever, Eur. J. Physiol, 321, 133 (1970); J. Aschoff et al., Science 171, 213 (1971); J. Asehoff and R. Wever, Fed, Proc. 35, 2326 (1976). 4. C. A. Czeisler, thesis, Stanford University (1978). 5. C. A. Czeisler, G. S. Richardson, J. C. Zimmerman, M. C. Moore-Ede, E. D. Weitzman, Photochem. Photobiol. 34, 239 (1981). 6. C. A. Czeisler et al., Science 233, 667 (1986). 7. Self-selected times of going to bed and rising during a fm run do not occur at a consistent circadian phase in human subjects, even when the period of the rest-activitv cycle is about the same as that of the pacemaker (4, 30). In humans, the behavioral rest- activity cycle is itself an oscillatory process with a labile period often substantially different from that of the pacemaker. Internal desynchronization be- twcen the free-running rest-activity cycle and the output of the circadian pacemaker, which occurs only in humans (4, 30), demonstrates that the rest- activity cycle is not a suitable marker of circadian phase in humans. In addition, many physiologic rhythms-including body temperature-are passive- ly responsive to the rest-activiry cycle, complicating attempts to accurately assess circadian phase reset- ting with such markers under free-running condi- tions. In fact, while Honma et al, have found that a single exposure to bright light can induce phase- advance shifts of the free-running resaactivity cycle in humans, they did not observe significant phase- delay shifts, regardless of the initial circadian phase of light exposure [K. Honma, S. Honma, T. Wada, Experientia 43, 1205 (1987)]. We conclude that their failure to generate phase-resetting data consis- tent with data of other human studies (6, 24) or comparable to that of other species (2) is because the frce-rcuming rest-activity cycle in humans is not an accurate marker of the endogenous circadian pace- maker. 8. Mills et al, utilized 24-hour CR's beginning at 4:00 a.m., and allowed subjects to change posture occa- sionally [J. N. Mills, D. S. Minors, J. M. Water- house, J. Physiol. (London) 285, 455 (1978); D. S. ,MGnors and J. M. Waterhouse, Chronobiol. Int. 1, 205 (1984)]. We have found the phase of the endogenous circadian temperature cycle minimum, the most reliable circadian phase marker, to be inadvertently obscured by the timing of the Mills procedure, since the masking effects of sleep on core body temperature persist for 3 to 5 hours after awakening occurs. We begin the CR at the regular 16 lUNE 1989 REPORTS 1331 2047u51995
Page 121: brs52e00
Laminar Flow Workbench WFieriever a(vIiCRO-iSOLATC~K uria is being serviced (th4 is, wherr ~3nimaJs or the conterits of the unit are manibufated}, theseactivities must take place _~enthi~ a Cfass `00 environment. The STAY-CLEAN Larriirfar F1ow Workbench is a specialized unit devel- opeclfor `such`cage and animal manipulation. It has been designed to achieve two goals: (1) to prevent ambient contagion from entering the workbench and any-of the components, ahd (2) to limit the escape of =animat dander-and other particufate matter from the area ' `~The STAY_CLEAN.t_aminar F(ow Workbench is com- v:-pac€, moveabie, and inclucfes state of the art riia+ fitc3r _ : ing'insfrumerifation to assure, nroper aperation` circi6 tva zLIb nc~ eaae;~ SerwCg~~;&rc( ~ ~ : . .i'K.~.:~ ... 'r- . 4 (' ~{5: ' ~ C 31 F ~ r . ~e S » E2 t'f 1 ~~ ~ RI€~ 3rn7 ST11 ~t EALY?~V3~e The Service Cart The service cart completes the MICRO-ISOLATOR System by simplifying the movement of all necessary supplies to the laminar flow workbench for servicing the MICRO-ISOLATOR units. Write or call Lab Products, Inc., 255 West Spring Valley Avenue, P.O. Box 808, Maywood, New Jersey 07607 or complete the coupon. Phone 201/843=4600 or 800/526-0469. lab products iric 0 o i I would appreciate; - : 0 Your new MICRO-ISOLATOR System"P-roducts, Principles, Lab Products, Inc.-- 255 West Spring tFalley Avenue PO.Box8ofi Maywood, New Jersey 07607 and Procedures Manuaf" O Information on your other environmental control products. O Your comprehensive catalog of animal housing and care ._ I systemsandaccessories. _ R Seeing your ioCaF'representative Please call and set up an -appointment.> - . Area Code --------------------...... -.............................. Name . Qlgdtlf2$tf(~' .. AdW1e1,S ..-..-- company
Page 122: brs52e00
\3,4 to these exQeriments. For those interested in this fiterature, I would recommend the 1984 Cold Spring Harbor Symposium on homologous recombination (6) and a recent review (7). I will also discuss various approaches being used to modify nonselectable genes and venture some guesses as to where the field is likely to progress. From ES Cells to Germ Line Chimera Figure 1 outlines the procedure for introducing a designed mutation into the germ line of mice by means of targeted modifica- tion of the ES cell genome. A targeting vector, containing the desired mutation, is introduced into ES cells by electroporation or microinjection. In most cells the targeting vector inserts randomly into the ES genome. However, in a few cells, the targeting vector pairs with the cognate chromosomal DNA sequence and transfers the mutation to the genome by homologous recombination. Screen- ing or enrichment procedures (or both) are then used to identify the rare ES cell in which the targeted event has occurred. The appropri- ate cell is then cloned and maintained as a pure population. Next, the altered ES cells are injected into the blastocoel cavity of a preimplantation mouse embryo and the blastocyst is surgically transferred into the uterus of a foster mother where development is allowed to progress to term. The resulting animal is chimeric in that it is composed of cells derived from both the donor stem cells and the host blastocyst. In the particular example shown in Fig. 1, the ES cells are derived from a mouse homozygous for the black coat color allele and the recipient blastocyst is derived from an albino mouse. The fur of the resulting chimeric mouse has patches of both colors because the mouse contains cells of both genotypes. Breeding of the chimeric mouse to an albino mouse yields some black mice, indicating that the ES cells contributed to the formation of the germ line. Genomic screening of these progeny is used to determine which mice received the allele carrying the targeted mutation. Interbreeding of heterozygous siblings yields animals homozygous for the desired mutation. Disruption of hprt Mammalian cells can mediate recombination between homolo- gous DNA sequences but they demonstrate an even greater disposi- tion for mediating nonhomologous recombination. The problem is thus to identify homologous recombination events in a vast pool of scattered, nonhomologous recombination events. The hypoxanthine phosphoribosyl transferase gene (hprt) has provided an ideal model system for developing the technique of gene targeting in ES cells, because one can select directly for the targeting event. Since this gene is on the X chromosome, only one mutant copy is needed to yield the recessive hprt- phenotype in male ES cells. The hpn- cells are selected by growth in the presence of the base analog, 6 thioguanine (6-TG), which kills hprt+ cells. Figure 2 illustrates the use of sequence replacement and sequence insertion vectors to disrupt hprt (8). Using yeast as a paradigm, we anticipated that sequence replacement vectors would replace endog- enous DNA with exogenous sequences, whereas sequence insertion vectors would insert the entire vector DNA sequence into the endogenous locus. Since the final products are predicted to be different when these two classes of vectors are used (note the partial duplication of the gene in Fig. 2B), each vector could generate different types of mutant alleles. The presence of the gene encoding neomycin phosphotransferase (neo) within the eighth exon of hprt disrupts the hprt coding sequence and also provides a selectable Fig. 1. Generation of mouse germ line chime- ras from embryo-derived stem (ES) cells contain- ing a targeted gene dis- ruption. T ransiecLon wdn a !arge:,ng vector " tmiui or rrr•r-rr~a Embryo-derived eiectropaatonl ES cell culture with stem (ES) cells rare targeted cell Screening/or enrichment for~ targeted cell Injection of ES cells into blastocyst ®l Implantation into foster mother Pure population of targeted ES cells Chimeric mouse ES cell genome contatning ~ targeted modification Germ-line transmission of marker (resistance to the drug G418). Both types of targeting vector were introduced into ES cells by electroporation. The transfectants that survived selection in G418 and 6-TG had lost hprt activity as a result of a targeted disruption of hprt. Both types of vectors were equally efficient at disrupting the endogenous hprt (8). Furthermore, replacement and insertion vec- tors showed the same dependency of the targeting frequency on the extent of homology between the targeting vector and endogenous DNA sequences (Fig. 3). (The word "homology" is used here to describe participants in homologous recombination, which are generally identical.) Over the range tested, from 2.9 to 14.3 kb, a fivefold increase in DNA sequence homology resulted in roughly a 100-fold increase in the targeting frequency. In the above experi- ments, the amount of nonhomology (neo) being transferred to the target was kept constant. Therefore, it has not been determined whether the critical parameter is the absolute extent of sequence homology between the incoming DNA and the target, or whether the relative amount of nonhomology is also important. However, with the largest targeting vector the absolute targeting frequency was one independent targeting event per 3 X 104 ES cells electro- porated. Smithies and his colleagues have corrected a defective hprt in ES cells using a sequence insertion vector (9) and have inactivated hprt with a sequence replacement vector (10). In the former experiments the recipient ES cells contained a spontaneous 5' deletion in hprt and the incoming targeting vector supplied the missing exons. In the latter experiments the replacement-type vector contained only 1.3 kb of hprt sequence homology disrupted by a promoterless neo. As will be discussed shortly, use of a promoterless neo in the targeting vector yields an enrichment for homologous versus nonhomologous recombination events. More recently Thompson et al. (3) generated germ line chimeras from ES cells in which a mutant hprt had been corrected by gene targeting. This demonstrates that ES cells trans- fected by electroporation and subjected to HAT selection still retain their ability to contribute to a functional germ line. It has not been straightforward to make quantitative comparisons among hprt targeting experiments done in different laboratories. Targeting vectors containing different extents of homology to the endogenous target were used. In addition, the targeting vectors have been directed to different regions of hprt. The simplest means for 16 JUNE 1989 2047651953 ARTICLES 1289
Page 123: brs52e00
11 d N i the effect of light on the human circadian pacemaker, represented as a van der Pol oscillator (15). When stimuli are extended in time, as ours were, the intrinsic tendency of such a van der Pol oscillator to revert to its nominal amplitude would ordinarily act Fig. 3. Average wave- forms of plasma cortisol, cumulatively to oppose stimulus-induced changes. However, if the oscillator's resilien- cy is weak [that is, its "stiffness" is low, as suggested in (16) ], then even an extended- time stimulus can be approximated as an equivalent impulsive stimulus. Under such Baseline Phase delay shift Phase advance shift and core 18 I ,- A D G urine production , body temperature during y _ baseline compared to L E 12 ~ waveforms after phase 8 g shifts of > 4 hours. (A, B, ~~ 61 C) Average baseline wave- m3 forms (solid lines t SEM) a of each of these variables measured during the first constant routines (before intervention) of the 11 subjects who then under- went a phase shift of more than 4 hours. Data are aligned with respect to the baseline ECPm,~, indicated by the vertical dashed line. (D, E, F) Average wave- forms (solid lines ± SEM) of data recorded during constant routines after nine substantial phase-ad- vance shifts in six subjects (mean 1~ t SD = +7.0 ± 2.3 hours), aligned with respect to the final ECPR,;n (tz). Plasma cortisol data are available for eight of the nine trials in these sub- H I 6 12 18 0 6 12 6 12 18 0 6 12 6 12 18 0 6 12 Endogenous circadian temperature phase (O=ECPmtn) jects. For direct comparison, these results are superimposed on average waveforms (broken lines) from the baseline constant routines, aligned with respect to the ECP,,,, of those subjects who were subsequently phase-advance shifted; remaining symbols as in (A). (G, H, I) Average waveforms (solid lines --* SEM) from constant routines after 17 substantial phase-delay shifts in 11 subjects (mean A(~ t SD = -6.9 ± 1.8 hours); remaining symbols as in (D to F). Plasma cortisol data are available for 14 of the 17 trials in these subjects. The average waveforms of circadian rhythms in adrenocortical and renal funetion maintained the same phase relation to the endogenous circadian temperature cycle during constant routines that followed substantial phase-advance or phase-delay shifts as they did during the baseline constant routines. Flg. 4. The timing of exposure to room Light can substantial- ly modulate the phase-shifting effect of bright Light when the midpoint of the bright Light exposure, tBL, occurs at the most light-sensitive phase. Daily illuminance patterns and resulting phase shifts are shown in three different trials of light exposure in a 22-year-old man (subject 713). In each of these trials, tBL occurred at approximately the same initial ECP,,,;,, (tt, indicated by a vertical dashed line), while the timing of exposure to room Light [and therefore darkness or sleep (13)] was varied. In (A), exposure to room Light occurred predominantly after the bright light exposure, whereas in (C), most of the exposure to room light occurred before the bright Light expo.sure. In (13), the midpoint of the room Light exposure (tRL) was concurrent with that of the bright Light exposure (tBL). While taL occurred at a relative clock hour of 05:20 (± 15 minutes) in all three cases, the relative clock hours at which the midpoints of the overall light exposures occurred [tL, which is a brightness-weighted average of t8L and tRL, as described in (14)] were 06:36, 05:34, and 03:43 for (A), (B), and (C), respectively. These tL values correspond to initial circadian phases at which the stimuli occurred ((b;) of 1.6, 0.6, and 22.7, respectively. These differences in d)i were associated with marked differ- Reiative clock hour 18 24 6 12 18 A tJ1-1 fT1 J7 conditions, the asymptotic form achieved by this model (in the limit of weak stiffness) can be represented as: ~)f = a 24 - 2~ tan - ~~)] 1 sin [24 (d~i L ~ (1) a + (b - 1) cos [ 2,~ 2((~;-d)0)-1] where small deviations of the intrinsic circa- dian period from 24 hours are accommodat- ed by the phase shifts, a and and the parameter a represents the average influence of light and b represents a modulation of that influence as the cosine of its circadian phase of application. The sum (a + b) represents the sensitivity to the stimulus when applied at (~; = 0 (that is, at ECPm;n), while (a - b) represents the sensitivity to the stimulus when applied at (~; = 12. The data are well described by the parsi- monious four-parameter representation (Fig. 5, solid lines), consistent with similar models of circadian phase resetting to single light stimuli acting impulsively on the oscil- lator (17, 18). The standard error of the model curve is comparable to that reported for Drosophila pseudoobscura (17, 19). The ratio (a - b)/(a + b) = 0.22 derived from our parameter estimation (Fig. 5C, legend) implies a substantial reduction of circadian sensitivity to light at ~); = 12 (relative clock hour 17:00), although more data are re- quired in the band 9<(~i < 21 to estimate this ratio precisely. These data are consistent with reported circadian variations in retinal- visual sensitivity, which may be driven by an oscillator in the eye itself (20). Our three-cycle stimulus has generated a phase transition curve (~)f compared to ~)„ Fig. 5C) with an average slope of zero, comparable to Winfree's definition of strong "type 0" circadian phase resetting in re- sponse to single light pulses (21). This dem- onstration of type 0 resetting in human subjects, as anticipated by Winfree (21), implies that the stimulus has affected not only the pacemaker's phase, but also its amplitude of oscillation, consistent with our recent observations reported elsewhere (22). Previously, the house sparrow (Passer do- mesticus) was the only vertebrate in which type 0 resetting by light had been reported, although Gander's data on the Polynesian rat (Rartus exulans) also support the possibili- ty that mammals are capable of type 0 resetting in response to an extended (8- or 16-hour) light stimulus (23). While humans have been thought to be relatively insensi- tive to phase resetting by light (3, 24), our data indicate that the responsiveness of the human circadian pacemaker to light is with- in the wide range of sensitivity observed in . ~ i, tz F---- -1o = -5.9 hours I-' ences in the magnitude and direction of the resetting response to the light stimulus [0(b for (A) = +3.6 hours; for (B) = +8.6 hours; and for (C) =-5.9 hours], consistent with the results discussed below (in Fig. 5A). 1330 20470"151994 1 t, -10 . +8.6 hours SCIENCE, YOL- 244
Page 124: brs52e00
Life Technologies, Inc., a leading supplier of research products for Cell Culture and Molecu- lar Biology is establishing a new Cell Biology business to provide research products for the cellular and molecular biochemistry market. The selected candidate will identify new product areas for the Cell Biology business and supervise their qualification and development to meet the business objectives. The ideal candidate will have a Ph.D. degree and post-doctoral experience in cellular, molecular or protein biochemistry. Strong communications and interpersonal skills and relevant experience in the biochemistry industry. The selected candidate will be responsible for the transfer of new product technical information by generation of appropriate technical documentation, product information sheets, and development of workshops and training sessions. The ideal candidate will have a Ph.D. in the life sciences, strong communi- cation skills and experience in the biotechnology industry. For consideration, please send resume or C.V., in confidence, to: Mr. Richard L. Hotaling, Jr. Personnel Manager Life Technologies, Inc. Cell Biology, Dept. SB 8717 Grovemont Circle Gaithersburg, MD 20877 (A suburb of Washington, D.C.) Bionetics is realizing its potential in Biomedical Research. You can realize your potential at Bionetics. Founded in 1961, the Organon Teknika Corporation- Bionetics Research Institute (OTC-BRI) family was acquired in 1985 by Akzo, N.V. of the Netherlands, Akzo is active in chemicals, fibers, coatings and health-care products. It operates in 300 locations in 50 countries with 70,000 employees. UndertheAkzo Pharma Division, Bionetics Research Institute, in the Greater Washington, D.C. area, is pursuing a program of cancerAIDS and cardiovascu- lar disease research and diagnostic product develop- ment. Positions in this group offer opportunities for collaboration with academic, industrial, and govern- ment investigators throughout the scientific community. POSTDOCTORAL SCIENTIST Nucleic Acid Technology The successful candidate will explore gene probe methodologies for detection of pathogens within the Product Development Laboratory in close association with the Molecular Biology Laboratory. We seek applicants with a Ph.D. degree in biochemis- try or molecular biology with a strong biochemistry background and experience in nucleic acid chemistry and nucleic acid enzymology. Proven skills in nucleic acid synthesis, modification, and hybridization will be utilized in this work. POSTDOCTORAL SCIENTIST Immunoassay Technology The successful candidate will develop monoclonal antibody-based immunoassays for tumor markers and apolipoproteins in the Product Development Laboratory. We seek applicants with a Ph.D. degree in immun- ology or clinical chemistry and experienpe in diagnos- tic immunoassay development for the clinical labora- tory. Proven skills in the development of assays for serum/plasma and urine samples will be utilized in this work. Compensation for these positions includes a com- prehensive benefits package with health, life and dental insurance, relocation, if necessary, and a company-matched savings plan. To apply, send your curriculum vitae to the address below. Letters of recommendation and transcripts may be requested following initial evaluation of qualifications. OTC-BIONETICS RESEARCH INSTITUTE Department SM-616 1330-A Piccard Drive Rockville, MD 20850 An Equal Opportunity Employer M/F/H/V. Principals Only.
Page 125: brs52e00
M i t 2.4 g; and pellets-out, 100.7 '- 1.9 g. Parametrial fat pad weights: high fat, 5.6 t 1.8 g; powder, 4.7 t 0.5 g; pellets-in, 1.4 t 0.2 g; and pellets-out, 0.8 ± 0.2 g. 11. T. C. Kiorpes et al., J. Biol. Chem. 259, 9750 (1984). 12. J. Brown, Metabolism 11, 1098 (1962); N. Row- land, Physiol. Behav. 30, 743 (1983). 13. J. E. Schneider and G. N. Wade, unpublished data. 14. in preparation. 15. F. E. Johnston, A. F. Roche, L. M. Schell, N. B. Wettcnall, Am. J. Dis. Child. 129, 19 (1975); M. P. Warren,J. Clin. Endocrinol. Metab. 51, 1150 (1980); S. F. Abraham, P. J. V. Beaumont, I. S. Fraser, D. Llewellyn-Jones, Br. J. Obstet, Gynaecol. 89, 507 (1982); J. B. Russell, D. E. Mitchell, P. I. Musey, D. C. Collins, Fertil. Sterii. 42, 690 (1984); H. Ronkainen, A. Pakarinen, A. Kauppila, Gynecoi, Obstet. Invest. 18, 183 (1984). 16. M. 1. Friedman and M. G. Tordoff, Am. J, Physiol. 251, R840 (1986). 17. J. E. Schneider, S. J. Taz>arin;, M. I. Friedman, G. N. Wade, Physiol. Behav. 43, 617 (1988); S. J. I,z+arini, J. E. Schneider, G. N. Wade, ibid. 44, 209 (1988). 18. We thank M. I. Friedman and L. P. Morin who laid the conceptual groundwork for this research; J. D. Blaustein and G. J. DeVries for helpful comments on this manuscript; J. Alexander, R. Mergendahl, and M. H. Brown for technical assistance; and C. Bowden of McNeil Pharmaceuticals for the methyl palmoxirate. Supported by NIH research grants NS 10873-17 and AM 32976-06, National Institute of Mental Health Research Scientist Development Award MH 00321-09, and by NSF research grant BNS 8719361. 22 December 1988; accepted 24 March 1989 ioral stimuli that can otherwise obscure it. Using the CR, we have found that repeated sequential estimates of the endogenous cir- cadian phase at which the body temperature minimum (ECPm;n) occurs (9) are highly correlated (Pearson's correlation coefficient, 0.998; P< 0.001), indicating that the CR is a reliable, reproducible procedure that has no measureable phase-shifting effect on the pacemaker. Therefore, we used the CR to assess the ECPmin both before and after the administration of a light stimulus in order to evaluate the phase-resetting effect of that stimulus (Fig. 1). We applied a stimulus consisting of three cycles of exposure to a daily illuminance pattern that included bright light, ordinarv indoor room light, and darkness (10) across the fiill range of initial circadian temperature phases ((~i) (11). In order to determine the resetting response at these different phases, we began each resetting trial with an assess- ment of the initial pre-intervention ECP,t,in (tl), exposed the subjects to the light stimu- lus, and then reassessed the final post-inter- vention ECPm,,, (tZ) (Fig. 1) (11). We coq- ducted 45 resetting trials in 14 healthy young male subjects, aged 18 to 24 years (12), the data obtained represent a total of 420 subject-days of laboratory recording. Exposure to our three-cycle light stimulus induced the largest phase shifts (A~) > 8 hours) when the light stimulus was centered around the initial ECPmin (ti) (Fig. 2A). Since the ECPm;n ordinarily occurs about 2 to 3 hours before the habitual wake time, centering the light stimulus around the ECPmin required inversion of the sleep-wake schedule (13); however, in 14 control trials in which the daily 5-hour episodes of bright light exposure were replaced with exposure either to room light (12 trials) or to dark- ness (2 trials), we found that such sleep- wake schedule inversion alone did not in- duce such large phase shifts (Fig. 2B) (6). This indicates that the observed phase shifts were induced primarily by the light expo- sure rather than by the displacement of sleep or activity. To confirm that such light-induced phase shifts of the endogenous circadian tempera- ture cycle accurately reflect phase shifts of the circadian pacemaker, we analyzed other established indicators of circadian rhythlnic- ity before and after each of the resetting Bright Light Induction of Strong (Type 0) Resetting of the Human Circadian Pacemaker CHARLES A. CZEISLER,* RICHARD E. KRONAUER, JAMES S. ALLAN, JEANNE F. DUFFY, IYS.EGAN E. JEWETT, EMERY N. BROWN, JOSEPH M. RONDA The response of the human circadian pacemaker to light was measured in 45 resetting trials. Each trial consisted of an initial endogenous circadian phase assessment, a three- cycle stimulus which included 5 hours of bright light per cycle, and a final phase assessment. The stimulus induced strong (type 0) resetting, with responses highly dependent on the initial circadian phase of light exposure. The magnitude and direction of the phase shifts were modulated by the timing of exposure to ordinary room light, previously thought to be undetectable by the human pacemaker. The data indicate that the sensitivity of the human circadian pacemaker to light is far greater than previously recognized and have important implications for the therapeutic use of light in the management of disorders of circadian regulation. T HIRTY YEARS AGO, A PHASE RE- sponse curve (PRC) to light was first described (1), revealing the mecha- nism by which pacemakers driving circadian rhythms are synchronized (entrained) to the 24-hour day (2). Since then, PRC's to light have been described in nearly all eukaryotes studied except humans; it was believed that social contacts, rather than the light-dark cycle, synchronized the human circadian sys- tem to the 24-hour day (3). Subsequent studies demonstrated that the circadian sys- tem of normal subjects could be entrained by a 24-hour cycle of ordinary indoor room light and complete darkness (4, 5). Evening exposure to bright light has been found to rapidly shift the phase of the endogenous component of the body tem- perature and cortisol cycles, even when the timing of the sleep-wake cycle was held constant (6). That experiment indicated that light could have a direct biological effect on the human circadian pacemaker, rather than an indirect synchronizing effect via its influ- ence on the timing of sleep. We now report that the timing of light exposure has a critical effect on the magnitude and direc- tion of the human circadian phase-resetting response to light. The human circadian pacemaker, which is more responsive to light than was previously postulated, can be reset to any desired phase by scheduled exposure to light for 2 to 3 days. Typically, free-running activity rhythms of animals living for several weeks in con- stant darkness are interrupted by the presen- tation of brief light stimuli to evaluate the circadian resetting response of a pacemaker to light (2). However, in human subjects the free-running behavioral rest-activity cycle is an unreliable indicator of endogenous circa- than phase and thus cannot be used to assess phase resetting (7). Hence, we have used the constant routine (CR) method to assess endogenous circadian phase (ECP), using the endogenous component of the body temperature cycle as a marker of the output of the human circadian pacemaker. Our CR procedure (6) is an extension and refinement of that of Mills (8), in which subjects are studied under constant environmental and behavioral conditions to unmask the endog- enous component of the body temperature cycle by either eliminating, or distributing uniformly across the circadian cycle, physio- logic responses to environmental and ~"- 1328 C. A. Czeisier, J. S. Allan, J. F. Duffy, M. E. Jewett, E. N. Brown, J. M. Ronda, Center for Circadian and Sleep Disorders Medicine, Division of Endocrinology , Depart- ment of Medicine, Harvard Medical School, Briph am and Women's Hospital, Boston, MA 02115. R. E. Kronauer, Division of Applied Sciences, Harvard Uni- versitv, Cambridge, MA 02138. "To whom correspondence should be sent at Center for Circadian and Sleep Disorders Medicine, Harvard Medi- cal School, Brigham and Women's Hospital, 221 Long- wood Avenue, Boston, MA 02115. 204 1 SCIENCE, VOL, 244
Page 126: brs52e00
Fig. 2. Analysis of cndothe- 7-A%x -_ W tt,7 ~- B Catheter Double balloons - Iliac artery Guide Wire Instillation port Fig. 1. Method of introduction of endothelial c:ells by catheterization. (A) Double balloon cath- eter used for instillation of endothelial cells. Prox- imal and distal balloon inflation isolates a central space, allowing for instillation of infected cells through the port into a discrete segment of the vessel. (B) Schematic representation of cell intro- duction by catheter. Female Yucatan minipigs were anesthetized with pentobarbital and under- went sterile surgical exposure of the iliofemoral arteries. The catheter was advanced into the iliac artery and the proximal balloon was partially inflated and passed to mechanically denude the endothelium. The catheter was positioned with the central space located in the region of denuded endothelium, and both balloons were inflated. The denuded segment was irrigated with heparin- ized saline, and residual adherent cells were re- moved by instillation of dispase (50 U/ml) for 10 min (12). After further irrigation, the BAG-infect- ed endothelial cells were instilled for 30 min. The balloon catheter was subsequently removed, and antegrade blood flow was restored. The vessel segments were excised 2 to 4 weeks later. A portion of the artery was placed in 0.5% glutar- aldehyde for 5 min and stored in phosphate- buffered saline, and another portion was mounted in a paraffin block for sectioning. coloration indicative of (3-galactosidase ac- tivity in the arteries seeded with infected endothelium, estimated to represent 20 to 100% of the cells that attached initially. Arteries seeded with uninfected endotheli- um exhibited no blue staining (Fig. 2, C and D). Light microscopy revealed (3-galacto- sidase staining primarily in endothelial cells of the intima in experimentally seeded ves- sels. No evidence of similar staining was observed in control segments (Fig. 2, E and F). G3-Galactosidase staining was occasional- ly evident in deeper intimal tissues and was suggestive of entrapment or migration of seeded endothelium within the previously injured vessel wall (Fig. 2F). Local throm- bosis was observed in the first two experi- mental subjects. This complication was min- imized in subsequent studies by administer- ing acet,vlsalicylic acid before the endothelial cell transfer procedure and by using heparin anticoagulation at the time of innoculation. In instances of thrombus formation, (3-ga- i6 JUNE 1989 lial cells in vitro and in vivo. l3-galactosidase activity doc- umented by histochemical staining in (A) primarv en- dothelial cells from the Yu- catan minipig, (B) a subline derived by infection with the BAG retroviral vector, (C) a segment of normal control artery, (D) a seg- ment of artery instilled with endothelium infected with the BAG retroviral vector, ._ (E) microscopic cross sec- tion of normal control ar- _ tery, and (F) microscopic cross section of artery in- stilled with endothelium in- fected with the BAG retro- viral vector. Endothelial cells in tissue culture were fixed in 0.5% glutaraldehvde be- fore histochemical staining (13). The enzymatic activity of the Escherichia coli l3-galac- tosidase protein was used to identifv infected endothelial cells in vitro and in vivo. Endothelial cells at two- thirds confluence were in- fected with BAG (7) retrovi- rus (104 to 105 G418-resist- ant colony-forming units per milliliter) and incubated for 12 hours in Dulbecco's minimum essential medium with 10% calf serum at 3TC in 5% CO2 in the presence of polybrene (8 µg/ml). Cells were maintained in medium 199 with 10% fetal calf serum, endothelial cell growth supplement (50 µg/ml), and endothelial cell-conditioned medium (20%) for an additional 24 to 48 hours before selection in G418 (0.7 mg/ml of a 50% racemic mixture). G418-resistant cells were isolated and analyzed for (3-galactosidase expression with a standard histochemical stain (13). Cells stably expressing the (3-galactosidase enzyme were maintained in continuous culture for use as needed. Frozen samples were stored in liquid nitrogen. lactosidase staining was seen in endothelial cells extending from the vessel wall to the surface of the thrombus. A major concern of gene transplantation in vivo is the production of a replication- competent retrovirus from genetically engi- neered cells. This potential problem was minimized through the use of a replication- defective retrovirus. No helper virus was detectable among these lines after 20 pas- sages in vitro. Although defective retro- viruses were used in this study because of their high rate of infectivity and their stable integration into the host cell genome (9), this approach to gene transfer is adaptable to other viral vectors. A second concern in- volves the longevity of expression of recom- binant genes in vivo. Endothelial cell expres- sion of (3-galactosidase appeared constant in vessels examined up to 4 weeks after sur- gery. Thus, genetically altered endothelial cells can be introduced into the vascular wall of the Yucatan minipig by arterial catheteriza- tion. A major complication of current inter- ventions for vascular disease, such as balloon angioplasty or endarterectomy, is disruption of the atherosclerotic plaque and thrombus formation at sites of local tissue trauma (10). In part, this is mediated by endothelial cell injury (11). Genetically altered or normal endothelial cells introduced at the time of intervention could minimize local thrombo- sis. This technology could be used also for the treatment of myocardial or tissue isch- emia by introducing cells expressing throm- bolvtic, angiogenic, or growth factor genes. Finally, this approach might be used to treat systemic or inherited diseases requiring se- cretion of gene products directly into the circulation. REFERENCES AND NOTES 1. J. N. George, A. T. Nurden, D. R. Phillips, .N. Fagl. J. .11ed. 311, 1084 (1984); C. T. Esmon, Scierue 235, 1348 (198i); G. M. Rodgers, FASEB J. 2, 116 i 1988). 2047e52007 REPORTS 1343 e
Page 127: brs52e00
(Slovene Society for Microbiology, Ljubljana, Yugoslavia, 1988), pp. 509-515; J. Lindemann and T. V. Suslow, Phytopathology 77, 882 (1987). 15. 5. Z LJttdou; D. K. W'tllit, N.1. Panopoulos, Pkytopathology 77, 1768 (1987); D. A. Cooksey, ibid. 78, 601 (1988). 16. T. J. Burr and A. J. Caesar, CRC Crit. Rev. Plant Sci. 2, 1(1984); M. N. Schroth and J. G. Hancock, Anmt. Rev. Microbial. 35, 453 (1981); T. V. Sualow, in Phytopathogenic Prokaryotes, M. S. Mount and G. H. Lacy, Eds. (Aeademic Press, London, 1982), pp. 187-223. 17. 1.. S. Thomashow and D. M. Weller, J. Bacteriol. 170, 3499 (1988). 18. P. R. Gill and G. J. Warren, ibid. 170, 163 (1988). 19. J. E. Loper, Phytopathology 78,166 (1988); P. A. H. M. Bakker, A. W. Bakker, J. D. Marugg, P. J. Weisbeek, B. Schippers, Soil Biol. Biochem. 19, 443 (1987); P. A. H. M. Bakker, P, J. Weisbcek, B. Sclvppers, J. Plant Nutc. 11, 925 (1988). 20. N. L. Gutterson, T. J. Layton, J. S. Ziegle, G. J. Warren, J. Bacterial. 165, 696 (1986); A- R. Poplawskv, Y. F. Peng, A. H. Ellingboc, Phytopathology 78, 426 (1988). 21. N. C. Franklin, Annu. Rev, Genet. 12, 193 (1978); T. J. Silhavy and J. R. Beckwith, Microbiol. Rev. 49, 398 (1985); S. E. Stachel, A. An, C. Flores, E. Nester, EMBO J. 4, 891 (1985); T. J. Close and R. L. Rodriguez, Gene 20, 305 (1982); J. J. Shaw and C. I. Kado, BiolTechnology 4, 560 (1986). 22. N. G. Gutterson, J. S. Ziegle, G. J. Warren, T. J. Layton, J. Bacteriol. 170, 380 (1988); G. J. Warren, H. R. Whitely, N. Gutterson, K. M. Timmis, M. J. Gasson, in The Release ofGenetically Engineered Microorganisms, M. Sussman, C. H. Collins, F. A. Skinner, D. E. Stcwart-Tull, Eds. (Academic Press, London, 1988), pp. 194- 206. 23. P. B. Lindgren et al., EMBOJ., 8, 1291 (1989). 24. R. E. Mitchell, .9nnu. Rev. Phytopathol. 22, 215 (1984); N. J. Panopoulos and R. C. Peet, ibid. 23, 381 (1985); A. Kotoujanski, ibid. 25,405 (1987); R. O. Morris, Annu. Rev. Plant Physiol. 37, 509 (1986); M. J. Daniels, J. M. Dow, A. E. Osburn, Annu. Rev. Phytopathol. 26, 287 (1988); R. A. Dixon, Biological Rev. Camb. Philos. Soc. 61, 239 (1986). 25. N. T. Keen and B. J. Staskawicz, Annu. Rev. Microbiol. 42, 421 (1988). 26. M. C. Whalen, R. E. Stahl, B. J. Staskawicz, Proc. Natl. Acad. Sci. U.S.A. 85, 6743 (1988); D. K. Kabayashi, S. J. Tamaki, N. T. Keen, ibid. 86, 157 (1989). 27. A. Trigalet and D. Demerv, Physiol. Mol. Plant Pathol.28, 423 (1986); H. Toyoda et al., Proceedings of the 5th }nternational Congress of Plant Pathology, Kyoto, Japan, 22 to 27 August 1988, Abstracts of Papers, p. 237 (abstr. P-VI-I-33); R. D. Durbin and P. L. Langston-Unkefer, Armu. Rev Phytopathol. 26, 313 (1988). 28. G. N. Gussin, C. W. Ronson, F. M. Ausubel, Atmu. Rev. Microbial. 40, 567 (1986); R. Haselcom, ibid., p. 525; E. W. Triplet, G. P. Roberts, P. W. Ludden, J. Handelsman, Am. Soc. Microbiol. News 50, 15 (1989); L. Rossen, E. O. Davis, A. W. B. Johnston, Trends Biochem. Sci. 12, 430 (1987); C. W. Ronson and P. M. Asrwood, in Nitrogen Fixation Research Progress, H. J. Evans, P. J. Botomley, W. E. Newton, Eds. (Nijhoff, Dordrecht, The Netherlands, 1985), pp. 201-209; G. Eisbrener and H. J. Evans, Am u. Rev. Plant Physiol, 34, 105 (1983); N. J. Brewin, in Genes Involved in Plant-Microbe Interactions, D. P. S. Verma and T. Hohn, Eds. (Springer-Verlag, Vienna, Austria, 1984), pp. 179-203. 29. M. A. Djordjevic and D. W. Gabriel, Annu. Rev. Phytopathol. 25, 145 (1987); J. L. Beynon and J. E. Beringer, J. Gen. Miaobiol. 291, 351 (1981); F. Debelle et al., J. Bacteriol. 170, 5718 (1988); P. J. J. Hooykaas, A. A. N. van Brussel, H. den Dulk- Ras, G. M. van Slogteren, R. A. Schilperoort, Nature 291, 351 (1981); G. Truchet et al., J. Bacterial. 157, 134 (1984); A. M. Hirsch et al., ibid. 158, 1133 (1984). 30. F. Cannon, personal communication. 31. H. P. Spaink, C. A. Wijffdman, B. J. H. Okker, A. A. N. van Brussel, B. J. J. Lugtenberg, in Cell to Cell Signals in Rhizobium-Legume Symbiosis, S. Seannerini, Ed. (Springer-Verlag, Berlin; in press); M. A. Gottfert et al., J. Bacterial. 167, 881 (1986); M. A. Honma and F. M. Ausubel, Proc. Natl. Acad. Sa. U.S.A. 84, 8558 (1987). 32. Y. Kapulnick, C. M. Joseph, D. A. Phillips, Plant Physiol. 84, 1193 (1987). 33. K. Birkenhead, S. S. Manian, F. O'Gara, J. Bacaeriol. 170, 184 (1988). 34. H. J. Evans et al., in Nitrogen Fixation and CO2 Metabolism: A Steenbock Symposium in Honor of Robert H. Burris, P. W. Ludden and J. E. Burris, Eds. (Elscvier, New York, 1985); pp. 3-11. 35. K. Minamisawa, in Nitrogen Fixation: 100 Years After, H. Bothe, F. J. de Bruijin, W. E. Newton, Eds. (Fischer, Stuttgart, Federal Republic of Getmany, 1988), p. 586. 36. J. E. Beringer and M. J. Bale, in The Release of Genetically Engineered Microorganisms, M. Sussman, C. H. Collins, F. A. Skinner, D. E. Stewart-Tull, Eds. (Academic Press, San Diego, CA, 1988), pp. 29-46; D. N. Dowling and W. J. Broughton, Annu. Rev. Microbiol. 40, 131 (1986); A. L. M. Hodgson and G. Stacey, Crit. Rev, Biotechnol. 4, 1 (1986). 37. E. W. Triplet and T. M. Barta, Plant Physiol. 85, 335 (1987). 38. F. J. Mondello, J. Bacteriology 17, 1725 (1989); R. Unterman et al., in Environmen- tal Biotechnology: Reducing Risks from Environmental Chemicals Through Biotechnology, (Plenum, New York, 1988), pp. 253-269; L. Wender, Ed., Bioprocess Technol. 11, 3 (1989); A. R. Harker, R H. Olsen, R. J. Seidler, J. Bacteriol. 171, 314 (1989); R. J. Kolenc, W. E. Inniss, B. R. Glick, C. W. Robinson, C. I. Marfield, App. Environ. Microbiol. 54, 638 (1988). 39. M. D. Lee et al., CRC Crit. Rev. Environ. Control 18, 29 (1988); R. M. Atlas, Petroleum Microbiology (Macmillian, New York, 1984). 40. J. E. McCarthy and M. E. A. Reisch, Hazardous Waste Fact Book (U.S. Congress, Congressional Research Servzce, Washington, DC, 1987); U.S. Congress, Office of Technology Assessment, Are We Cleaning Up? Ten Superfund Case Studies, a special report on OTA assessment on superfund (U.S. Congress Printing Office, Washington, DC, 1988). 41. D. D. Focht, in Environmental Biotechnology Reducing Risks from Environmental Chemicals, G. S. Omenn, Ed. (Plenum Press, New York, 1988), pp. 15-29; K. N. Timmis, F. Rojo, J. L. Ramos, ibid., pp. 61-79; P. J. Chapman, ibid., pp. 81-95; P. Adriaens and D. D. Focht, ibid., p. 442. 1306 42. Office ofTechnology Assessment, New Developments in Biotechnology, vol. 4, U.S. Investment in Biotechnology (U.S. Congress Printing Office, Washington, DC, 1988). 43. J. L. Ramos and K. N. Timmis, Microbial. Sci. 4, 228 (1987); A. J. Weightman and J. H. Slatcr, in Miaoo~Qanisms in Action: Concepts and Applications in Microbial Ecology, J. M. Lynch and J. E. Hobbie, Eds. (Blackwell Scientific, Oxford, 1988), pp. 322- 347; J. F. Quensen and F. Matsumura, in Treatment of Pesticide Wastes (American Chemical Society, Washington, DC, 1984), pp. 327-341. 44. J. L. Ramos, A. Wasserfallen, K. Rose, K. N. Tinunis, Science 235, 593 (1987); J. L. Ramos, A. Stolz, W. Rcineke, K. N. Timmis, Proc. Natl. Acad. Sci. U.S.A. 83, 8467 (1986); P. R. Lehrbach et al. J. Bacteriol. 158, 1025 (1984); I. Bartels, H.-J. Knackmuss, W. Reineke, .9pp. Environ. Microbiol. 47, 500 (1984). 45. A. M. Chakrabartv, D. A. Friello, L. N. Bopp, Proc. Nad. Acad. Sci. U.S.A. 15, 3109 (1978); General Electric Company, U.S. Patents 72-260563, 72- 0607,260,488 (1974). 46. B. D. Ensley et al., Science 222, 167 (1983); K. Furukawa and H. Suzuki, Appl. Microbiol. Biotechnol. 29, 363 (1988); N. Mermod, S. Harayama, K. N. Timtnis, Bio/Technology 4, 321 (1986). 47. J. L. Glick, Ener,qy Technology, 9th Energy Technology Conference, R. F. Hill, Ed. (Government Institutes, Washington, DC, 1982), pp. 1470-1474; H. W. Stokes, S. K. Picataggio, D. E. Eveleigh, Adv. Sol. Energy, 1, 113 (1983); Biotechnology Newswatch (McGraw-Hill, New York, August 1988), p. 2; P. F. Stanburg and A. Whitaker, Eds., Principles of Fermentation Technology (Pergamon Press, New York, 1984), pp. 1-9. 48. S. E. Buchloz, M. M. Dooley, D. E. Eveleigh, J. lnd. Microbiol. 4, 19 (1989); N. Misawa, T. Okamoto, K. Nakamura, J. Biotechnol. 7, 167 (1988). 49. A. D. Neale, R. K. Scopes, J. M. Keey, App. Microbial. Biotechnol. 29, 162 (1988); L. O. Ingram, T. Conway, D. P. Clark, G. W. Sewell, J. F. Preston, Appl. Environ. Microbiol. 53, 2420 (1987); J. S. Tolan and R. K. Finn, ibid., p. 2039. 50. S. Fukusumi, A. Kamizono, S. Horinouchi, T. Beppu, Eur. J. Biochern. 174, 15 (1988); I. C. Kim et al., KareanJ. AppJ. Microbiol. Bioeng. 16, 369 (1988); P. Oriel and A. Schwacha, Enzyme Miaob. Technol. 10, 42 (1988); L. Wender, Ed., Bioprocess. Techrtol. 11, 2 (1989); H. Liao, T. McKenzie, R. Hageman, Proc. Nail. Acad. Sa. U.S.A. 83, 576 (1986). 51. A. A. Nicolaidis, J. Chem. Technol. Biotechnol. 38, 167 (1987); D. E. Rawlings, in Biotechnology in Minerals and Metals Processing, B. J. Scheiner, F. M. Doyle, S. K. Kawatra, Eds. (Cushing-Mallow, Ann Arbor, MI, 1989), pp. 3-8. 52. D. E. Rawlings and D. R. Woods, U.S. Patent 4 748 118 (1988); L. Wender, Ed., Bioprocess. Technol. 11, 1(1989); R. S. Ramesar, D. R. Woods, D. I:. Rawlings, J. Gen. Microbiol. 134, 1141 (1988). 53. B. E. Rittman, Basic Life Sa. 28,215 (1987); M. Sezgin, D. Jenkins, D. Parker, J. Water Polut. Control Fed. 50, 362 (1978). 54. A. J. Sinskey, D. D. Easson, Jr., C. Rha, European Product Number 287576 (1988), and U.S. Patent 891136 (1986); D. D. Easson, Jr., O. P. Peoples, A. J. Sinskey, Industrial Polysaccharides: Genetic Engineering Structure/Propeny Relations and Applications, M. Yalpani, Ed. (Elsevier, Amsterdam, 1987), pp. 57-65. 55. C. Khosla and J. E. Bailey, Mol. Gen. Genet. 214, 158 (1988); Nature 331, 633 (1988). 56. F. M. Romeyer et al., J. Biotechnol. 8, 207 (1988). 57. C. E. Furlong et al., in Environmental Biotechnology: Reducing Risks from Environmental Chemicals Through Biotechnology (Plenum, New York, 1988), pp. 271-280. 58. J. M. Tiedje et al., Ecology, in press; M. Sussman, C. H. Collins, F. A. Skinner, D. E. Stewart-Tull, Eds., The Release of Genetically Engineered Microorganisms (Academic Press, London, 1988); H. O. Halvorson, D. Pramer, M. Rogul, Eds., Engineered Organisms in the Environment: Scientific Issues (American Society for Microbiology, Washington, DC, 1985). 59. L. Simonsen and B. R. Levin, Trends Biotechnol. 6, 527 (1988); P. J. Regal, ibid., p. 536; S. A. La* ibid., p. 547; Committee on the Introduction of Genetically Engineered Organisms into the Environment, Introduction of Recombinant DNA- Engineered Organisms into the Environment: Key Issues (National Academy Press, Washington, DC, 1987); U.S. Congress, Office ofTechnology Assessment, New Developments in Biotechnology-Field-Testing Engineered Organisms: Genetic and Ecological Issues (Government Printing Office, Washington, DC, 1988). 60. B. P. Ager, Trends Biotechnol. 6, S42 (1988). 61. D. T. Kingsbuty, ibid., p. S39; F. Betz, A. Rispin, W. Schneider, in Biotechnology in Agricultural Chemistry, H. M. LeBaron, R. O. Mumma, R. C. Honeycutt, J. H. Duesing, Eds. (American Chemical Society, Washington, DC, 1987), pp. 316- 327. 62. D. A. Jones, M. H. Ryder, B. G. Clare, S. K. Farrand, A. Kerr, Mol. Gen. Genet. 212, 207 (1988); W. E. Holben, J. K. Jansson, B. K. Cheim, J. M. Tiedje, .4ppl. Envrion. Microbiol. 54, 703 (1988); J. S. Shim, S. K. Farrand, A. Kerr, Phytopatholo- gy 77, 463 (1987). 63. R. J. Steffen and R. M. Atlas, App. Environ. Microbial. 54, 2185 (1988). 64. S. B. Levy and B. M. Marshall, in The Release of Genetically Engineered Micro- Organisms, M. Sussman, C. H. Collins, F. A. Skinner, D. E. Stewart-Tull, Eds. (Academic Press, London, 1988), pp. 61-76; J. L. Fox, Am. Soc. Microbial. News 65, 259 (1989). 65. R. Curtiss III, ibid., pp. 7-20. 66. A. K. Bej, M. H. Perlin, R. M. Atlas, Appl. Environ. Microbiol. 54, 2472 (1988). 67. S. T. Kellogg, D. K. Chatterjee, A. M. Chakrabarty, Science 214, 1133 (1981); J. J. Kilbane, D. K. Chatterjee, J. S. Karns, S. T. Kellogg, A. M. Chakrabarty, App. Environ. Microbial. 44, 72 (1982); D. Ghosal, I.-S. You, D. K. Chatterjee, A. M. Chakrabarty, Science 228, 135 (1985); J. S. Karnes, J. J. Kilbane, S. Duttagupta, A. M. Chakrabarty, App. Environ. Microbial. 46, 1176 (1983). 68. J. H. Slater and D. Lovatt, in Microbial Degradation of Organic Compounds, D. T. Gibson, Ed. (Dekker, New York, 1984), pp. 439-485. 69. L. Krockel and D. D. Focht, Appl. Environ. Microbiol. 53, 2470 (1987). 70. B. Nortemann, J. Baumgarten, H. G. Rast, H.-J. Knackmuss, Appl. Environ. Microbiol. 52, 1195 (1986); J. A. M. DeBont, M. J. A. W. Voragc, S. Ha,,,nanc, ,-, O476t.. 1n Ly U SCIENCE, VOL. 244 I
Page 128: brs52e00
dependent protein kinase can direct- ly activate normal Cl- channels in excised patches, whereas Cl- channels from CF patients that have the same outward rectifi- cation and single channel conductance fail to respond to the kinase (4, 5). This suggests that defective phosphorvlation may be re- sponsible for the lack of (3-adrenergic ago- nist stimulation of Cl- secretion in CF tissues. Epithelial Cl- secretions can also be regu- lated by cAMP-independent pathways. For example, both the Ca2+ ionophore A23187 and prostaglandin F2a stimulate Cl- secre- tion without inducing measurable changes in intracellular cAMP concentration (6). Furthermore, the phorbol ester phorbol 12- myristate 13-acetate (PMA), a protein ki- nase C (PKC) activator, also increases Cl- secretion without causing a rise in intracellu- lar cAMP, although the actual first messen- ger of PKC stimulation is not known (7, 8). We have used the patch-clamp technique to A Excised,-50 mV y 2 min after PKC, -50 mV ~ I %*~*44 4~0*1 20 s later, -b0 mV 1 min later, +50 mV ~ ~ S ..W'%* -. ~,, . *,..w, B Excised, -50 mV 100~ 2 pA 100 ms 2 min after PKA, -50 mV -' '~wr u',tn. 20 s later. -50 mV 1 min later, +50 mV 2 pA 100 ms Fig. 2. Activation of fetal epithelial Cl- channels by PKC and PKA. Excised membrane patches from human fetal tracheal cells were held at -50 mV for 2 min before PKC (A) or PKA (B) and cofactors, DiC$ (Serdarv, Ontario, Canada) and Mg-ATP (Sigma) for PKC and only Mg-ATP for PKA, were added to the solution facing the cytoplasmic side of the membrane. In six experi- ments, Walsh inhibitor peptide, a specific inhibi- tor for PKA, was added with PKC. Channel activitv was monitored for another 8 min. PKC and PKA were prepared as described (18). Final concentrations of chemicals and enzvmes were 1 mM ATP, 1 µM DiCa, 2 µM Walsh inhibitor, 10 nM PKC, and 50 nuV1 PKA. Arrows indicate the closed state. determine whether purified PKC and PKA can regulate C1- channels in normal adult and fetal airway epithelia (9) and whether regulation by both kinases is defective in CF patients. Excised patches of cell membrane from normal fetal and adult and CF adult airways displayed no channel activity until they were depolarized to between +50 and +120 mV (all voltages are referenced to a bath ground). Voltage-activated channels had an outwardly rectifying current-voltage (I-b~ relation with a reversal potential in asym- metrical solutions consistent with Cl- chan- nels (Fig. 1). The electrophvsiological prop- erties were identical to those reported previ- ously for secretory Cl- channels (3-5). Thus, fetal and adult airway cells contain the same type of secreton, Cl- channels. To determine whether secretorv Cl- channels are regulated by both PKC and PKA, we maintained excised patches first at -50 mV to avoid voltage activation. After an initial period of 2 min to verify the absence of spontaneous channel activity, PKC or PKA plus cofactors [adenosine tri- phosphate (ATP), and dioctanoylglycerol (the diacylglycerol analog DiC$)] was added to the bath. After channel activity was ob- served, the voltage was changed to values between + 5 0 and + 8 7 mV to verify that the kinase-activated channels were epithelial Cl- channels. No spontaneous channel activity was seen at negative voltages for at least 8 min with buffer containing only the cofac- tors (0/10); the presence of Cl- channels in these patches was verified by depolarization. In normal fetal and adult airway cells, Cl- channel activity was evoked within 7 min of the addition of PKC or PKA (Table 1 and Table 1. Protein kinase activation of Cl- chan- nels. PKA, 50 n,W; PKC, 10 mL4. Normal adult human epithelia include primary cultures of nasal scrapings and tracheal epithelial primart-• cultures. Fetal human tracheal cells were transformed with an origin of replication-defective SV40 plasmid (17). The adult CF group includes primary cul- tures of nasal polvps from two CF patients, and both primary and SV40-infected cultures of CF bronchial epithelia from one CF patient. Data are expressed as "number of patches activated by protein kinases/number of patches containing Cl- channels." In the adult CF cells, the presence of channels was confirmed by voltage activation. Experiments in which channels were not observed after kinase treatment and after depolarization were not included (ten with fetal cells, three with normal adult cells, and five in CF cells). Source PKA PKC PKA + PKC Fetal tracheal epithelia 6/7 7/8 Adult airway epithelia 3/3 Adult CF airway epithelia 0/9 0/7 0/3 Excised, -50 mV y +PKA and PKC, -50 mV for 8 min y Activation by +77 mV, then -50 mV +50 mV r*7 r _f2pA 100 ms Fig. 3. Failure of both PKC and PKA to activate a Cl- channel in a CF cell. The experimental conditions were as in Fig. 2. Fig. 2). The time courses of activation bv PKC and PKA were very similar. PKC did not activate Cl- channels (0/4) in the pres- ence of the PKC inhibitor staurosporine (10). Staurosporine by itself did not activate Cl- channels (0/3) or inhibit subsequent voltage activation. In contrast, PKC activat- ed channels in the presence of the Walsh PKA inhibitor (11). The concentration of the PKA inhibitor was sufficient to com- pletely block the activation of Cl- channels by PKA (0/3). Therefore, PKC and PKA can directly activate Cl- channels. The 1-V characteristics of PKC- and PKA-activated Cl- channels were identical to those activat- ed by depolarizing voltages (Fig. 1). To ascertain if PKC activation of CI- channels is defective in CF, we applied both PKC and PKA to patches of membrane excised from bronchus and nasal polyp cells from patients with CF. In CF cells, the catalytic subunit of PKA was not able to activate the channels, as has been reported (4, 5). In addition, we found that PKC alone or in combination with PKA failed to open channels in membrane patches from three different CF patients (Table 1 and Fig. 3). In these experiments, the presence of Cl- channels was verified by depolarization acti- vation (Fig. 3). Phosphorylation sites are present on sev- eral different types of ion channels and are important in channel regulation (12). For example, both PKA and PKC phosphorylate the nicotinic acetylcholine receptor (13) and the dihydropyridine receptor (14) of the Ca'-+ channel in skeletal muscle. Phospho- rylation by both kinases accelerates the rate of desensitization of the nicotinic receptor (13). In cardiac cells both L-type Ca`+ (15) and delayed rectifier K' channels (16) are activated by PKC and PKA phosphoryl- ation. PKA also activates epithelial Cl- channels (4, 5). Our work suggests the existence of either multiple phosphorylation sites or a single site that can be phosphory- 1352 SCIENCE, VOL. ?.¢4 20470"15201(i
Page 129: brs52e00
United States department of Agriculture Postdoctoral A . ,t , a Research Associates The Agricultural Research Service as the principal scientific research agency of USDA, conducts research to solve technical food and agricul- tural problems of broad scope and high national priority. The agency's work is carried out under six specific research objectives--conservation of national resources, crop production and protection, animal production and protection, human nutrition, postharvest research, and integration of management systems. Overall aim of ARS research is to ensure the continuation of an adequate supply of food and fiber of high quality to meet the needs of American people and for export. ARS is currently recruiting for 100 postdoctoral positions throughout the country. Oppor- tunities exist in many research areas, including:  Human Nutrition  Genetics  Immunology  Virology  Biochemistry  Chemistry  Microbiology  Animal Science  Entomology  Plant Physiology  Plant Pathology  Agronomy  Soil Science  Engineering gricu ur U25 Research Service Successful candidates will be hired under excepted appointments up to 2 years in duration. Salary for these GS-11/12 positions ($28,852 to. $34,580) will be based on qualifi- cations and experience. For written descriptions of positions- and application procedures, write to: N.L. Bakes Personnel Division (S) USDA/ARS/BARC-W Bldg. 003, Room 101 Beltsville, MD 20705 or call: Ms. Kim Carpenter (301) 344-2796 ARS is an Equal Opportunity Employer. Women and minorities are encouraged to apply. SCIENTISTS/SENIOR SCIENTISTS CELLULAR THERAPY CELS, Inc., an exciting new biotechnology com- pany is developing encapsulated cell and tissue transplants for treatment of human disease. Op- portunities exist in our research headquarters for: Biopolymer Scientists You will evaluate and develop novel biocom- patible polymers for the immunoprotection of cells and tissue when transplanted for treatment of human disease. Experience in biopolymer chemistry and the interaction of polymers with the human immune system required. Biomedical Engineering Qualified candidate will develop novel biomedical devices for the immunoprotection of cells and tissue for human transplantation. Experience in the engineering and development of relevant biomedical devices essential. Cell Biologist and Cell Isolation Scientist You will develop mammalian cell culturing and cell isolation technologies for therapeutic cellular trans lantati Ex a alian cell e ence m m mm on Immunologist Qualified candidate will evaluate the immunologi- caI responses to implanted polymer encapulation devices and work with chemists and engineers to develop new products. Experience in immunol- ogy, materials and their interactions required. Scientist positions require a PhD in the appropriate field. Senior scientist positions are available for individuals with related postdoctoral or industrial experience. CELS, Inc., based in the Providence, RI area offers competitive salaries, excellent benefits and equity participation. For immediate consideration, please send your resume, indicating position of interest to: DSE Confidential Reply Service, Dept. 138, 651 Gateway Blvd. #850, South San Francisco, CA 94080. CELS, Inc., is an equal opportunity employer. ~ ~ CELS ~C. , CII.LULAR Er~LnTED uv~G sYS~r~ts p . p n biology required. I
Page 130: brs52e00
OPPORfUNIIY AT CETUS IN PCR DIAGNOSTIC RESEARCH Cetus Corporation and Hoffman-LaRoche have established a joint effort to develop and commercialize in vitro human diagnostic products and services utilizing the most important new technology in the field of diag- nostics - Cetus' patented Polymerase Chain Reaction (PCR). PCR will facilitate rapid, sensitive and highly accurate diagnosis of such conditions as infectious diseases, genetic disorders and cancer. VIRRL INFECTTOUS DISEASES The spectrum of research will encompass the development of PCR-based assays for known viruses to deter- mine the clinical utility of highly sensitive detection of the pathogens of interest to a search for new viruses that may play a role in diseases of suspected viral etiology. In the study of persistent viruses, the identification of prognostic markers for specific disease susceptibility (primarily cancer) progression to disease development and severity of disease are of particular interest. GENE11C DISORDERS The focus of the research program will be the identification of genetic variation involved in common diseases such as cancers, autoimmune and cardiovascular diseases leading to the development of diagnostic tests using PCR. The clinical significance of variations in candidate genes, like oncogenes, tumor suppressor genes or immune system related loci will be explored. ASSOCIATE SCIENITST/ SCIENTIST/SR SCIEM'IST Qualifications: Ph.D and/or MD with specialty in biochemistry, biological sciences, microbiology, genetics or virology. One or more years of experi- ence in a relevant field is essential. Excellent written and verbal communication skills are required. Expe- rience in leading a research team is desirable for the scientist and senior scientist positions. Preference will be given to highly creative and excep- tionally productive investigators with demonstrated independent research experience with an interest in working in a collaborative environment applying PCR to the study of viral infectious diseases, genetic disorders, and cancer. RESEARCH ASSISTANT/ RESEARCH ASSOCIATE Quafficatioiw BS/MS in biological sciences or chem- istry with one or more years of relevant laboratory experience involving biochemistry, genetics, microbiology or virology. Cetus seeks several innovative research assistants and associates to join our departments of infectious diseases and human genetics. Individuals in these positions work with highly motivated scientists in a stimulating scientific research environment. POSIT)OCTORAL PosmoNs Quafifications Ph.D and/or MD with specialty in biochemistry, genetics, or virology. Extensive experi- ence in molecular biological techniques in general and nucleic acids specifically is preferred. Excellent written communication skills are essential. We expect the candidates selected for these positions to conduct independent research in the areas noted above. Additional opportunities include the study of the kinetic and enzymatic properties of thermostable polymerases. The individuals will be strongly encour- aged to describe their studies for major scientific jour- nals and at scientific meetings. Currently, a number of positions with two year appointments are available. We offer competitive salaries commensurate with your experience and education, an outstanding benefits package and a significant opportunity for career development. If you would like to contribute to the applica- tion of PCR to diagnostic research, please send your resume to Cetus Corporation, Box JS, 1400 Fifty-Third St., Emeryville, CA 94608. We are an Equal Opportunity Employer. c€tus ` woo
Page 131: brs52e00
TliF OENETICS ANQ MOLECULAR BIOLOGY OF ARABIDOPSIS Indiana Molecular Biology Symposium IV October 12-15, 1989 Presented by the Institute for Molecular and Cellular Biology at Indiana University Bloomington, Indiana A symposium devoted to recent developments in the genetics and molecular biology of Arabidopsis thaliana. Speakers include: Gerry Fink (Keynote Speaker) Chris Somerville Bill Ogren Mike Sussman Mike Thomashow Elliot Meyerowitz Ken Poff Harry Kiee Maarten Koornneef Ruth Finkelstein Eric Richards Fred Ausubel Pete Snustad Joe Ecker Robert Masterson JoAnne Chory Howard Goodman Ken Feldman Sponsored in part by the Indiana Corporation for Science and Technology, Eli Lilly and Company, Calgene Inc., E.l. DuPont De Nemours and Company, Agracetus, Monsanto Company, and GIBCO BRL Research Products, Life Technologies Inc. For information and application, write to: Director, Institute for Molecular and Cellular Biology, Jordan Hall 322A, Indiana University, Bloomington, Indiana 47405. INDIANA UNIVERSITY hlicroliter Dispensers High Speed, High Accuracy If you're dispensing microliter quantities of biologicals, reagents, siurries, suspensions, emulsions, viscous con- centrates, and other fluids, FMI's PiP dispensers can help. They feature: • Continuously adjustable output from 0 to 100 1,Ilshot • Reversible-for aspirating or back flushing your system • Valveless FMI RH Pump Heads • High speed-up to 600 shots/minute • High repeat accuracy-better than 1% • Easy operation- hand or foot actuated • Inert fluid contact a~~,l Sp~•tJl surfaces-ceramic and fiuorocarbon To find out how FMI will speed up your dispensing operations in the laboratory or on the production line, call or write for the complete story MODELS PIPO & PIPi AVAIi-ABLE FROM STOCK =525 CALL TOLL-FREE 800-223-3388 • " IN NY STATE ~• FLLAa METERING, INC. 51s-922-easo 29 ORCHARD ST, P.0. BOX 179, OYSiER BAY, MY 11771 TEO 5101001281 FAX 518-6248261 Circle No. 215 on Readers' Service Card NEW SCIENTIFIC PERSPECTIVES ' New in 1989 IM*T of Computing in Scien~e and Engin~ering New in 1989 Journal of X Ray Science and Technology MANAGING EDITOR Peter Deuflhard Kuurad Zuse Center, Berlin Federal Republic oj'Genrtativ Interdisciplinary in nature, this new journal focuses on articles from the areas of mathematical and scientific modeling, scientific computing, computer science, and scientific and engineering applications. Volume 1 (1989). 4 issues ISSN 0899-8248 In the U.S.A. and Canada: $80.00 All other countries: S92.00 EDITOR-IN-CHIEF Larry Knight Brighartt Yotr+:g U+ai,ersit.i Pruvu, Utair Designed to provide scientists and engineers with a single literature source covering new developments in the field of x-ray imaging and analysis techniques, this journal reports original research and timely reviews of the best technical and esthetic qualit-v. Volume 1 (1989), 2 issues ISSN 0895-3996 In the U.S.A. and Canada: $50 00 AII other cauntries: 556.00 Sample copies and onvileged personal rates are available upon request, For more rn7ormarion, please write or call: ACADEMIC PRESS, INC., Journal Promotion Department 1250 Sixth Avenue, San Diego, CA 92101, U.S.A. (619) 699-6742 All pnces are in U.S. dollars and are sul7jeCt to change without notice. New Biomedical and 1988 Environmental Sciences EDITORS Chen Chunming Chinese Acaderrry o} Prererrtire Medicine, Beiiirtg, China Frederick Coulston White Sands Research Center Almtrogorda. New Mexico MANAGING EDITOR Frank C. Lu L/iarrti, Flurida This international journal, with special emphasis on scientific data and information from China, publishes regular articles, review articles, and important reports dealing with biologic and toxic effects of chemicals, drugs, natural products, and physical agents on man, plants, and animals. Volume 2 (1989), 4 issues ISSN 0895-3988 In the U.S.A. and Canada: 5100.00 All other countries: $112.00 S9143 zz I 16 JUNE 1989 Circle No. 38 on Readers' Service Card t3^9
Page 132: brs52e00
i hancing activity and no neutralizing activity. The three sera selected (4) came from a guinea pig (gp) hvperimmunized with HIV 1SF128A from an HIV-1sF-infected chim- panzee (ch), and from a patient (h) with acquired immunodeficiency syndrome (AIDS). The enhancing titers of these sera ranged from 1:250 (ch and h) to 1:1250 (gp). Controls included normal sera (ch and h) or homologous serum obtained before immunization (gp). Different HN strains isolated in our laboratory, including macro- phage-tropic strains of HIV-1 and HrV-2 (7), were used in the enhancement assays (8-10). Initially we investigated whether the CD4 receptor, which has been considered a pri- mary site of HIV entry into the cell, played a role in enhancement. We used Leu3a, a monoclonal antibody (MAb) against CD4a (anti-CD4a), and soluble recombinant CD4 (srCD4), which effectively inhibit HIV in- fection by preventing virus attachment to Table 1. ADE of HN-1 and HIV-2 infectivity in macrophages. Monocytes were isolated from PBMC by adherence onto a polystyrene plate and incubated in RPMI 1640 medium containing 10% fetal calf serum and 5% blood group- matched, heat-inactivated human serum. Adher- ent monocytes were kept in culture for 10 to 12 days before infection to ensure full differentiation into macrophages (4). Cells isolated in this way were _ 95% positive for LeuM3 staining. After washing and trypsinization, 5 x 103 macrophages were infected with 100 µl of HIV-1 or HIV-2 culture supematants (RT activity was = 106 cpm/ ml) that had been incubated 1:1 (vol/vol) with enhancing or control serum (1:20) for 1 hour at room temperature (4). The gp serum came from an animal hyperimmunized with HIV-lsF, (for- merly ARV-2), the ch serum from an animal infected with HIV-1sF2, and the h serum from a patient with AIDS. These sera had no neutraliz- ing activity. Cultures were incubated for 2 hours at 37°C, washed with Hanks buffer, and resus- pended in appropriate medium. HIV production was monitored by measurement of RT activity at 3-day intervals (9). Results represent the peak RT activity measured 12 to 15 days after infection (8). In the presence of normal serum, RT activity never increased over the levels shown here for HIV-lsF2~ (molecular clone of HIV-1sF-2) (18), HIV-1sF33, HIV-2uc2, or HIV-2uC3 (7). A rep- resentative of two experiments giving similar re- sults is shown. Vi RT activity ( x 10' cpm/ml) rus strain Control serum Enhancing serum Source HIV-1 SF2c 9.4 111.6 gP SF33 4.3 164.4 ch SF128A 426.8 1465.5 gP HIV-2 UCI 293.1 2131.4* gp UC2 3.6 298.3 h UC3 102.8 420.2 ch *HIV-2ucl, a macrophagc-tropic isolate (19), reached high le~~cLs of RT aco~Yty onlY 12 days after i.nfection in the presence of enhancing serum. 1358 the cell surface (11). Controls included the anti-CD3 MAb OKT3 and the anti-macro- phage MAb LeuM3. The presence of Leu3a prevented the infection of both purified CD4+ lymphocytes and macrophages in the presence of control sera (Fig. 1A). It had no effect, however, when the virus had been incubated with enhancing sera before infec- tion, even when up to 50 µg per 105 cells was used. As expected, treatment of cells with OKT3 or Leu1123 did not have any significant effect on infection in the presence of either the enhancing or a nonenhancing neutralizing serum (Fig. 1A). Furthermore, the addition of srCD4 at up to 50 µg per 106 peripheral blood mononuclear cells (PBMC) was not able to inhibit serum enhancement of HIV-1 infection (Fig. 1B), even though this concentration completely abolished HIV infectivity in the presence of control serum. The reduced level of reverse transcriptase (RT) activity observed at day 3 after infection with 50 µg of srCD4 (Fig. 1B) represents a delay in virus production and probably reflects the effect of srCD4 on residual free virus that is not bound to enhancing antibodies. Three days later, this culture reached high levels of RT activity, whereas the culture-receiving virus that was incubated with control serum remained neg- ative. Similar results were obtained with two different strains of HIV-1 as well as HIV-2 in both types of blocking experiments (Leu3a and srCD4) (10). Finally, we tested CD4- human fibroblastoid cells for their ability to support enhancement of HIV in- fection. These cells do not express CD4 on their surface and do not contain a detectable amount of CD4 mRNA (12). However, after cocultivation with highly susceptible lymphoblastoid cells, both viral antigen pro- duction (>0.5 ng/ml) and cytopathology occurred only in cultures that had been infected in the presence of enhancing sera (13). All of these results indicate that the CD4 protein does not mediate ADE ofHTV infectivity. In studying further the role of the Fc receptors (FcRs) in this process, we at- tempted to block ADE of HIV infection of macrophages by treating these cells with antibodies known to bind and block the function of each human FcR. Three FcRs (FcRI, FcRII, and FcRIII) have been iden- tified on human leukocytes (14). They are glycoproteins of 72,000, 40,000, and 50,000 to 70,000 3Tr, respectively, and they can all bind IgG immune complexes or aggregates. However, only FcRI can bind monomeric IgG. FcRI is found on mono- cytes and macrophages and has been shown to be involved in ADCC, possibly in con- nection with interferon gamma (14). We used RPC-5, the product of a murine IgG2a myeloma, to bind and block the funcrion of FcRI. When used at high concentrations, RPC-5 serves as an appropriate ligand to saturate the binding sites of FcRI (6). FcRII is a polymorphic receptor found on mono- cytes, neutrophils, eosinophils, B cells, and platelets. FcRII mediates the monocvte-de- pendent mitogenic response of T cells and may serve as a target for natural killer (NK) cell activity (14). These properties can be blocked by MAb IV.3 of the IgG2b sub- class. Finally, FcRIII, also termed CD16, has been identified on neutrophils, eosino- phils, NK cells, and differentiated macro- phages and appears to be mainly responsible for the clearance of immune complexes through phagocytosis (6). MAb 3G8, an IgGl, binds human FcRIII and inhibits attachment and phagocytosis of IgG-coated red blood cells by macrophages (6, 14). In addition to these antibodies, we used MOPC-21, a murine IgG1 myeloma anti- 200 1 A 100 c 0 gGi aFcRl aFcRll aFcRlll Leu3a+ Leu3a + aFcRl II IgG1 gG1 aFcRl aFcRll aFcRlll Leu3a+ Leu3a+ aFcRlll IgGi Fig. 2. The effect of FcR blockage on ADE of HIV-1 and HIV-2 infection of macrophages. Isolation of macrophages and enhancement ex- periments were as described in legends to Table 1 and Fig. lA, except that anti-FcR, control anti- bodies, and Leu3a were used at a concentration of 5 µg per 5 x 105 cells. (A) HIV-1sFi2sA (100 TCIDso per milliliter) or (B) HIV-2ucr fluid (5 x 10' cpm/ml) were used in these experiments with the chiunpanzee and the human serum, re- spectively (diluted 1: 20), and the normal control sera ( L• 20). Results represent peak RT activirv of culture supernatants (8, 9) measured between day 15 and 18 (A) or day 12 (B) after infection. RPC- 5(Litton Bionetics) was used to block FcRI, anti- FcRII MAb was MAb IV.3 (14), anti-FcR.III MAb was MAb 3G8, and IgG1 was MOPC-21 (6). The RPC-5 antibody used at the concentra- tions given saturates the binding sites of FcRI. A representative experiment of two different experi- ments is shown. Closed bars, enhancing serum; hatched bars, control serum. 20470-52022 SCIENCE, VOL. 24-1•
Page 133: brs52e00
storage H©sures ti~a~o -Put on andA-M ~ You asfaedfbr ~saiilh~t 1~e ~enetl.__ „~ 1~0+_I tOqc~`mC sizes~E~lus gridua-. >n-s ori: recetvers-and upperss for easy measurement, because you asked for it._ You asked fnr easy mtificatlon. We tistened. So now, Nalgene Filter Units are'i" , or-coded by membrane material-- and the pore size and membrane material are marked right on. the collars. ;le No. 201 on Readers' Service Card aige Company, 1987 C tlz are ca~ly to ~ for=~tato?c=# icity, and.atl-units are guaranteed erite.-S6 vou w,on't introduce anv ariables whatsaeyer inta:your work. Nalgene Filterware :;_F . the name you've trusted for 20 years. Your Ideas are built right [rt; Available from Authorized Nalgene Labware dealers worldwide. Or write or call: 4 Nalgene Labware Dept., Nalge Company, Subidiar of Sbron Cor Box 20365 s ., , y y p Rochester, NY 14602-0365 Telephone (716) 586-8800 Telex 97-8242. ; NaIgccqnpiy Nalgene Brand Products The ability to listen. The technology to respond. 1la d'rdct'.f:.dbah =pfa5ticsy~u~ve , on. YQu,get piisi rTg"standa-F c~~nWcf . ' from Nalge,because alt rvtaterials
Page 134: brs52e00
Science Writer Oncogene Science, Inc., a biotechnology company located on the North Shore of Long isiand, is expanding its discovery research programs in the appli- cation of oncogene technology to diagnostic and therapeutic product development. We are currently seeking qualified candidates for the posrtion of SCIENCE WRITER who will be responsible for the writing of grants, patent applicat;ions and project planning reports. Qualified candidates will have a Ph.D. in the bioioa+cal sciences and proven writing skills. Oncogene Science, Inc. offers an excellent compensation and benefits packageFor considera- tion, please send your resume including references and salary history to: Personnel Admin- istrator. Oncogene Science, Inc., 350 Community Drive, Manhasset, NY 11030. An Equal Opportunity Employer. Oncogene Scienc~e~j±~ ST. JOHN'S UNMVERSITY New York Department of Biological Sciences Postdoctoral Research Associate - A position is available immediately to study signal transduction in Aspergillus nidulans. The research will involve cloning and disruption of the gene for a calmodulin-dependent protein kinase (Proc. Nat. Acad. Sci. 85, 3279). Expe- rience in molecular and microbiological research is desirable. Salary and bene- fits are competitive. Please send a curriculum vitae and names of three references to: Dr. Diana Bartelt, De- partment of Biological Sciences, St. John's Uni- versity, Grand Central & Utopia Parkways, Jamaica, NY 11439. St. John's Uni- versity is an equal opportu- nity employer- NI/F. INSTITUTE OF NATURAL RESOURCES AND ENVIRONMENT DIVISION OF ATMOSPHERIC RESEARCH, MELBOURNE, AUSTRALIA CLIMATE CHANGE RESEARCH PROGRAM (Greenhouse Research) RESEARCH SCIENTISTS/SENIOR RESEARCH SCIENTISTS OR PRINCIPAL RESEARCH SCIENTISTS/SENIOR PRINCIPAL RESEARCH SCIENTISTS (CLIMATE DYNAMICS, OCEAN MODELLING, APPLIED CLIMATOLOGY, ATMOSPHERIC CHEMISTRY) $A32,045 TO $A62,396 PER ANNUM The Australian Government has recently made available funds for an enhanced research effort designed to substantially improve climate change forecasting in the Australian region. The research effort is comprehensive, with a core activity involving the development of an Australian Climate Model by the CSIRO Division of Atmospheric Research and the Australian Bureau of Meteorology. THE DIVISION: The Division of Atmospheric Research has a staff of 120 including 70 professional scientists and undertakes research into physical, chemical and dynamic aspects of atmospheric phenomena and related areas. THE PROGRAM: The Division of Atmospheric Research has an existing commitment to the study of climate change, with special emphasis on the greenhouse effect. Applications are called for a number of positions to join that team in a major research effort aimed at the development of the BMRC general circulation model for regional climate-change forecasting. The central model development is to be strongly integrated into a CSIRO Institute-wide program involving scientists from other Divisions of the Institute of Natural Resources and Environment (Fisheries, Environmental Mechanics, Oceanography, Water Resources, and Wildlife and Ecology), as well as with the Division's activities in trace gas studies, drought research and climate-change assessment. DYNAMICAL METEOROLOGIST (NUMERICAL MODELLER) THREE POSITIONS - NOS. AT8901, AT8902,AT8903 To undertake research into 1) Global Atmospheric General Circulation Models and cloud and or radiation schemes, 2) Limited Area Atmospheric Circulation Models, and 3) Global Atmospheric General Circulation Models and aspects of tropical meteorology convective adjustment and the hydrological cycle. DYNAMICAL OCEANOGRAPHER (NUMERICAL MODELLER) TWO POSITIONS - NOS. AT8904, AT8905 To undertake research into the development of oceanic models and/or the coupling of existing atmospheric and oceanic models. APPLIED CLIMATOLOGIST POSITION NO. AT8906 To undertake research into the assessment of regional climate change primarily from results of general circulation models, but with consideration of past climatological data. Interaction with both users of climate-change predictions and modellers to improve the utility of modelling results will be a feature of the position. ATMOSPHERIC CHEMIST POSITION NO. AT8907 To undertake research and development of techniques for the measurement of trace gases in the atmosphere. This will include oversight of a major laboratory upgrade and will involve research on surface properties leading to improved gas storage containers, and analysis of contemporary and historic air samples and scientific interpretation of the results. Applicants should possess a Ph.D degree or equivalent in the physical sciences, meteorology, or the atmospheric sciences, and preferably some experience appropriate to the particular positions available. Conditions: Appointment will be indefinite or fixed term depending on the mutual agreement of the applicant and CSIRO. Australian Government superannuation benefits will be available. MORE INFORMATION: Prospective applicants are invited to contact the INRE Climate Change Program Coordinator, Dr Graeme Pearman on (03) 586 7650 (Int. +61 3), Fax (03) 586 7600 (Int. +61 3), Telex AA34463, or Omnet G. Pearman, who can provide further details of the program, copy of relevant duty statements and selection criteria. APPLICATIONS: Applications should be related to the selection criteria. They should provide details of relevant qualifications and experience and also nominate at least two professional referees. Applications quoting the relevant reference number should be submitted by 30 June,1989,to: The Chief CSIRO Division of Atmospheric Research Private Bag No.1 Mordialloc. Vic. 3195. CSIRO IS AN EQUAL OPPORTUNITY EMPLOYER r
Page 135: brs52e00
body, to control for nonspecific binding of MAb 3Cs8. MOPC-21, RPC-5, and MAb IV.3 at up to 25 pg per culture (-5 X 105 cells) were not able to block enhancement of HIV in macrophages (Fig. 2). The addition of Leu3a MAb did not change these results (10). In contrast, treatment with anti- FcRIII MAb 3G8 efficientlv blocked the enhancement of both HIV-1 and HIV-2 infection of macrophages (Fig. 2). Because the infectious dose of HIV-2 was greater than that of HIV- 1, some HIV-2 replication but no enhancement occurred in the pres- ence of the anti-FcRIII MAb alone. Never- theless, the addition of Leu3a MAb to the anti-FcRIII MAb completely eliminated HW-1 and HIV-2 replication in the pres- ence of either enhancing or control serum. Because the presence of Leu3a alone did not reduce enhancement, this observation sup- ports the conclusion that free virus as well as antibody-complexed virus account for infec- tivity in the presence of enhancing antibod- ies. Finally, the addition of the control IgGl MOPC-21 to Leu3a had no effect on en- hancement. This finding excludes the possi- bilitv that MAb 3G8 blocked ADE of HIV by attachment of its own Fc portion to the Fc receptor. The fluctuating level of virus replication observed in the control cultures treated with FcR MAbs (Fig. 2A) showed no reproducible pattern in repeat experi- ments. This variation-as well as the in- creased level of HIV-2 replication in anti- FcRIII-treated cells compared to the other treatment groups (Fig. 2B)-may represent different activating effects of the antibodies on the cells. In any case, the difference in virus enhancement observed between treat- ment groups was consistent in repeat experi- ments, independent of the level of virus replication. These results strongly implicate this epitope of FcRIII/CD16 as critical for HIV enhancement. The presence of FcRs on T cells has been reported (15), but it is not clear which recep- tor is present and which cell subset expresses it. When we examined monocyte-depleted CD4+ cells for expression of FcRIII/CD 16 by fluorescence-activated cell sorting (FACS), we found that less than 5% of them were positive with either Leull (an NK cell marker) or 3G8 MAb. When the experiment in Fig. 1 was repeated with this cell population, no blocking of HIV-1 enhancement was ob- served with any of the antibodies to FcR, including anti-FcRIII MAb 3G8 (Fig. 3). Nevertheless, normal human immunoglob- ulin aggregates, but not free IgG, inhibited this enhancement. This block was most effec- tive in the presence of Leu3a (Fig. 3). The Leu3a was used to prevent infection by free HW. This observation suggests that HIV .. 750 E E a M 100 0 x 50 0 =;lF~lli ~~ Or v v"j aU a ~ a Fig. 3. The effect of FcR antibodies, IgG, and IgG aggregates on ADE of HIV infection of CD4' lymphocytes. Isolation, treatment, and in- fection of monocyte-depleted CD4+ cells were conducted as described in Fig. 1 and as described for macrophages in Fig. 2. IgG aggregates were prepared from concentrated HIV-negative human IgG (Gamastan, Cutter Labs, Berkeley, Califor- nia) bv heating at 60°C for 10 min. Large aggre- gates were removed by centrifugation at 10,000g for 10 min. IgG aggregates were used at 25 µg per lOs cells. Antibody concentrations were 5 µg per 105 cells, and no difference in results was observed at 25 µg per 10' cells. The SF128A strain of HN-1 and the human enhancing serum were used in these experiments. Results represent RT activity of culture supernatants at day 9 after infection (8, 9). A representative of two different experiments is shown. Closed bars, enhancing serum; hatched bars, control serum. enhancement in CD4' lytnphocytes involves a receptor that binds immune complexes. Because the biochemical structure of FcRIII may vary substantially on different cells that express this receptor (6), conceivably MAbs 3G8 and Leull could not bind or block this receptor as expressed on CD4' lymphocytes. This possibility applies to other FcRs and their epitopes as well, but these results do not exclude that another unidentified FcR could also be responsible for ADE of HIV in these cells. Our findings establish that in the presence of enhancing antibodies, HIV can efficiently infect a cell independently of the CD4 pro- tein. We have shown that the FcRIII receptor mediates uptake of HIV-enhancing antibody complexes into human macrophages; this re- sult was not seen with CD4+ lymphoc} tes. Since Ig aggregates were effective in blocking enhancement in lymphocytes, it is thus likely that either a different epitope of FcRIII or another FcR mediates HIV enhancement in these cells. Finally, the receptor responsible fbr ADE of human fibroblastoid cell infection remains to be identified. The FcR MAbs used in this study may not represent all functional epitopes on these receptors, as more than one FcR on macro- phages or other cells could be involved in ADE of HIV infectivity. Indeed, FcRIII is not present on the U937 monocytic cell line that has been shown to support ADE of HIV infectivity (3, 5). This fact suggests that alternative Fc receptors may be used by viral:immune complexes, depending on the type of cells being infected by HN. Howev- er, the relevance to the in vivo situation of enhancing experiments performed on trans- formed cell lines remains to be established. Enhancing antibodies are likely to be found in many individuals as part of the immune response to HIV infection, even though such antibodies may be masked by the presence of neutralizing antibodies. Al- beit less frequently, we have identified sera with only enhancing activity (4, 16), and previously we had found that immune com- plexes precipitated from the serum of indi- viduals with AIDS or AIDS-related complex were infectious in culture (17). These obser- vations, and the fact that HIV enhancement represents an alternative infectious pathway independent of CD4, suggest that, from a therapeutic perspective, blocking of the CD4 binding sites on HIV may not suffice to reduce or stop virus spread. Blocking of relevant Fc receptors might also be required to prevent uptake of viral: immune complex- es by macrophages and other cells in vivo. In this regard, soluble FcRI1UCD16 might rep- resent a therapeutic approach worth evaluat- ing as a complement to soluble CD4 treat- ment. In any case, our results imply that enhancing antibodies can substantially con- tribute to the "underground" spread of the virus in vivo, can increase the tropism of some viral strains (Table 1), and might enhance an individual's susceptibility to HIV infection. The viral epitope or epitopes involved in this reaction appear to be conserved since the same sera enhanced several strains of both HW-1 and HIV-2 (Table 1). Therefore, the identifi- cation of the viral antigen or antigens eliciting the formation of such antibodies is critical for vaccine development. REFERENCES AND NOTES 1. R. A. Weiss et al., Namre 316, 60 (1985); M. Robert-Guroff et al., ibid., p. 72; D. D. Ho et al., J. Virol. 61, 2024 (1987); C. Cheng-Mayer et al., Proc. Natl. Acad, Sci. U.S.A. 85, 2815 (1988). 2. A. H. Rook et ai., J. Immunol. 138, 1064 (1987); K. Ljunggren et al., ibid. 139, 2263 (1987); E. A. Ojo- Amaize et al., ibid., p. 2458; R. S. Blumberg et al., J. Inject. Dis. 156, 878 (1987); D. H. Shepp et a/., ibid. 157, 1260 (1988). 3. W. E. Robinson, D. C. Montefiori, W. M. Mitchell, Biochern. Biophys. Res. Commun. 149, 693 (1987); Lancet i, 790 (1988). 4. J. Homsv, M. Tateno, J. A. Levy, Lancet i, 1285 (1988). 5. A. Takeda, C. U. Tuazon, F. A. Ennis, Snencc 242, 580 (1988). 6. S. B. Clarkson and P. O. Ory, J. Exp. Med. 167, 408 (1988). 7. J. A. Lerv and J. Shimabukuro, J. Infect. Dis, 152, 734 (1985); L. A. Evans et al., J. Immunol. 138, 3415 (1987); L. A. Evans and J. A. Levy, Biochim. Biophys. Acta, in press. 8. In these studies, enhancement was measured primar- ilv by the first peak of RT activity of culture supematants (9). For all experiments, peak RT activity was always from the same time points for enhanced versus control samples and was always I I 16 JUNE 1989 20"7652a REroRTS 1359 4 ti ~
Page 136: brs52e00
i CLI1tIICA~ SCIENTISTS Nelson Research, a wholly owned subsidiary of Ethyl Corporation situated on the campus of the University of California at Irvine, is a pharmaceutical research firm committed to the discovery and development of new drugs The company currently has openings for Clinical Scientists. Our recent acquisition by the Ethyl Corporation affords us the opportunity to expand our Clinical Development activities. As part of this expansion, we have the need for dynamic individuals to fill senior positions in Clinical Research. You will be responsible for planning the Clinical Development of new chemical entities in such diverse therapeutic areas as cardio• vascular, neurological and dermatological. The ideal candidate will hold an M.D. or a Ph.D. in physiology or pharmacology and will have a minimum of 2 years pharmaceutical experience or a demon• strated academic research achievement in a clinical facilitv. Excellent oral and written communication skills are essential. The position offers a rare challenge and unique opportunity for professional growth along with the chance to contribute to the overall success of a growing company. Velson Research offers a professional environment and competitive salary and benefits. Interested candidates may send their resumes and salary history to: Personnel Manager Nelson Research & Development Company 1001 Health Sciences Road West Irvine, CA 92715 Ethyl ~ An Equal Opportunity Employer DEPUTY DIRECTOR DIVISION OF EXTRAMURAL ACTIVITIES NATIONAL CANCER INSTITUTE NATIONAL INSTITUTES OF HEALTH The National Cancer Institute (NCI) is seeking candidates for the position of Deputy Director of the Division of Extramural Activities (DEA). This position is located in Bethesda, Maryland and is a permanent full-time position with a salary range of $68,700 to $76,400 per annum commensurate with qualifications. Additional salary incentives are available should a physician be selected for this position. The Deputy Director, DEA, along with the Director, is responsible for the day-to-day scientific management of the Division which conducts the scientific review and evaluation of grant and cooperative agreement applications and contract proposals in response to the programmatic initiatives of the NCI. The extramural research funded by the NCI supports a broad program of activities designed to increase knowledge of the causes, prevention, control, diagnosis and treatment of cancer with a total budget of approximately $600 million annually. Applicants for this Senior Executive Service position must have a doctoral level degree or equivalent in one of the biomedical sciences. Send Applications to. Ms. Dolores Guido, NCI BIdg.31 Rm. 3A19 9000 Rockville Pike Bethesda, MD 20892 For applications and a copy of the requirements, contact Ms. Guido, at NCI on (301)496-8182. Deadline for applications is s_ly 10_1989 p~PL 1 NST~ t= ~ ¢ O'O HEPV NCI IS AN EQUAL OPPORTUNITY EMPLOYER REGENERON Staff Scientists Postdoctoral Fellows Molecular Biology Neurobiology Regeneron seeks to apply recent advances in the understanding of neuronal growth and regeneration to the development of novel therapeutic products for degenerative and traumatic neurological disorders. Regeneron offers an exciting, collegial environment in which state-of-the-art molecular skills are brought to bear on outstanding problems in neurobiology and medicine. Key projects focus on the discovery, purification, and molecular cloning of novel neurotrophic growth factors, and on the assessment of their biological roles and therapeutic potentials using innovative cell culture methods and animal models. Present openings in Molecular and Cell Biology require skills in the areas of: • Protein Biochemistry • • Mammalian Expression Vectors • • In vitro Protein Synthesis • • Monoclonal Antibodies • • Transgenics • • Molecular Cloning • Positions in Neurobiology require strong background and expertise in the areas of: • CNS Development • • CNS Regeneration • • Models of Neuronal Disease • • Neurotrophic Factors • • Neuronal Cell Culture • Regeneron's modern facility is located on a 275- acre wooded campus in Westchester County, 20 miles north of Manhattan, near major universities and medical centers. Regeneron offers excellent compensation packages, including generous stock options. Suburban Westchester features attractive and affordable housing, outstanding public schools and recreational facilities, and ready access to the cultural and business centers of New York City. P/ease send your resume, in confidence, to: Ms. Carol Deaken, Regeneron, Suite 10, 777 Old Saw Mill River Rd, Tarrytown, NY 10591-6707. Regeneron is an equal opportunity employer, r
Page 137: brs52e00
How in the world can you discover subtte changes in genetic expression?~.. ...With PDI We can give you the answer. If you work with 2-D gels in the life sciences, then you need to know which proteins are being induced, repressed, phosphorylated and glycosylated. And you need to know when they are chang- ing. PDI can help. We've taken the empirical art of 2-D electrophoresis and made it a more precise science by creating the only total system of analytical gel services, software, and instruments to reduce biological infor- mation to useful, manageable data. We can quantify the changes in your cells and tissues. Whether you run 2-D or not, we can give you the answers you need to make dis- coveries. With PDI, you get the benefit of years of gel running experience linked to software devel- opment devoted to quantifying and That's How! Series""', does the tedious work and frees you for the creative and intuitive processes that lead to breakthroughs. That's the power of PDI; the power to illuminate, amplify. You no longer need to reinvent the wheel every time you run an experiment with hormones, growth factors, neurotransmitters, drugs. Proven in top labs and by over 90 publications. Don't take our word for it. Over 90 publications world-wide testify to the value of PDI's partnerships In applications such as: • Growth & development • Hormonal regulation • Genetic expression • Effects of toxins & drugs • Genomic sequencing reducing biological data to answers you can use. The marriage of2-DElectrophore- sis and computer-assisted analysis. Our instrument system, the Discovery with world's leading scien- tists. Clients from Cal Tech. Columbia University, The Pasteur Institute, The University of Penn., Harvard, and leading UCSF, pharmaceutical companies have used gel~ervices and/or The Discovery Senes from PDI. protein databdses inc. , 405 Oakwood Road, Huntington Station, NY 11746 (516) 673-3939, Fax: (516) 673-4502 Circle No. 124 on Readers' Service Card (1) 800-777-6834 Use the Power of The Discovery Series Our latest version of The Discovery Series17" is the most powerful, the most user-friendly and the most customer- proven system available anywhere for the systematic analysis of global changes occurring in biological systems. And it's more affordable than you think! As with all our services, you can buy or lease the entire system- or you may send your samples to us and use our system on a low-cost service basis. Either way, we give you the answers. You make the discoveries. Call or write for our latest "Product & Services Guide" shown here and for more ~ information. The Thrill of Discovery
Page 138: brs52e00
actrvatecy by dePolarizatioc. (,Fig. 2B and Table 2B). Addition of ATP and then PMA to a depolarization-activated Cl- channel (Fig. 2B) did not alter channel kinetics. However, on addition of PKC, the channel inactivated. In control patches not exposed to PKC, CI- channels remained in the acti- vated state for at least 10 min, indicating that inactivation was not a random event. When internal Ca'-+ was <10 nM, PKC, DiC8, and ATP did not inactivate depolar- ization-activated channels. However when we subsequently increased internal Ca2+ to > 10 µM in those same patches, channels inactivated. At an estimated Ca2+ concentration of 150 nM, we found variable effects of PKC, although it usually inactivated channels. In one series of experiments, depolarization failed to activate a channel in seven patches; in parallel controls, depolarization activated channels in two of four patches not exposed to PKC; PKC inactivated four depolariza- tion-activated channels; and PKC activated one channel that was subsequently inactivat- . ed by increasing Ca`+ to 10 µM In some cases inactivation in the presence of high Ca`, ,vas reversible (Fig. 2B). We were able to evaluate reversibility in 16 patches. In 12 of those 16 patches (6 from canine and 6 from normal human cells), removal of the phosphorylation solution resulted in reactivation (average time, 3 min). Reversibility of PKC-induced inacti- vation suggests that a membrane-associated phosphatase has access to the channel in the membrane patch. Each of three activators of PKC-PMA (100 nlVI), DiC8 (1 µg/ml), or diolein (40 µg/ml)-was able to support inactivation of channels (Table 2B). PKC partially purified from canine trachea (12) was also effective in four of seven cases. Inactivation required the combination of PKC, ATP, and PIMA or a diacvlglycerol; addition of one or of any two alone was insufficient (14). Complete chan- nel inactivation occurred an average of 196 ± 58 s (mean ± SEM) after addition of PKC, ATP, and PMA or a diacylglycerol. In many cases the kinetic properties of channels were altered 10 to 60 s after addition and before complete inactivation. The 1251- efflux studies (Fig. 1C) indicat- ed an interaction between the effects of PKA and PKC. To firrther address this issue, we first activated a Cl- channel by phosphorvl- ation with the catalytic subunit of PKA and ATP (Fig. 2C) (3) and then studied the effect of subsequent addition of PKC plus DiC8 at 1 µM Ca`+. In six patches, PKA activated Cl- channels (average time, 174 s) and subsequent addition of PKC plus DiC8 (n = 3) or PMA (n = 3) inacti- vated channels (average time, 108 s). Since regulation of Cl- channels by PKA is defective in CF (3, 4), we asked whether regulation by PKC was also abnormal. Nei- ther PMA nor cALMP increased 125I- efflux in intact CF cells (Fig. 1B). In excised patches, PKC at low Ca'-+ concentration failed to activate any channels even though patches did contain Cl- channels that could be activated by depolarization (Table 3A, compare with data from normal cells in Table 1). These results indicate that in CF, PKC fails to activate Cl- channels either in the cell or in cell-free membrane patches. At high Ca'`+ concentrations (1 µVl), the combination of PKC, PMA, and ATP inac- tivated CF C1- channels, as it had in normal cells (Table 3B, compare with results from normal cells in Table 2B). The effect of PKC Fig. 3. Model of Cl- chan- A B C nel regulation. Inner and ouc outer surfaces of the mem- a o N oi brane are indicated in (A). F Channel is defined as inacti- ~ ~ PO PO vated when the "gate" is a• er a- dosed (A and C) and acti- low(CaZ'7 ow[CaZ`] highlCaZ'1 vated when it is open (B) (2). The gate may involve Prca arcc PKP PKe different molecular steps. "Depol" refers to strong membrane depolarization (approximately + 100 to + 140 mV). At high Ca`' concentration, PKC may also phosphorvlate the low Ca`1 site. In this model and in the text, we refer to the channel as a single entity, but it may consist of multiple subunits and associated proteins. Table 2. Inactivation of Cl- channels by PKC. (A) Patches were excised, holding voltage was -40 mV, and membrane voltage was stepped to +40 mV for 2 s every 10 s. Purified PKC, PMA (100 nM), and ATP were applied as indicated. If no channel activated in 6 min, we applied strong depolarization (up to 140 mV). (B) Patches were excised, channels were activated by strong depolarizatnon (up to + 140 mV), then holding voltage was -40 mV, and membrane voltage was stepped to +40 mV for 2 s every 10 s. Purified PKC, ATP, DiCS, PMA, and diolein were then added as indicated. In (A) the number of channels activated in the two conditions was different (P < 0.001 by X` analysis). In (B) the number of channels inactivated in the control and the low CaZ+ groups were different from the other three groups (P < 0.001 by X'- analysis). Data are from 38 dog and 25 human cells. (A) Prevention of depolarization-induced activation Nn Intervention caZ+ patches channel Intervention • Depolarization activated Control PKC, PMA, ATP 1 µ.11 15 1 µM 12 0 12 1 0 3 11 (B) Inactivation of depolarization-activated channels Patches with Patches Intervention Ca` depolarization- activated channels with channels inactivated Control 1 µM 8 0 PKC, DiC8, ATP <10 nM 5 0 PKC, DiC8, ATP 1 µM 4 4 PKC, PMA, ATP 1 µM 15 12 PKC, diolein, ATP 1 µM 4 3 Table 3. Regulation of Cl- channels by PKC in CF cells. (A) Experiments performed as in Table 1. (B) Experiments performed as in Table 2B. (A) PKC activation of CF Cl- channels at low Ca`' concentration Patches with channel Inter- Z, Total activated during: Blank i ~ h atch on vent patc es Intervention Depolarization es p PKC, DiC8, ATP <10 n1w 13 0 8 5 (B) PKC inactivation of CF Cl- channels at high Ca`, concentration Patches with Patches Inter- CaZ+ depolarization-activated with channels vention channels inactivated PKC, PMA, 1 µM 9 6 ATP Patches with channel activated during 16 ItnvE 1989 c~ ~~,.y 6 52 01 9 REPORTS i355
Page 139: brs52e00
NEUROCHEMICALS FOR THE NEUROSCIENTIST NEW PRODUCTS i u HIV 1. ENVELOPE, REVERSE TRANSCRIPTASE AND CORE ANTIGENS .0. 4. ft* ft <- gp160 E- gp120 <-- p66 MicroGeneSys has what you've been looking for... highly purified, biologically active HIV-1 proteins. MicroGeneSys' recombinant HIV-1 proteins are: • Greater than 95% pure • Biologically active • Full-length and non-denatured • Glycosylated (gp160 and gp120) • Supplied in Tris-buffered saline; no carrier proteins or azides • Suitable for use in Western blot, ELISA, CD4 binding assays, functional studies or antisera generation • Packaged in I ml vials at 100 µg/ml For additional information, contact: MicroGeneSys BIOPHARMACEUTICALS - 400 Frontage Rd., West Haven, CT 06516 Toll-Free (800) 541-8315; in CT (203) 932-2010 For Research Use Only; Not for Use in Humans or Clinical Diagnostic Procedures. Circle No. 254 on Readers' Service Card (3-Adrenergic Blocking Agents PINDOBIND PINDOLOL Anticholinergic IPRATROPIUM cAMP Activator FORSKOLIN D, Agonist QUINPIROLE (LY-171555) Delta Opioid Antagonist NALTRINDOLE Dopamine Antagonists AMOXAPINE DOMPERIDONE lon Channel Modulators AMILORIDE, 5-(N,N- DIMETHYL) BENZAMIL GABA-B Antagonists 2-HYDROXYSACLOFEN PHACLOFEN 5HTs Antagonists KETANSERIN RITANSERINE PIRENPERONE Neurotoxins BMAA, L(-) QUINOLINIC ACID NMDA/Glycine/PCP Ligands 7-CHLOROKYNURENIC ACID 5-FLUOROINDOLE-2-CARBOXYLIC ACID HA-966 METAPHIT MK 801, (+) & (-) PCP TCP Opioid Analgesics FENTANYL CITRATE LOPERAMIDE PNMT Inhibitor LY 134,046 Research Biochemicals Incorporated 9 Erie Drive. Natick. MA 01760-1312. USA Tel: (508) 651-8151. FAX: (508) 655-1359 Telex: 510 601 5087 (RES 810 UQ) Circle No. 219 on Readers' Service Card The Reconstruction of Disturbed Arid Lands: An Ecological Approach Edited by Edith B. Allen, Systems Ecology Research Group, San Diego State University In recent years, ecological considerations have played an important role in the reconstruction of arid and semiarid lands that have been disturbed by grazing, fire, wood harvesting, drought, mining, or other causes. This book uses a multidisciplinary approach in discussing the structure and functioning of a variety of native and self-perpetuating ecosystems as well as the diverse methods used in the revegetation process. O ~ $38.50; AAAS members $30.80 (include membership number '~ from Science). 268 pp., 1988. AAAS Selected Symposium 109. C ~ Order from: Westview Press, Dept. AAAS, 5500 Central Avenue, Boulder, CO 80301. (Add $2.50 postage and handling for the first copy, 75 cents for each additional copy: allow 4-6 weeks for delivery.) Published by Westview Press for AAAS i
Page 140: brs52e00
Amgen, a leader in the research and development of novel protein therapeutics, is rapidly emerging as a fully-integrated biopharmaceutical company. We recognize that our future success depends upon providing continued support for our scientific staff in the development of new and challenging research programs. This support reflects Amgen's commitmentto providing an environment that encourages scientific excellence. Amgen's rapid growth is constantly creating opportunities for innovative and motivated Ph.D. scientists at both the Research Scientist and Postdoctoral level who wish to share Amgen s dedication to scientific excellence. The positions below are currently available. 1tESEARCI-I SCIENTISTS Candidates for all of the Research Scientist positions must have both an appropriate Ph.D. and 2-4 years' relevant Postdoctoral experience as indicated for the positions below: CELLULAR PHYSIOLOGY Dept. #347 Will apply mammalian cellular physiology and/or somatic cell genetics towards growth regulation and differentiation of animal cells. Experience with cul- turing various primary and established cell lines, cloning, sorting cells and selecting metabolic and drug resistant mutants is essential. PHARMACOLOGY Dept. #372 A strong background in whole animal research will be applied to one or more of the following areas: inflam- mation, wound repair, immunopharmacology, hema- tology and oncology. Proficiency in statistical analy- sis of data is essential. ANALYTICAL BIOCHEMISTRY Dept. #395 Will contribute to on-going methods development programs for the separation and analysis of proteins. Additional responsibilities will include the design, synthesis and evaluation of chemical bonded silica based phases for HPLC protein separations. PROTEIN DELIVERY Dept. #343 Will develop new concepts for enhancing delivery of proteins and peptides and the design of pharmaceu- tical formulations to improve sustained release and drug bioavailability. Extensive experience in the IN VIVO evaluation of pharmaceutical formulations and background in Physiology, Biophysics, Pharmaceu- tics or related fields is essential. PROTEIN FORMULATION Dept. #344 Responsibilities will include the physical and chemi- cal characterization of bioactive proteins'peptides in solution along with bioanalytical method develop- ment and design including evaluation of new con- trolled release formulations for enhancing protein bioavailability. MOLECULAR AND CELLULAR BIOLOGY Dept. #112 Exploratory research in the molecular and cellular biology of one of the following disciplines: neuro- biology, lipid metabolism, bone formation, soft tissue regeneration, hematology, endocrinology or immuno- modulators. Experience in cDNA cloning and gene expression as it relates to these positions is desirable. POSTDOCTORAL SCIENTISTS Candidates for all of the Postdoctoral positions must have a Ph.D. in a discipline relevant to the following positions: GROWTH FACTORS: MOLECULAR AND CELLULAR BIOLOGY Dept. #392 Will conduct studies on the effects of growth factors on a variety of mammalian cell lines. Knowledge of cell physiology and experience with recombinant DNA techniques is essential. INFLAMMATION AND HOST DEFENSE MECHANISMS Dept. #375 Will examine the influence of colony stimulating factors and lymphokines on the regulation of phagocytic cell function and the inflammatory response. Must be proficient in statistical analysis and familiar with both IN VIVO and IN VITRO studies. EXPERIMENTAL HEMATOPOIESIS Dept. #334 Will participate in the characterization, cloning and expression of hematopoietic growth factors. Experience in bone marrow and tissue culture and a variety of colony forming assays is essential. Amgen offers an excellent compensation and benefits package as well as the unique opportunity to contribute to the development of significant new human pharmaceuticals on the cutting edge of biotechnology. If you have the necessary qualifications and would like to be a part of a company that places a high priority on its human resources, please send a resume, in confidence, to: AMGEN, INC. Recruitment, (Specify Dept. #) 1900 Oak Terrace Lane Thousand Oaks CA 91320 Equal opportunity Emptoyer AMGBI r MAKING BIOTECHNOLOGY WORK
Page 141: brs52e00
single exposure to MK-801 (1.0 mg/kg sc) and became increasingly more conspicuous at 4, 8, and 12 hours. However, in the interval from 18 to 24 hours, the reaction subsided and the morphology of most neu- rons, as evaluated by light microscopy, ap- peared to have returned to normal. We next evaluated the effects of repeated exposure to PCP and MK-801. Rats were treated with MK-801 daily for 4 days at 0.3 mg/kg sc and then killed, and the brains were evaluated by light microscopy 4 hours after treatment on day 4. The brains of animals subjected to this treatment regimen displayed no morphological changes. When a gradually increasing dose schedule (0.2, 0.4, 0.6, and 0.8 mg/kg sc) was used and treatments were spaced 12 hours apart, no cytopathology was seen 4 hours after the last treatment. When rats were treated daily with MK-801 for 4 days with higher or more steeply increasing dose schedules (0.25, 0.5, 0.75, and 1.0, or 0.25, 0.5, 1.0, and 2.0 mg/kg sc on days 1, 2, 3, and 4, respectively) and the brains were examined 4 hours after the treatment on day 4, these brains dis- played the typical cytopathological changes that would be expected 4 hours after a single treatment, but there was no evidence (by light microscopy) of a cumulative effect or of the reaction progressing to an irreversible stage. A single treatment with MK-801 (0.5 mg/kg sc) followed by a day without drug, then renewed treatment (MK-801, 0.5 mg/kg sc) on day 3 resulted in the typical pathomorphological reaction 4 hours after the treatment on day 3. Experiments of similar design were conducted with PCP Flg. 1. (A) Electron micrograph depicting a large posterior cingulate cortical neuron from the brain of a normal untreated rat. The cytoplasm of this neuron contains many normal-appearing mitochondria, and there are no abnormal vacuoles (x7000). (B) A large posterior cingulate cortical neuron from a rat treated with PCP (5 mg/kg sc) 4 hours earlier. Very few normal mitochondria are evident in the cytoplasm but many vacuoles are present, some of which contain multiple small, round structures that appear to be remnants of mitochondria. The neuropil surrounding this neuron is well presen,ed, and there are many normal-appearing mitochondria in the neuropil components ( x 70Q0). (C) Numerous vacuole-containing large neurons in Iayers III and IV of the posterior cingulate cortex of a rat treated 4 hours earlier with IMK-801 (1 mg/kg sc). Smaller neurons in other layers (arrows) are free from vacuoles (x 200). and the same results were obtained, suggest- ing apparent tolerance. Rats treated with very high doses of 'ldK- 801 (5 or 10 mg/kg sc) and examined 24 to 48 hours later displayed vacuolar changes in cingulate and retrosplenial cortical neurons at both time intervals. Thus far, only light microscopic evaluation of changes at these high doses has been performed. On the basis of a relatively comprehen- sive, although not exhaustive, light micro- scopic evaluation of the brains of rats treated with PCP or MK-801 to determine how many CNS neuronal populations are suscep- tible to the apparent toxic effects of these agents, we believe that this action may be quite selective for specific neurons in the posterior cingulate and retrosplenial corti- ces. The affected neurons are medium to large in size and multipolar or pyramidal in shape and are located in cortical layers III and IV (Fig. 1C). To further clarifv the role of PCP recep- tors, we tested two other PCP receptor ligands, tiletamine and ketamine. Both agents are anesthetics used in veterinary medicine, and ketamine is used in human anesthesia (15). Each drug was administered in aqueous solution (12) as a single dose (1, 5, 10, and 20 mg/kg sc for tiletamine and 5, 10, 20, and 40 mg/kg sc for ketamine) to adult rats (n = 6 per treatment group). Ex- amination of the brains 4 hours later re- vealed vacuole formation in cingulate and retrosplenial cerebrocortical neurons after tiletamine treatment at 10 and 20 mg/kg and ketamine treatment only at 40 mg/kg. Low- er doses of either drug were not associated with cerebrocortical pathological changes. Our findings suggest that PCP and the related compounds MK-801, tiletamine, and ketamine induce a pathomorphological reaction in the majority of inedium- to large- sized neurons in layers III and IV of the posterior cingulate and retrosplenial corti- ces. The order of potencies with which these agents induced this effect (MK-801 > PCP > tiletamine > ketamine) is the same as their order of affinities for binding to the PCP receptor (4, 6) and for their order of potencies in antagonizing either the excit- atory (4, 6) or neurotoxic (5, 7) actions of Ni1fDA. For example, in the isolated chick embryo retina, the concentration of antago- nist required to totally prevent the toxic action of 80 µM NMDA is 0.1, 0.5, 2.0, and 5.0 µM, respectively, for MK-801, PCP, tiletamine, and ketamine (16). Many ligands for the PCP receptor also bind to the sigma opiate receptor; however, they do so with an order of affinities opposite to the above, and MK-801, the most potent PCP receptor ligand known, has very little afFinity for the sigma binding site (6). Moreover, the 16 JiJNE 1989 REPORTS 1361
Page 142: brs52e00
POSTDOCTORAL FELLOW CELL BIOLOGY Burroughs Wellcome Co., a progressive pharmaceutical company with a top reputation for research, has a postdoc- toral position available in the Division of Cell Biology with Naji Sahyoun, M.D., to study: Caz,/calmodulin-dependent protein kinases and tyrosine kinases in synaptosomes and growth cones Work involves multidisciplinary techniques in biochemis- try, immunochemistry and molecular biology. Ph.D. or M.D. with training in biochemistry/molecular biology or cell biology required. Familiarity with recombinant DNA techniques will be helpful. Candidates should have no more than two years of experience beyond the granting of their Ph.D. or M.D. degree. This Postdoctoral Fellow will initially be appointed for up to two years with renewal for a third year upon the mutual agreement of the employee and the Company. Burroughs Wellcome Co. offers top benefits programs along with very competitive salaries, If you are interested in this postdoctoral position, submit your curriculum vitae by August 16, 1989 to: Burroughs Wellcome Co., Scient'lf'ic Recruiting and Staffing, Position #61168-4, 3030 Cornwal- lis Road, Research Triangle Park, NC 27709. Wellcome BURROUGHS WELLCOME CO. An Equal Opportunity Employer Genetics Institute is a company known for its innovative ap- proach to the scientific research, development and manufacture of human therapeutic agents.. including fibrinolytic and clot- ting factors, bone morphogenic factors and hematopoietic growth factors. The successful application of a sound business strategy in the development of our company enhances our strength and promising future in biotechnology. Research Associates Several openings exist to join our Molecular and Cellular Genetics and Fibrinolysis Groups. These positions would be responsible for the characterization of cell lines. Ideal candidates will have a BS/MS in the life sciences and solid cell culture and tissue cul- ture experience. Molecular Immunology/ Mammalian Gene Expression We are acticely recruiting for an individual to join our discov- ery research group studying native and recombinant im- munoglobins intended for therapeutic purpos•es. The ideal candidate will have a BS/MS in the life sciences and experience in mammalian cell expression. protein characterization and im- munological assay development. A background in recombinant DNA is also beneficial but not a prerequisite for the position. V'e offer a stimulating and dynamic work environment plus an excellent salary and comprehensive benefits package, Interested candidates should forward a resume, in confi- dence, to Susan Fletcher, Genetics Institute, 87 Cambridge- Park Drive, Cambridge, MA 02140. An Equal Opportunity Employer H/F/F{/V Genetics Institute Research Associates • • • • • • • • • • • • • • • • • • • • . • s . s:y • • t COR Therapeutics, Inc. • Peptide Biochem~- is a recently estab• experience in purification an growing biotechnology company located in South San Francisco. We specialize in the development of novel therapeutics for cardio• vascular disease. We are actively recruiting lished and rapidly characterization of peptideg natural sources, • Molecular BiologlF-- experience in expression of natlve, chimeric, and mutant proteins. • Protein Biochemistry- experience in purification, fractiona- tion, and characterization of proteinss highly qualified Research • Cell Culture- Associates in the following areas: expenence in establishing primary cultures of human celis. Preference for experience with vascular cells and isolation of human neutroohils and monocytes. These positions offer the opportunity to study basic mechanisms of receptor ligand interactions and to use this information to design therapeutic agents effective in the treatment of several types of cardio- vascular disease, Preference will be given to individuals with prior research and/or laboratory experience. COR Therapeutics, Inc, offers com- petitive salaries. benefits and attractive equity positions to its employees, combined with the challenge and opportunity to make a significant contribution to this new organization. To apply, please send resume to. Human Resources, COR Therapeutics. Ina. 256 East Grand Avenue, Suite 80, South San Francisco, CA 94080. ECE COR Therapeutics, Inc. THE SCIENCE RECRUITMENT "FOUR DAY CLOSE" NOW YOU CAN SEE YOUR AD IN SO E.rE FOUR DAYS AFTER SUBMISSION Scientific Recruiters can now advertise positions almost as soon as the need arises. Instead of reserving space a month or more in advance, you can now place your ad four days before the magazine mailing date. ticit:Nct: is mailed on the cover date. Film (right-reading, emulsion face down) or full camera ready art and insertion order must reach: Scit:,wF:, Short Close Desk, 1515 Broadway, New York, NY 10036 by NOON Mondays (except for legal holidays when material must reach New York by Noon Fridays). Because space is limited, the four-day close page will be reserved on a first-come, first-served basis, at a 15% premium. 1/4 and 1/2 page ads only. Now you don't have to wait to find the researchers you need immediately, nor must you advertise in a Sunday paper that pans a lot of sand, but not much gold. Scientific employers know that Srit:vre ads fill the job better. Now they fill it faster too. You can call it "INSTANT RECRUITMENT." For further information, telephone Ed. Keller, Recruitment Ad- vertising Manager, or Donna Rivera, Production Manager at Srir:Nct:: 212-730-1050, or write to: St•iFNcf;, 1515 Broadway, NY, NY 10036. CURRENT DISTRIBUTION 160,000 I
Page 143: brs52e00
I preliminary to allow conclusive statistical ( analysis. REFERENCBS AND NOTES 1. D. T. Burke, G. F. Carle, M. V. Olson, Science 236, 806 (1987). 2. J. Collins and B. Hohn, Proc. Natl. Acad. Sci. U.S.A. 75, 4242 (1978); P. F. R. Little and S. H. Cross, ibid. 82. 3159 (1985); P. Bates, Methods EnzymoJ. 153, 82 (1987). 3. D. Botstein and G. R. Fink, Scirnce 240, 1439 (1988). 4. S. Yoshitake, B. G. Schach, D. C. Foster, E. W. Davie, K. Kurachi, Biochemistry 24, 3736 (1985). 5. R. D. Ye, T.-C. Wun, J. E. Sadler, J. Biol. Chem. 262, 3718 (1987). 6. A. Coulson et al., Nature 335, 184 (1988). 7. R. D. Little et al., Proc. Nat1. Acad. Sci. U.S.A. 86, 1598 (1989). 8. D. T. Burke and M. V. Olson, in preparation. 9. The digests were fractionated on 0.8% agarose gels and transferred to nylon membranes for hybridiza- tion. The pure human samples contained 10 to 15 µg of DNA, whereas the pure yeast samples con- tained 0.1 to 0.2 µg; the mixed samples contained 10 to 15 µg of human and 0.1 to 0.2 µg of yeast DNA. Small differences in the electrophoretic mo- bilities of corresponding fragments detected in the human and yeast lanes of Fig. 3 are due to dif£er- ences in the amounts of DNA loaded in the two cases. Because of the 200-fold disparity in the sizes of the yeast and human genomes, 50 ng of YAC- containing yeast DNA gives a hybridization signal comparable to that obtained from 10 µg of human DNA. When 10 to 15 µg of human DNA are mixed with 0.1 to 0.2 µg of ycast DNA the electrophoretic mobilities of the hybridizing bands are identical to those observed in the pure human samples, but the intensities of bands that contain YAC-derived frag- ments are enhanced (lanes 2 and 4 of all panels). 10. Methods of producing YAC clones from Eco RI partial digests of high molecular weight human DNA are described elsewhere (1, 8). Clones that were ura', trp', and lacked ochre suppression were grown to saturation in 1-nil cultures in the rich medium YTD [F. Sherman, G. R. Fink, J. B. Hicks, Methods in Yeast Genetics (Cold Spring Harbor Labo- ratory, Cold Spring Harbor, NY, 1986), p. 163]. Samples were adjusted to a glycerol concentration of 20% and stored at -80°C in microtiter plates. A custom-fabricated, multiprong replicator was used to stamp the colony grids onto SUREBLOT nylon membranes (Oncor), which were then placed in contact with the ura- trp- medium AHC' [per liter: 1.7 g ofyeast nitrogen base (Difco 0335-15), 5 g of (NH.)ZSO;, 10 g of casein hydrolysate (U.S. Biochemicals 12852), 20 g of glucose, and 20 mg of adenine (pH 5.8)] and incubated at 30°C. Cells were converted to spheroplasts and lysed by sequen- tially placing the nylon filters in contact with a series of reagent-saturated paper filters. In the order of use, the reagents and treatment times were as fol- lows: lyticase mixture CDY [yeast lyric enzyme (2 mgiml) (ICN 152270, >70,000 U/g), 1.0M sorbi- tol, 0.1M sodium citrate, 0.05M EDTA, and 0.015M dithiothreitol (pH 7)], overnight; 10% SDS, 5'min; 0.5M NaOH, 10 min; 2X saline sodium citrate, pH 7, and 0.2M tris HCI, pH 7.5, three times for 5 min each. The lyticase reaction was carried out at 30°C, and the remaining treatments were at room temperature. Filters were air-dried. Labeling of probes, hybridization, and autoradiog- raphy were performed in accordance with standard methods [A. Feinberg and B. Vogelstein, Anal. Biochem. 132, 6 (1983); T. Maniatis, E. F. Fritsch, J. Sambrook, .blolecular Cloning (Cold Spring Harbor Laborator,v, Cold Spring Harbor, NY, 1982)]. 11. Methods of preparing high molecular weight yeast DNA in agarose plugs have been described [D. C. Schwartz and C. R. Cantor, Cell 37, 67 (1984); G. F. Carle and M. V. Olson, Methods Enzymol. 155, 468 (1987)]. For clectrophoresis, the contour- clamped homogeneous electric field system was used [G. Chu, D. Vollrath, R. W. Davis, Science 234, 1582 (1986)]. The electric ficld was 6.0 V/cm, the temperature 12' to 14'C, the running time 22 to 24 hours, and the running buffer was half-strength tris borate (Carle and Olson, above). For the gel in Fig. 2A- a ramped switching interval starting at 35 s and ending at 70 s was used, and for the gel in Fig. 2B, a constant switching interval of 70 s was used. The former conditions provide better resolution in the region most relevant for the analysis of typical YACs. The probe for factor IX w-as prepared by gel ptrrifyittg the 1.0-kb Eco RI-Hind III insert in a factor IX cDNA clone whose insert spans nucleo- tides 1-1029, as numbered by M. Jaye et al. [Nucleic Acids Res. 11, 2325 (1983)], and which recognizes all eight of the factor IX exons; the hybridization of this probe with Taq I-digested human DNA has been described [G. Camerino, M. G. Mattei, J. F. Mattei, M. Jaye, J. L. Mandel, Nature 306, 701 (1983)]. The probe for PAI-2 was prepared by gel purifyittg the 1.9-kb full-length cDNA fragment described in O~, which had been subcloned into the Eco RI site of pGEM-4. 12. We acknowledge R. Rothstein for providing an unpublished yeast colony-screening protocol. M. A. Hutchinson, P. Dang, S. C. Silver, and M. Lackey provided technical assistance. J. L. Mandel provided the factor IX cDNA clone and J. E. Sadler provided the PAI-2 cDNA clone. R. Waterston made helpful suggestions on the manuscript. Supported by a grant from the James S. McDonnell Foundation to the Center for Genetics in Medicine, Washington University, St. Louis, MO, and by NIH grant GM40606. G.A.S. was supported by a National Research Service Award (HD07271) from the Na- tional Institute of Child Health and Human Devel- opment. 5 January 1989; accepted 3 March 1989 C1- Channels in CF: Lack of Activation by Protein Kinase C and cAMP-Dependent Protein Kinase TzYH-CHANG HwANG, Luo Lu, PAMELA L. ZEITLIN, DIETER C. GRUENERT, RICf3ARD HUGANIR, WILLIAM B. GUGGINO* Secretory chloride channels can be activated by adenosine 3',5'-monophosphate (cAMP)-dependent protein kinase in normal airway epithelial cells but not in cells from individuals with cystic fibrosis (CF). In excised, inside-out patches of apical membrane of normal human airway cells and airway cells from three patients with CF, the chloride channels exhibited a characteristic outwardly rectifying current-voltage relation and depolarization-induced activation. Channels from normal tissues were activated by both cAMP-dependent protein kinase and protein kinase C. However, chloride channels from CF patients could not be activated by either kinase. Thus, gating of normal epithelial chloride channels is regulated by both cAMP-dependent protein kinase and protein kinase C, and regulation by both kinases is defective in CF. HE APICAL CL CONDUCTANCE OF Airway epithelia contain outwardly recti- airway epithelia controls transepithe- fying Cl- channels that are activated lial Cl- secretion. The magnitude of through cAMP-dependent pathways (3). Cl- secretion, which is regulated by several The purified catalytic subunit of cAMP- secretagogues, determines the quantity of respiratory tract fluid (1). The apical Cl- conductance of epithelia from patients with CF is abnormally low because of an inability of [3-adrenergic agonists to increase the magnitude of the apical Cl- conductance (2). This abnormality contributes to the T.-C. Hwang, L. Lu, P. L. Zeitlin, W. B. Guggino, Deparanent of Physiology, The Johns Hopkins Univer- sity, Baltimore, MD 21205. D. C. Gruenert, Cardiovascular Research Institute, Uni- versity of California, San Francisco, CA 94143. R. Huganir, Howard Hughes Medical Institute, and Department of Neuroscience, The Johns Hopkins Uni- versity, Baltimore, MD 21205. production of thick mucous in CF patients. *To whom correspondence should be addressed. Fig. 1. Current-voltage relations (I-V) of Cl- channels 6•0T I(PA) activated by PKC in normal human fetal tracheal cells and by depolarizing voltages both in adult normal and CF airway cells. The number of channels in a patch varied from one to four. Data were recorded by an EPC-7 patch-clamp amplifier (List Darmstadt, Federal Republic of Germany), filtered at 1 kHz (Frequency Devices, Haverhill, MA) digitized with a pulse-code modulator (Japanese Victor Corporation), and stored on video cassette recorder (Japanese Victor Corporation). Data were analyzed on a PDP 11/23 computer (Digital Equip- ment Corporation). The bath solution contained 150 mM NaCl, 2 mM MgCIZ, 1 m111 EGTA, 5 mM Hepes, and 0.5 mM CaCIZ (free Ca'-+ was 1.2 µM). The pipet contained 150 mM NaCI, 2 mM CaC12, and 5 mA4 Heocs. The pH of both solutions was adjusted to 7.3 -4.0' with tris base. With 300 mM Cl- in the bath, the reversal potential (15 mV) was close to that expected for the Cl- concentration gradient (16.7 mV). Graph was drawn by Sigmaplot Version 3.1 (Jandel Scientific). 9, human fetus; 0, human adult; F1, human CF. I 16 JUNE 1989 REPORTS 1351
Page 144: brs52e00
vese turns ia the a lielices discussed above, The reverse turns and loops in the proteins are generally exposed to the aqueous envi- ronment and are highly hydrated. Our pre- liminary analysis of the patterns of hydration of these loops and turns indicates that the water molecules again play an intimate role in directing the chain folding (17) and thus probably play a key role in driving protein folding. REFERENCES AND NOTES 1. C. B. Anfmsen, Science 181, 223 (1973). 2. P. E. Wright. H. J. Dyson, R. A. Lerner, Biochemis- try 27, 7167 (1988). 3. C. L. Tsou, ibid., p. 1809. 4. C. M. Venkatachalam. Biopolymers 6, 1425 (1968). 5. C. Ramakrishnan and G. N. Ramachandran, Biophys. J. 5, 909 (1965). 6. K. A. Satyshur et al., J. Biol. Chem. 263, 1628 (1988), and unpublished results. The large differ- ence in the interheGcal angles of the apo calcium- binding motifs (AB 139° and CD 149°) probably stems from the B helix being kinked by the presence of inserted water molecules. In contrast, the interhe- lical angles of the holo calcium-binding motifs (EF 113° and GH 113') are the same. 7. I. L. Karle, J. Flippen-Anderson, K. Uma, P. Ba- laram, Proc. .Natl. Acad. Sci. U.S.A. 85, 299 (1988). 8, F. C. Bernstein et al., J. .1-fol. Biol. 112, 535 (1977). 9. G. A. Jeffrev and J. Mitra, J. Am. Chem. Soc. 106, 5546 (1984); G. A. Jeffrey, in Landolt-Bomstein, vol. VIU1, Nucleic Ands, W. Saenger, Ed. (Springer Verlag, Berlin, in press); U. C. Singh and P. A. Kollman, J. Chem. Phys. 83, 4033 (1985). 10. T. L. Blundell, D. J. Barlow, N. Borkakoti, J. M. Thomton, Nature 306, 281 (1983). 11. J. L. Crawford, W. N. Lipscomb, C. G. Schellman, Proc. Nad. Acad. Sa. U.S.A. 70, 538 (1973). 12, The amino acid composition (in %) derived from the 26 inserted segments is: A, 16.15; G, 11.54; L, 5.38;I,5.38;V,3.08;F,2.31;Y,2.31;W,0.77;P, 0.77; S, 6.92; T, 4.62; C, 2.31; M, 3.85; E, 6.92; D,6.92;K,8.46;R,2.31;H,3.85;0,2.31;andN, 3.85. Abbreviations for the amino acid residues are: A. Ala; C, Cvs; D. Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lvs; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; 55', Trp: and Y, Tyr. 3BCL with three inserted segments, which has onlv the x-rav sequence„ and 3CTS with four inserted segments, whose sequence is unknown, were not induded in calculation. Of the total of 130 residues in the 26 segments, Ala occurred 21 times and Gly 15 times. Composition of Ala and Gly in the inserted segments exceeded that of a helix middle by 3 and 6.5%, respectively. 13. The amino acid composition of the helix termini and the helix middle were extracted from P. Y. Chou and G. E. Fasman [Adv. Enzymol. 47, 45 (1978)]. The helix tertnini include the three residues in either side of the helic boundaries and the a-helix middle excludes the three residues at the helix ends. The correlation coefficients given in the text were calcu- lated using the relation (Y,„ =~~„)=t(Y = Y~c, where Y represents the amino composition of the inserted segments and Y_ represents the expected composition for the helix middles or reverse turns. 14. H. J. Dyson, M. Rance, R. A. Houghten, P. E. Wright, R. A. Lemer, J. :b1o(. Bial. 201,201 (1988). These authors (ibid., p. 161) have also shown the presence of tvpe-II and tvpe-VI reverse turns in aqueous solution of a series of synthetic penta- and hexapeptide segments containing Pro and Glv by 'H nuclear magnetic resonance studies. This result was expected for such sequences but was initially ob- served in solution by these workers. We find that water-inserted a-helical se¢tnents do not favor the ty-pe-VI reverse tum. 15. S. S. Zimmerman and H. A. Scheraga, Proc. :Natl. Acad. Sci. U.S.A. 74, 4126 (1977). 16. P. S. Kim and R. L. Baldwin, Annu. Rev. Biochem. 51, 459 (1982). 17. M. Sundaralingam and Y. C. Sekharudu, unpub- lished results. 18. Supported by NIH grant AR-34139, the College of Agncultural and Life Sciences, and the University Graduate School. We dedicate this paper to G. A. Jeffrey, professor emeritus, Department of Crystal- lography, University of Pittsburgh. 7 December 1988; accepted 21 March 1989 Global Positioning System Measurements for Crustal Deformation: Precision and Accuracy WILLIAM H. PRESCOTT, JAMES L. DAVIS, JERRY L. SVARC Analysis of 27 repeated observations of Global Positioning System (GPS) position- difference vectors, up to 11 kilometers in length, indicates that the standard deviation of the measurements is 4 millicneters for the north component, 6 millimeters for the east component, and 10 to 20 millimeters for the vertical component. The uncertainty grows slowly with increasing vector length. At 225 kilometers, the standard deviation of the measurement is 6, 11, and 40 millimeters for the north, east, and up components, respectively. Measurements with GPS and Geodolite, an electromagnetic distance-measuring system, over distances of 10 to 40 kilometers agree within 0.2 part per million. Measurements with GPS and very long baseline interferometry of the 225- kilometer vector agree within 0.05 part per million. R ELATIVE MOTION OF THE MAJOR tectonic plates of the earth pro- duces crustal deformation along the plate margins. This deformation typically in- volves strain rates of 0.1 to 0.5 ppm/year (1). Since late in the 19th century [for example, (2)], our understanding of crustal deforma- tion has benefitted greatly from geodetic ob- servations. Until recentlv, studies of the defor- mation occurring in plate boundary zones relied on data from triangulation, trilatera- tion, and leveling. However, GPS surveying is rapidly becoming the preferred technique. In addition to providing a great deal of flexibility in selection of stations and a greater tolerance for adverse weather conditions and air quality than the older techniques, GPS provides a direct observation of three translation compo- nents and orientation. With land-based sur- veying, techniques must be combined in order to obtain all three translation compo- nents of station motion and the precision of the determination of the rotational part of the deformation is far below that of the other components. The abilitv to observe directly all translational components plus orientation between stations separated by any distance allows us to study plate defor- mation at broad scales over hundreds of kilometers as well as within a few meters in fault zones. Since late 1985, we have made repeated GPS measurements of the relative positions of stations in the western United States. In this report, we use this data set to examine the repeatibility of GPS vectors and to compare GPS measurements with those from other techniques. The heart of GPS is a set of satellites (currently 7 active, but eventually 21) orbit- ing the earth at an altitude of approximately 20,000 km. These satellites transmit on two L-band frequencies, LI at 1575.42 MHz and L, at 1227.60 MHz. Receivers record time-tagged pseudo-range and phase obser- vations (3) from Li, L2, or both. The signals broadcast by the satellites allow the user to determine the location of a single receiver with an accuracy of a few meters. For geo- detic applications, at least two receivers are required. The satellite signals are then used in differential processing to determine the relative position of the receivers with an uncertainty 10-3 times as small as the mea- surement obtained with a single receiver. The largest number of repeated observa- tions are measurements of the relative posi- tions of four stations in the vicinity of Parkfield, California (Fig. 1). Estimates of relative position were obtained from month- ly GPS measurements (4-10), the series extending from January 1986 to October 1988. In all of the solutions, the coordinates of station 10JDG were fixed (11), and coor- dinates of the other three stations relative to station 10JDG were determined for each set of observations. The secular trends in station movement (Fig. 2) indicate that there was significant motion only in the component of velocity parallel to the strike of the San Andreas fault (Table 1). Rates obtained with GPS are consistent with other esti- mates of the creep rate (12) in the Parkfield area. The vertical component of one obser- vation for station Joaquin is a clear outlier. We suspect that there was an error in the measurement of the antenna height. The variations about the best fitting straight line are of particular interest for assessing the precision of the observations U. S. Geological Survey, 345 Middlefield Road, Mail Stop 977, Menlo Park, CA 94025. t 16 JUNE 1989 2047REPORTS 1337 05200~
Page 145: brs52e00
sector as it abandoned the concept of health insurance as social insurance-the philoso- phy of a single rate for all members of the community. Though the 1960s may have offered a turning point in the way care was organized in America, Medicare followed the path of least resistance by accepting the prevailing reimbursement assumptions, greatly increasing expenditures and facilitat- ing capital expansion. In this sense, Medi- care made hospitals more "capitalistic" and weakened their nonprofit character. Hospi- tals became, as Stevens puts it, "merely- and clearly-vendors" (p. 298). The story unfolding since then is one of a continuing and frustrating effort to control cost, mounting federal regulation, and, most re- cently, the implementation of hospital pro- spective payment under the Medicare pro- gram. The shift of the American hospital away from charitable concerns, Stevens be- lieves, is largely a product of federal policy. "In their basic motivations and assumptions about the pay ethos, stratification, and in- come maximization, the voluntary hospitals have changed very little since the beginning of the century. But at issue now are funda- mental assumptions about 'charitable pur- pose' as an in-built, moral attribute of health care institutions" (p. 333). During the century, with advances in biomedical technology and surgery, the hos- pital increasingly came to occupy a central place in our vision of health care. Although never becoming the organizing core of for- mal regional systems of care, as some experts advocated, informally the hospitals became increasingly dominant and diversified in their patient care activities and responsibil- ities. Hospitals became part of larger health care centers, and in the past 20 years there has been extensive consolidation of institu- tions in both profit and nonprofit networks. Following Medicare, there was a great deal of money to be made by hospitals through generous reimbursement that included capi- tal costs. But as financial pressures became more acute, government efforts to ratchet down prices accelerated an already evident pattern of declining hospital admissions and lengths of stay. Within a relatively short time, a remarkable range of services have been shifted to ambulatory settings, contrib- uting to increased vacancy rates in many hospitals. As we move into the 1990s, hos- pitals seem less the focal point for organiz- ing care than in earlier decades, but existing reimbursement schemes, despite the intro- duction of diagnostic related groups, con- tinue to bias care in the direction of inpa- tient services and technical procedures. En- hancing function and quality of life among the chronically ill remain neglected chal- lenges. Stevens explores the dilemmas of the con- temporary hospital with insight. She recog- nizes that in our curious mix of private institutions, largely subsidized by public monies, we have constructed an expensive administrative infrastructure that makes our medical system the most highly regulated in the world. Noting the irony that the heavy hand of government has come under the guise of "private enterprise," she seems re- luctant to push her analysis to its logical conclusion. The federal government is de- picted as the heavy, having created the in- centives that pushed the voluntary hospitals off their charitable course. But the incentives that presumably perverted the hospital and medical care more generally were precisely those that hospitals and doctors insisted upon in return for their cooperation in the Medicare program. Stevens doesn't appear to assign blame in proportion to responsibil- iri'. Whatever the historical case, the fact is that our present medical care system, how- ever resilient, is diminished by large gaps in care, imbalance between curative efforts, re- habilitation, and prevention, and failure to impose financial discipline on physicians, hospitals, or other providers. It is extraordi- narily wasteful and increasingly weighted down by bureaucratic regulation. There is increasing dissatisfaction on the part not only of patients and health professionals but also of industry and government, who pay most of the costs. It seems an appropriate time to examine whether the many billions of dollars we spend to maintain the mirage of a private "voluntan"" sector represent a good investment. Stevens's carefully docu- mented volume, informed by deep and im- portant values, is an invaluable primer for undertaking this task. DAVID iV1ECHANIC Institute for Health, Health Care Policy, and Aging Research, Rutgers University, New Bnsnswick, NJ 08903 A Psychologist of the '20s Mechanical Man. John Broadus Watson and the Beginnings ofBehaviorism. KExttY W. BucIn,EY. Guilford, New York, 1989. \vi, 233 pp. + plates. $19.95. John B. Watson (1878-1958) became the first American "pop" psychologist in the 1920s by publishing a series of manifestos and self-help manuals that promoted his vision of a world perfected by behavioral engineering. He found an eager audience among fellow academics and the general public for his claims that the urban middle classes could gain personal peace and social order by following the prescriptions of tough-minded technocrats. Watson assured fellow academic psychologists that his ex- perimental method, for which he coined the term "behaviorism," would assure their ac- ceptance as natural scientists who could predict and control human action; he dedi- cated his widely read The Psychological Care of Ir fant and Child (1928) to "the first moth- er who brings up a happy child" and found frequent opportunities to attack housewives, marriage, the family, religion, and other old- fashioned institutions. Watson's legend is large among social scientists, for whom he stands as an advocate of a creative scientific reductionism that narrowed the subject mat- ter of psychology while expanding the possi- bilities of its application, and he probably had an impact upon the lives of thousands of children raised by parents who turned to Watson for advice before Benjamin Spock displaced him as the prominent source of store-bought directions for child-rearing. Despite his salience as a scientific and cultural icon, Watson's work, both as an experimental psychologist and as a popular- izer of science, does not read well today. His famous experiment with the infant Little Albert, which became a classic textbook example of the conditioned reflex, has been reexamined and found shoddy; Watson trained few students, and even those of his colleagues who were most sympathetic to his desire to bring objective methods to psychology found shallow his attempt to banish philosophy from science. Cultural historians point to the obvious misogamy and other nasty traits in Watson's popular writings, which reveal his deep cynicism, personal insecurity, and distrust of emotion- al intimacy. Watson's life was full of stark contrasts. His pioneering work in compara- tive animal psychology, which included the exemplary study of neurological develop- ment and learning in the white rat and his classic study of terns in the Dry Tortugas, earned him election as president of the American Psychological Association in 1915, at the age of 37, but he was dismissed from both The Johns Hopkins University and the New School for Social Research for sexual misconduct. His scientific reputation was built on a demanding commitment to an austere methodology, but he made a fortune as an advertising executive who de- vised enormously successful campaigns to sell cigarettes and toothpaste through cyni- cal manipulation of emotional insecurities, and he lived the life of a Connecticut society dandy. Kerry Buckley's Mechanical Man provides the first thoroughly researched biography of Watson. Although Watson destroyed most SCIENCE, VOL. 7s}¢ 1386 20470";5201108
Page 146: brs52e00
products in all, with more addedeveryweek. , and the skils essential ta applying them FisherBiotech sends our biotechriologiststo work wlthyaurhiotechnol Ists. p 11 Qbr81~'echtrol~ S lalists. the1ar9estdedicatedforcein thefleld,carry thebestcreden- tialsandspeakyourlanguage fluently. That promotes symbiosis, notjust sales. Rour s as it is yours. restdt Biotechnologyimpo ses unforgivinpstandards.So all FLsherBiotech suppliers undergo stringent product evaluations, and must meet or exceed our Quality Assu rance standards before we distribute their products. With nearly a century of man ufacturi ng highqualityreagents Fsher-. Bfotech knows howto assme consistent purity Our product ' assays and ourcustamers' results-soeakfor . themselves.. , The new products of symbiosis FisherBiotech introduces what you need by u nder- standing firsthand what you need to know. Your prob- lems stimulate our product development-thr instance: In non-radioactive pro6es.s new peptides...more efficie nt electrophoresis systems... new scintillation cocktaila.s a nd hlghe r yield cell cultures. amonyothers. ' Deftverysystems that " help you deliver results Instantaneouscomputeraed ordering. Express sh ipments from massive inventories. Fxpertanswers with one tell- free call. The convenience and economy of Fisher Scientific as the source for everything your lab needs. Fisher service letsyou spend less time ob- taining products. and more time using them productively. Symbiosis with Molecular Biology...Immunology...Electrophoresis... Cell Culture...Biochemicals Choose a supply house- or a symbiotic relationship. Supply houses sell to you, FsherBiotech works with you. The benefits will be as unique and mutual as the relationship Foradditional informatlon,contactyour , FisherBfotechnology Specialist or local Fisherl' Scientific Representative. ~
Page 147: brs52e00
Centrifuged gradient scanning When your resear so should your ii Primarily, the UA-5® is a sensitive absorbance detector for LC and HPLC. But if you're a life scientist, it's the key part of an integrated system, able to perform many functions in your lab. Accessories turn the UA-5 into a dual-beam fluorescence detector, a gel scanner, or a fractionator for centrifuged density gradients. You can even read samples in spectrophotometer-type cuvettes. But the UA-5 is still the best all-around LC detector. A selection of 18 wave- lengths means you can detect peptides at 214 nm, chlorophylls at 660 nm, and nearly everything else in between. A UA-5 gives you a built-in recorder, simultaneous monitoring of two columns or two wavelengths, automatic scale expansion, and a peak separator which controls a fraction collector to put each peak in its own tube. You can choose from 15 flow cells designed specifically for high flow LC. conventional LC, and HPLC down to a 0.12 µl volume micro- bore cell. ch expands, struments. A versatile UA-5 costs no more than a single- purpose detector, so it's not surprising that more than 10,000 scientists have bought them. Learn more about what a UA-5 can do for you-send for your catalog today. Isco, Inc., P.O. Box 5347, Lincoln, Nebraska68505, USA.Or dial toll free (800)228-4250(eYcept :NE. AK). Circle No. 229 on Readers' Service Card
Page 148: brs52e00
j actiact af several mitogens (2, 17), AZI may be implicated in fetal growth. In support of this possibility, All has been shown to act as a mitogen in cultured bovine adrenal cells (18) and to stimulate growth and induce the expression of c-myc and c fos in cultured smooth muscle cells (4, 5). In addition, injection ofAII in 18-day rat fetuses in utero caused a 20% increase in 3H-labeled amino acid incorporation into proteins in the skin, but not in the brain, measured 5 hours later (19). All may modulate growth through its effect on the calcium-phospholipid pathway directly or through the regulation of the expression of other growth factors or proto- oncogenes. The latter is supported by the finding that All causes an increase in PDGF mRI~JA in cultured smooth muscle cells (5). In addition, our findings on the ontogeny and localization of AII receptors are similar to those reported for insulin-like growth factor II in the rat fetus (20). Although the exact physiological function of AII in the fetus remains to be demonstrated, the prom- inent and transient expression of functional All receptors at unique sites in the fetus strongly suggests a role for AII in fetal development. REFERENCES AND NOTES 1. R. James and R A. Bradshaw, Armu. Rev. Biochem. 53, 259 (1984); M. B. Sporn and A. B. Roberts, Nature 332, 217 (1988). 2. C. J. Marshall, Cell 49, 723 (1987). 3. K. J. Catt, F. A. 0. Mendelsohn, M. A. Millan, G. Aguilera, J. Cardiovasc. Phannacol. 6, S575 (1984); R. N. Re. Arch, Intern. Med. 44, 2037 (1984). 4. A. A. T. Geisterfer, M. J. Peach, G. K. Chwens, Circ. Res. 62, 749 (1988); T. Kawahara et al., Biochem. Brophys. Res. Comman. 150, 52 (1988); M. B. Taubman et al., J. Biol. Chem. 264, 526 (1989). 5. A. J. Naftilan, R. E. Pratt, V. J. Dzau, Clin. Res. 36, 303A (1988). 6. C. Jones, M. A. Millan, F. Naftoli, G. Aguilera, Peptides, in press. 7. S. L. Skinner, E. R. Lumbers, E. M. Svmonds, Am. J. Obstet. Gynecol. 101, 529 (1968); B. M. Wilkes, E. Krim, P. F. Mento, Am. J. Physiol. 249, E366 (1985); H. U. Lee, D. J. Campbell, J. F. Habener, Endocrinology 121, 1335 (1987); G. M. Taylor, W. S. Peart, K. A. Porter, L. H. Zondek, T. ZondekJ. Hypertens 4, 121 (1986); T. Yasui, F. Alhent-Gelas, P. Corvol, J. Menard, J. Lab. Clin. Med. 104, 741 (1984). 8. M. .Llillan, G. Aguilera, P. C. Wynn, F. A. O. Mendekohn, K. J. Catt, Methods Enzymol. 124, 590 (1986). 9. M. A. Millan and G. Aguilera, unpublished data. 10. C. L. Hvde, G. Childs, L. M. Wahl, Z. Naor, K. J. Catt, Endocrinology 111, 1421 (1982); P. Tulkens. H. Beaufav, A. Trouet, J. Cell Biol. 63, 383 (1974), 11. M. J. Berridge and R. F. Irvine, Nature 312, 315 (1984). 12. A. Spat, J. Steroid Biochem. 29, 443 (1988). 13. K. J. Catt et al., ibid. 27, 915 (1987); J. R. William- son, R. H. Cooper, K. J. Suresh, A. P. Thomas, Cell Physiol. 17, C203 (1985); A. Capponi, D. Lew, :1-1. Vallotton, Biochem. J. 247, 335 (1987); S. J. Quinn, G. H. Williams, D. L. Tillotson, Proc. Natl. Acad. Sci. U.S.A. 85, 5754 (1988). 14. T. Balla, A. J. Baukal, G. Guillemette, K. J. Catt, J. Biol. Chem. 263, 4083 (1988). 15. S. K. Ambler and P. Taylor, ibid. 261, 5866 (1986). 16. G. Grvnkiewicz et al., ibid. 260, 3440 (1985). 17. M. J. Berridge, Biochem. J. 220, 345 (1984). 18. M. H. Simonian and G. N. Gill, Endocrinology 104, 588 (1979). 19. G. Aguilera, unpublished data. 20. A. L. Brown et al., J. Biol. Chem. 261, 13144 (1986); F. Beck, Development 101, 175 (1987). 27 December 1988; accepted 28 March 1989 Recombinant Gene Expression in Vivo Within Endothelial Cells of the Arterial Wall ELIZABETH G. NABEL, GRECTORY PLAUTZ, FREDERICK M. BOYCE, JAMES C. STANLEY, GARY J. NABEL A technique for the transfer of endothelial cells and expression of recombinant genes in vivo could allow the introduction of proteins of therapeutic value in the management of cardiovascular diseases. Porcine endothelial cells expressing recombinant (3-galacto- sidase from a murine amphotropic retroviral vector were introduced with a catheter into denuded iliofemoral arteries of syngeneic animals. Arterial segments explanted 2 to 4 weeks later contained endothelial cells expressing (3-galactosidase, an indication that they were successfully implanted on the vessel wall. R EDUCTIONS IN BLOOD FLOW TO the heart and other organs are often caused by fixed atherosclerotic ob- structions, which can become critical when accompanied by superimposed narrowings due to thrombus formation or vessel con- striction. Vascular endothelial cells contrib- ute to the pathogenesis of these lesions by (i) altering the thrombogenic properties of the vessel lumen (1), (ii) inducing smooth muscle cell proliferation (2), and (iii) regu- lating vascular smooth muscle tone (3). Ge- netically altered endothelial cells could trans- mit recombinant DNA products that would provide anticoagulant, vasodilatory, angio- E. G. Nabel, Cardiology Division, Department of Inter- nal Medicine, Universitv of Michigan Medical Center, Ann Arbor, MI 48109-0650. G. Plautz, F. M. Bovice, G. J. Nabel, Howard Hughes Medical Institute, Departments of Internal Medicine and Biological Chemistry, University of Michigan Medical Center, Ann Arbor, MI 48 1 09-06 5 0. J. C. Stanlee, Section of Vascular Surgery, Department of Surgetv, Universitv of Michigan Medical Center, Ann Arbor, MI 48109-0329. genic, or growth factors to a localized seg- ment of vessel. We show that endothelial cells can be stably implanted in situ on the arterial wall and express a recombinant marker protein, (3-galactosidase, in vivo. Because atherogenesis in swine has simi- larities to humans, we used an inbred pig strain, the Yucatan minipig (Charles River Laboratories), as an animal model (4). We established a primary endothelial cell line from the internal jugular vein of an 8- month-old female minipig and confirmed the endothelial cell identitv of this line (5), Two independent (3-galactosidase-express- ing endothelial cell lines were isolated (6) after they were infected with a murine am- photropic (3-galactosidase-transducing re- troviral vector (BAG), which is replication- defective and contains both (3-galactosidase and neomacin resistance genes (7). Endothelial cells derived from this inbred strain, being syngeneic, were applicable for study in more than one minipig, and were 1342 tested in nine different experimental sub- jects. The animals were anesthetized, the femoral and iliac arteries were exposed, and a catheter was introduced into the vessel through a small branch (Fig. 1). Intimal tissues of the arterial wall were denuded mechanicallv bv forceful passage of a partial- ly inflated balloon catheter within the vessel. The artery was rinsed with heparinized sa- line and incubated with a neutral protease dispase (50 U/ml), which removed any re- maining luminal endothelial cells. Residual enzyme was presumably inactivated by a2 globulin in plasma (8) on deflating the catheter balloons and allowing blood to flow through the vessel segment. The cul- tured endothelial cells, which expressed (3- galactosidase (Fig. 2, A and B), were intro- duced by means of a specially designed arterial catheter (C. R. Bard Inc., Billerica, MA) that contained two balloons and a central instillation port (Fig. 1). When these balloons were inflated, a protected space was created within the artery into which cells were instilled through the central port. These (3-galactosidase-expressing endotheli- al cells were allowed to incubate for 30 min to facilitate their attachment to the denuded vessel. The catheter was then removed, the arterial side branch ligated, and the incision closed. Labeling with 51Cr indicated that, of the 2 x 105 endothelial cells instilled in the central space, 2 to 11% successfully attached to the denuded arterial wall. Segments of experimental and control ar- teries were removed 2 to 4 weeks later. Staining of arterial specimens with X-gal chromagen revealed multiple areas of blue 204"1v520o6 SCIENCE, VOL. 244
Page 149: brs52e00
ETERINARY PATHOLOGIST We are an innovative and highly respected producer of prescription and over-the-counter drugs, located in DANBURY, CT. Due to expansion, the following position is available in the Department of Toxicology and Safety Assessment at our Research and Development Center. The candidate we seek should have a D.V.M. Degree and be ACVP Board Certified with 2 or more years experience in toxicologic pathology. Pharmaceutical experience is preferred, You will provide pathology support for the Toxicology, immunology and Pharmacology Departments, supervise and perform laboratory procedures, write and review protocols and reports and assist in the design and start-up of a modern histopathology laboratory. Additionally, you would serve as Toxicology Representative on inter- dlsciplinary research teams, function as study monitor for contract studies and participate in peer review of drug safety studies. BOEHRINGER INGELHEIM offers a competitive salary and benefits package, including relocation assistance and the opportunity to have your contributions recognized. If interested please send your C.VV to: Dept JC-1S-880, BOEHRINGER INGELHEIM PHARMACEUTICALS, Inc., 90 East Ridge, P.O. Box 368, Ridgefield, CT 06877, We are an equal opportunity employer m/f/h/v SENIOR AEROSOL PHYSICIST NSI Technology Services Corporation, a nationwide contract re- search and development firm, is seeking a Senior Aerosol Physicist to conduct research on the deposifion and clearance of aerosols in the lungs. Thesuccessfui candidate forthis position will be responsible for: • design and Implementation of an experimental program to study deposition of fluorescent and/or radioactive aerosols in hollow lung casts • collaboration with other scientists on experimental validation of theoretical models of particle deposition in bifurcating airways • collaboration with pulmonary physiologists to design and implement experimental studies of particle clearance from common laboratory rodents. Requirements include a Ph.D. or comparable experience in physics, aerosol sciences, mechanical engineering, or related field. A strong record of research and publications in the areaof lung deposition must be demonstrated. Salary is competitive and commensurate with experience. Qualified candidates should submit their resume, in- cluding salary history and requirements, in confidence, to: HUMAW RESOURCES ATTN: 04210-36 NSI TECHNOLOGY SERVICES CORPORATION ENVIRONMENTAL SCIENCES A Subridrary ot 61anTech intaeationat corporatmn P.O. Box 12313 Research Triangle Park. NC 27709 EOE E Genentech, Inc., a leader in the field of biotechnol- ogy, currently has the following opportunities available. Postdoctoral Researchers Genentech has added a dimension to our existing postdoctoral training program. This new program, administered by Dr. David Botstein, features opportu- nities for research and training across the whole spec- trum of Research and Development. A number of positions are currently available in this new program Genentech is committed to maintain a standard of ex- cellence that encourages creativity and provides per- sonal and professional growth. Many postdoctoral alumni have gone on to academic positions at major research universities, or have gone on to research positions in the biotechnology industry. We expect Genentech Postdoctoral Fellows to con- duct independent research in the areas of our scien- tific interests, publish in the leading scientific journals, attend and present their work at scientific confer- ences, and to maintain dose ties with the academic community. Dept. DB. Itesearch Assistants/ Associates Biochemistry/Molecular Biology Working on programs to discover new human pharmaceuticals, these positions offer a challenging opportunity to be a key team participant Typical requirements indude a BS/MS in Biochemis- try, Molecular Biology, Chemistry or dosely related scientific field. Candidates must have a minimum of 2 years' experience in one or more of the following areas: biochemistry techniques induding chromatog- raphy, electrophoresis, protein purification and char- acterization, cell/tissue culture, animal or cell models, and assay development; molecular and cell biology techniques induding DNA cloning, expression and sequencing. Dept. RA. Genentech, Inc. offers an excellent salary and bene- fits package coupled with the opportunity to make a signifirant contribution to our organization. For consideration, please send your resume indicating appropriate Department to Yvonne Davino, Human Resources, Genentech, Inc., 460 Point San Bruno Blvd., South San Francisco, CA 94080. We actively support and promote affirmative action and equal employment opportunity. Women and minorities are encouraged to apply. M n enenteche O~
Page 150: brs52e00
Immediate Openings for APPLIED ECOLOGISTS Will participate in long-term research and monitoring programs to evaluate the effects of energy related development on the endangered San Joaquin kit fox, giant kangaroo rat, blunt-nosed leopard lizard, and other species of concern in the San Joaquin Valley of California. Minimum requirements are a B.S. degree in biology, zoology, wildlife management, or related field with emphasis on vertebrate ecology, plus 2-4 years additional related experience. Applicants must have demonstrated ability to design, implement, manage and carry out research projects, synthesize data, and prepare written and scientific articles. Knowledge of environmental laws and regulations and experience in supervising scientific and technical staff and develop- ing new programs is desired. Work location is Bakersfield, California. Opening SB 89-14. Qualified candidates send resume with job opening to: EG&G Energy Measurements Santa Barbara Operations Attn: Technical Recruiting 130 Robin Hill Road Goleta, California 93117 Bioanatytical Chemist Syntex, an international health care company and a leader in its field, has an outstandin opportunity for a Bioanalytical ~hemist at our research headquarters on the San Francisco Peninsula. You will perform characterization of new drug substances, including peptides, proteins and novel organic compounds. Be prepared to correlate analytical parameters with biological activities as well as isolate and identify impurities and degradation products. You will support new drug applications by developing analytical methods and establishing quality criteria. State-of-the-art separation science skills are essential. Require- ments include a PhD in analytical/ physical chemistry or biochemistry and postdoctoral or industrial experi- ence in a related field. Syntex offers a competitive salary, benefits and relocation package in campus-like surroundin~s. If you have good communication skills and want to belong to a dynamic research team, please send your resume to: Syntex, Professional Staffing, Dept. KH/PAC, 3401 Hillview Ave., Palo Alto, CA 94304. An equal opportunity employer. We require a pre-employment physical examination which includes drug and alcohol screening. U.S. Citizenship Required. An Equal Opportunity Employer. ANhOUnCE1tENT FRANZ VOLHARD FELLOWSHIP The German Hvpertension League has created a new research fellowship, now available to scientists cur- rentlv involved in fundamental or clinical research. relevant to hvpertension. Basic criteria for the selec- tion are scientific merit and a detailed research proposal. Recipients will be selected on the vote of two independent experts bv the Scientific Committee of the German Hypertension League. Candidates from any country can work for 6 to 12 months in a laboratorv or hospital of their choice. This award is sponsored b} ESSEX PHARMA GmbH, ltunchen. The deadline for receipt of research proposals is 4ugust 31,1989. / n T~-IE ~ GERMAN HYPERTENSION LEaGUE _J Further details may be obtained from Deutsche Liga zur Bekampfung des hohen Blutdruckes e.V. c/o Prof. Dr. med. D. Klaus Pustfach 102010. D-6900 Heidelberg. FRG Reference: Franz Volhard Fellowship 0 ADVERTISEMENT SENIOR RESEARCH ASSOCIATE WASTE MANAGEMENT RESEARCH AND EDUCATION INSTITUTE THE UNIVERSITY OF TENNESSEE, KNOXVILLE The Waste Management Research and Education Institute, a state-sponsored "center of excellence" at The University of Tennessee, is seeking a qualified person to fill a senior research position specializing in environmental biotechnology policy. With internal and external funding of approximately $3 million annually, the Institute has specialized in: 1) research on public policy issues of waste management and environmental quality and 2) basic and applied research applying the tools of biotech- nology to environmental problems, in partnership with the university's Center for Environmental Biotechnology and in collaboration with Oak Ridge National Laboratory and industry. The person filling the senior research position will be required to have a Ph.D in science, engineering, or social science; be thoroughly knowledgeable about the science of modern environmental biotechnology and its' related policy issues; and have several years of relevant experience with a record of publication and scholarship. The position is full-time and the possibility of a joint appointment with an academic department can be explored. Salary is negotiable and competi- titve, and the starting date is negotiable. Senior and junior researchers in government, industry, and academia are encour- aged to apply. All inquiries and nominations should be ad- dressed to: Dr. William Colglazier and Dr. Gary Sayler, Co-chairs, Search Committee for Environmental Biotechnology Policy Posi- tion, Waste Management Research and Education Institute, The University of Tennessee, 327 South Stadium Hall, Knoxville, TN 37996-0710. Applicants should submit a current curriculum vitae. Review of applications will begin as soon as they are received. A~ ~ 1 3 UTK is an EEO/AA/Title /X/Section 504 Employer.
Page 151: brs52e00
. y ._.. . ..
Page 152: brs52e00
BO©k ReYIeWS Institutions of Health Care In Sickness and in Weaith. American Hospitals in the Twentieth Centurv. RosExARY STEvExs. Basic Books, New York, 1989. xii, 432 pp. $24.95. The American health care system is in deep trouble. Despite expenditures now reaching 5550 billion a year-approximately $2500 per capita-some 37 million persons remain uninsured and many more underin- sured. Notwithstanding extraordinary ad- vances in biomedical science and technolo- gy, our health indices lag behind those of many other Western nations, and we have yet to seriously address the growing prob- lems of long-term care for the elderly and for others with incapacitating chronic disease. Medical care costs continue to rise, affected only little by efforts to contain them over the past 25 years. A recent survey by Louis Harris and Associates in the United States, Canada, and the United Kingdom found Americans least satisfied with their health care system; 90% of U.S. respondents dis- agreed with the statement that "the health system works pretty well, and only minor changes are necessary to make it better" (R. J. Blendon and H. Taylor, Health Affairs 8, 149-57 [spring 1989]). The hospital has evolved as the backbone and focus of health care activity, reflecting the pluralism and ethnic, religious, and ra- cial stratification of American society. Vol- untary (that is, non-government, not-for- profit) hospitals, accounting for 70% of short-term hospital beds, have been expan- sionary institutions motivated by income opportunities. But they have also, as Rose- mary Stevens writes, "simultaneously carried symbolic and social significance as embodi- ments of American hopes and ideals: not only of science, technology, and expertise, but of altruism, social solidarity, and com- munity spirit" (p. 4). Stevens brings to the unwieldy history of our vast but still largely localized hospital industry an extraordinary fund of scholar- ship and experience. Initially a hospital administrator in Britain and having taken up the study of epidemiology, history, and so- cial policy in the United States, she has previously written books on both British (Medical Practice in Modern England) and American (American Medicine and the Public Interest) medical organization. Together with Charles Rosenberg's The Care of Strang- ers: The Rise of America's Hospital System, her work provides a masterful picture of the emergence of the hospital and its role in American society. Exemplift-'ing the British commitments to equity, access, and caring, she implicitly uses the evolution of health care in Britain as a backdrop that sharpens her historical vision. The central problem of American health policy, as Stevens sees it, has been "how to distribute the wealth of medical science and diffuse its technology across the population without establishing a massive welfare state" (p. 3). The voluntary hospital, "an en- trenched aspect of American corporate capi- talism" (p. 4), is seen as an adaptive blend of a supply-driven technological system with a range of humanitarian and egalitarian goals, weathering constant, unpredictable change over the course of the century. The narrative is organized around several powerful but loosely connected themes. The prosperity of the American hospital derives from its central place in the development of medical technology and professional exper- tise, exemplified by surgery and an emphasis on acute care. While hospital ownership has reflected the pluralism of American society, the internal organization of hospitals has highlighted as well its racial and class divi- sions. Stratification withui the hospital, as well as many other aspects of its operation, was defined by a money standard of success, and hospitalization was substantially treated as a consumption good. As businesses, hos- pitals have been driven by reimbursement possibilities, whether in attracting affluent patients or in adapting to financial incen- tives in insurance programs. The use of the hospital as the doctor's workshop by a pro- fession largely based outside it has been a continuing source of tension. Finally, though hospitals have been independent from medical schools, these academic insti- tutions forcefully shaped hospital surgical practice and contributed to the standardiza- tion of the hospital product. The hospital, Stevens argues, has been and continues to be a complex negotiated system that is in no way inevitable. It reflects the political, cul- tural, and economic priorities of the larger society. These general themes hardly convey Ste- vens's rich historical analysis or the pressing policy questions that emerge from it. An important strand throughout is the ability of local hospitals to straddle the worlds of business and charity and the public and private realms, avoiding transformation into either public bureaucracies or socially irre- sponsible profit maximizers. Through gov- ernment subsidy, tax exemption, and dona- tions hospitals were able to respond to public need without becoming public insti- tutions. This adaptability leads Stevens to conclude that, in the absence of commit- ment to welfare-state egalitarianism, we would have to invent such institutions if they were not already a traditional form. Another central strand is the uneasy rela- tionships between hospitals and the medical profession. By World War I, the principle of "open-staff " hospitals and professional con- trol was firmly established, supported by the growing political clout of medicine as a national force. The independent and influ- ential role of doctors whose interests were often different from those of the hospital helped moderate the excesses of an industri- al-business orientation. Despite standardiza- tion of practice, hospitals substantially re- mained under local control. Hospital insurance since the 1920s has seemed an attractive way for hospitals to gain needed income and meet public need as well. With the Great Depression, and in- creasing calls for public solutions to health care problems, voluntarism was the "unify- ing rhetoric" to stave off "socialized medi- cine." The increasing numbers of patients in public hospitals during the depression, many with chronic physical and mental con- ditions, were no threat to voluntary hospi- tals, which were not seeking such disadvan- taged patients, but provided a platform for railing against government expansionism. The growth of hospital insurance and the emergence of Blue Cross served both hospi- tals and the medical profession in protecting their economic and professional interests and undercutting more radical proposals; but the dominant pattern of hospital-orient- ed insurance associated with employment reinforced a highly technical approach to care and set the stage for major gaps in coverage associated with job mobility or unemployment. The Hill-Burton Act of 1946, which greatly increased hospital capacity, and the passage of Medicare and Medicaid in 1966, which resulted in large infusions of funds to hospitals, encouraged the independent and institution-building tendencies of the volun- tarv hospital sector, The availability of insur- ance heightened demand and contributed to the expansionary and inflationary spiral we recognize today. The aggressive entry of commercial carriers into competition with nonprofit programs such as Blue Cross di- luted the special character of the nonprofit e 16 JUNE 1989 BOOK REVIEWS 1385 2047o".j2647
Page 153: brs52e00
6. R. T. Fraley et al., Bio/Technology 3, 629 (1985). 7. Ef. Kl'ee and S G Rogers, in Plant DtVA Infertious .9gents, T. Hohn and 1. Schell, F..ds. ~Spru.gcc V cclag,llcw Yock 1985), pP. 179-203. 8. S. G. Rogers et al., Methods Enzymol. 153, 253 (1987). 9. A. Spielmann and R. B. Simpson, MoJ. Gen. Genet, 205, 34 (1986); R. Jorgensen, C. Snyder, J. D. G. Jones, ibid. 207, 471 (1987). 10. W. Mark, K. Signorelli, E. Lacy, Cold Spring Harbor Symp. Quant. Biol, 50, 453 (1985); L. Covarrubias, Y. Nishida, B. Mintz, Proc. Natl. Acad. Sci. U.S.A. 83, 6020 (1986). 11. I. Potr,Vkus et al., in Plant DNA Infectious Agents, T. Hohn and J. Sehell, Eds. (Springer-Verlag, New York, 1985), pp. 229-247. 12. G. Gheysen et al., Proc. Natl. Acad. Sci. U.S. A. 84, 61 (1987). 13. M. Wallroth et ai., Mol. Gen. Genet. 202, 6 (1986); S. C. Deroles and R. C. Gardner, Plant Mol. Biol. 11, 355 (1988). 14. X. Delannay, private communication. 15. B. Bvtebier et al., Proc. Natl. Acad. Sci. U.S.A. 84, 5345 (1987). 16. W. Schafer, A. C>arz, G. Kahl, Nature 327, 529 (1987). 17. N. Grimsley, T. Hohn, J. W. Davies, B. Hohn, ibid. 325, 177 (1987). 18. I. Potrykus et al., Mol. Gen. Genet. 199, 183 (1985); H. Lorz, B. Baker, J. Schell, ibid., p. 178; M. Fromm, L. P. Taylor, V. Walbot, Nature 319, 791 (1986); H. Uchimiya et al., Mol. Gen. Genet. 204, 204 (1986). 19. J. Callis, M. Fromm, V. Walbot, Genes Dev. 1,1183 (1987); W. R. Mareotte, Jr., C. C. Bayley, R. S. Quatrano, Nature 335, 454 (1988). 20. T. Fujimura, M. Sakurai, H. Akagi, T. Negishi, A. Hirose, Plant T'usue Culture Lett. 2, 74 (1985); K. Toriyama, K. Hinata, T. Sasaki, Theor. Appl. Genet. 73, 16 (1986); Y. Yamada, Z. Q. Yang, D. T. Tang, Plant Cell Rep. 4, 85 (1986); R. Abdullah, E. C. Cocking, J. A Thompson, BiolTechnology 4, 1087 (1986). 21. K. Toriyama et al., BiolTechnology 6, 1072 (1988). 22. C. Rhodes, K. Lowe, K. Ruby, ibid., p. 56. 23. C. A. Rhodes et al., Science 240, 204 (1988), 24. I. K. Vasil, BiolTechnology 6, 397 (1988). 25. T. M. Klein, E. D. Wolf, R. Wu, J. C. Sanford, Nature 327, 70 (1987). 26. T. M. Klein et al., Proc. Natl. Acad. Sci. U.S.A. 85, 8502 (1988). 27. D. E. McCabe et al., BiolTechnology 6, 923 (1988). 28. T. M. Klein, B. A. Roth, M. E. Fromm, in Genetic Engineering, vol. 11, J. K. Setlow, Ed. (Academic Press, New York, in press). 29. G. Zhou et al., Methods Enzymol. 101, 433 (1983); D. Hess, Intern Rev. Cytol. 107, 367 (1987); Z.-x. Luo and R. Wu, Plant Mo/. Biol. Reporter 6, 165 (1988). 30. A. de la Pena, H. Lotz, J. Schell, Nature 325, 274 (1987). 31. G. Neuhaus, G. Spangenberg, O. Mittelsten Scheid, H.-G. Schweiger, Theor. .9ppl. Genet, 75, 30 (1987). 32. R. Topfer, B. Gronenbom, J. Schell, H.-H. Steinbiss, Plant Cell 1, 133 (1989). 33. C. Benbrook and P. Moses, in Proceedings: BioExpo 1986 (Butterworth, Stoneham, MA, 1986), pp. 27-54. 34. H. Steinrucken and N. Atnrhein, Biochem. Biophys. Res. Commun. 94, 1207 (1980); D. M. Mousdale and J. R. Coggins, Planta 160, 78 (1984). 35. D. Atkinson, in Glyphosate, E. Grossbard and D. Atkinson, Eds. (Butterworth, London, 1985), pp. 127-133; L. Torstensson, ibid., pp. 137-150. 36. D. M. Shah et al., Science 233, 478 (1986). 37. L. Comai et al., Nature 317, 741 (1985). 38. M. A. Hinchee et al., BiolTechnology 6, 915 (1988). 39. G. W. Haughn er ai., Mol. Gen, Genet. 211, 266 (1988). 40. M. De Block et al., EMBO J. 6, 2513 (1987). 41. D. M. Stalker, K. E. McBride, L. D. Malvj, Science 242, 419 (1988). 42. W. De Greef et al., BiolTechnology 7, 61 (1989). 43. H. T. DuLnage, in Microbial Control of Pests, H. D. Burgess, Ed. (Academic Press, New York, 1981), pp. 193-222; A. I. Aronson, W. Beckman, P. Dutut, Miaobioi. Rev. 50, 1 (1986). 44. S. A. McPherson et a/., BiolTechnology 6, 61 (1988). 45. T. Yamamoto and R. E. McLaughlin, Biochem. Biophys. Res. Commun. 103, 414 (1981); L. J. Goldberg and J. Margalit, Mosquito News 37, 355 (1977). 46. A. Llausner, Blo/Technology 2, 408 (1984); D. R. Wilcox et al., in Protein Engineering, M. Inouye and R. Samia, Eds, (Academic Press, New York, 1986), p. 395. 47. V. F. Sacchi et a/., FEBS Len, 204, 213 (1986). 48. D. A. Fischhoff et al., BiolTechnology 5, 807 (1987); M. Vaeck et al., Nature 238, 33 (1987); D. A. Fischhoff, private cotnmunication. 49. X. Delannay et ai., Bio/Technology, in press. 50. V. A. Hilder et al., Nature 330, 160 (1988). 51. P. Powell-Abel et al., Science 232, 738 (1986). 52. N. E. Turner et ai., EMBO J. 6, 1181 (1987); C. Hemenway, R.-X. Fang, W. K. Kaniewski, N.-H. Chua, N. E. Turner, ibid. 7, 1273 (1988); M. Cuozzo et al., BiolTechnology 6, 549 (1988); A. Hoekema, M. J. Huisman, L. Molendijk, P. J. M. van den Elzen, B. J. C. Comelissen, ibid. 7, 273 (1989); C. M. P. Van Dun, J. F. Bol, L. Van Vloten-Doting, Virology 159, 299 (1987); E. C. Lawson and P. R. Sanders, private communication. 53. J. C. Register and R. N. Bcachy, I irology 166, 524 (1988). 54. R S. Nelson et al., BiolTechnology 6, 403 (1988). 55. J. D. G. Jones et al., Mol. Gen. Genet. 212, 536 (1988). 56. F. Nagy, G. Morelli, R. T. Fraley, S. G. Rogers, N.-H. Chua, EMBO J. 4, 3063 (1985); R. Fluhr and N.-H. Chua, Proc. Natl. Acad. Sci. U. S. A. 83,2358 (1986). 57. M. A. Anderson et al., Nature 321, 38 (1986); C. S. Gasser, K. A. Budelier, A. G. Smith, D. M. Shah, R. T. Fraley, Plant Cell 1, 15 (1989). 58. C. Sengupta-Gopalan et al., Proc. Natl. Acad, Sd. U.S.A. 82, 3320 (1985); R. N. Beachy et al., EMBO J. 4, 3047 (1985). 59. D. P. S. Verma and R. B. Goldberg, Eds., Temporal and Spatial Regulation of Plant Genes (Springer-Verlag, New York); R. B. Goldberg, Science 240, 1460 (1988); P. N. Benfey and N.-H. Chua, ibid. 244, 174 (1989). 60. R Broglie et al., ibid. 224, 838 (1984); D. E. Rochester, J. A. Winter, D. M. Shah, EV80 J. 5, 451 (1986); A. Theologis, Annu. Rev. Plant Physioi, 37, 407 (1986); M. M. Sachs and T.-H. D. Ho, ibid., p. 363 (1986); R. W. Thomberg, G. An, T. E. Cleveland, R. Johnson, C. A. Ryan, Proc. Natl. Acad. Sci. U.S. A. 84, 744 (1987); J. Gbmez et a/., Nature 334, 262 (1988); N. M. Crawford, M. Smith, D. Bellissimo, R. W. Davis, Proc. Natl. Acad. Sci. U,S.A. 85, 5006 (1988); C. J. Lamb, M. A. Lawton, M. Dron, R. A. Dixon, Cell 56, 215 (1989). 61. C. J. S. Smith et al., Nature 334, 724 (1988); R. E. Sheehy, M. K. Kramer, W. R. Hiatt, Proc. Nad. Acad. Sci. U.S.A. 85, 8805 (1988). 62. A. R. van der Krol et al., Nature 333, 866 (1988). 63. J. Haseloff and W. L. Gerlach, ibid. 334, 585 (1988). 64. J. Paszkowski, M. Baur, A. Bogucki, I. Potrykus, E.-4fBO J. 7, 4021 (1988). 65. N. V. Federoff, D. B. Furtek, O. E. Nelson, Proc. Nat(. Acad, Sci. U.S.A. 81, 3825 (1984), K. C. Cone, F. A. Burr, B. Burr, ibid. 83, 9631 (1986); E. M. Rinchik, L. B. Russell, N. G. Copeland, N. A. Jenkins, Genetics 112, 321 (1986); R J. Schmidt, F. A. Burr, B. Burr, Science 238, 960 (1987). 66. B. Baker, G. Coupland, N. Federoff, P. Starlinger, J. Schell, EMBO J. 6, 1547 (1987); M. A. Van Sluys, J. Tempe, N. Federoff, ibid., p. 3881. 67. K. A. Feldmann et al., Science 243, 1351 (1989). 68. R. Bcmatzky and S. D. Tanksley, Genetics 112, 887 (1986); T. Helentjaris, Trends Gettet. 3, 217 (1987); B. S. Landry, R. Kesseli, H. Leung, R. W. Michelmore Theor. Appl. Genet. 74, 646 (1987); B. Burr, F. A. Burr, K. H. Thompson, M. C. Albertson, C. W. Stuber, Genetics 118, 519 (1988); C. Chang et al., Proc. Natl. Acad. Sri. U.S.A. 85, 6856 (1988). 69. A. H. Paterson et al., Nature 335, 721(1988); S. D. Tanksley and J. Hewit, Theor. Appl. Genet. 75, 811 (1988). 70. R. E. Pruitt and E. M. Meyerowitz, J. Mol. Biol. 187, 169 (1986). 71. H. J. Klee, M. B. Hayford, S. G. Rogers, Mol. Gen. Genet. 210, 282 (1987). 72. U. S. Congress, Office ofTechnology Assessmenr, New Developments in Biotechnol- ogy-Field Testing Engineered Organisms: Genetic and Ecological Issues, OTA-BA-350 (U.S. Government Printing Office, Washington, DC, May 1988). 73. Council of the National Academy of Sciences, Iruroduction of Recombinant DNA- Engineered Organisms into the Environment: Key Issues (National Academy Press, Washington, DC, 1987); Boyce Thompson Institute for Plant Research, Regula- tory Considerations: Genetically Engineered Plants (Center for Science Information, San Francisco, CA, 1987). 74. International Food Biotechnology Council, Food and Chemical News, 6 February 1989, pp. 10-12; Expert Panel on Criteria for Determining the Regulatory Status of Food and Food Ingredients Produced by New Technologies, Federal Register, vol. 53, no. 168, 30 August 1988. 75. Diamond v. Chakrabarty, 447 U.S. 303 (1980). 76. Ex parte Hibberd, United States Patents Quarterly 227, 303 (1985). 77. J. Johnson, Seedsmen's Digest, 6 to 8 October 1987; Executive Committee of the American Seed Traders Association, Diversity 14, 27 (1988). 78. B. J. Fowlston, BiolTechnology 6, 911 (1988). 79. L. R. Brown, Worldwatch Paper 85 (Worldwatch Institute, Washington, DC, October 1988). 80. Council for Agricultural Science and Teclmology, Report No. 114 (University of Iowa, Ames, IA, 1988). 81. D. A. Eichholtz et al., Somat. Cell, &foL Genet. 13, 67 (1987); D. D. Lefebvre, B. L: Miki, J.-F. Laliberte, Bio/Technology 5, 1053 (1987); A. Barte et al., Plant Mol. Biol. 6, 347 (1986). 82. J. Vandelcerckhove et al., Bio/Technology, in press. 83. S. McCormick et a/., Plant Cell Rep. 5, 81 (1986). 84. G. Ooms, M. M. Burrell, A. Karp, M. Bevan, J. Hille, Theor. AppL Genet. 73, 744 (1987); S. Sheerman and M. W. Bevan, Plant Cell Rep. 7, 47 (1988). 85. J. Paszkowski et al., EMBO J. 3, 2717 (1984). 86. A. M. Lloyd et al., Science 234, 464 (1986). 87. R. Michelmore, E. Marsh, S. Seely, B. Landry, Plant Cell Rep. 6, 439 (1987). 88. N. P. Evrette et al„ BiolTechnology 5, 1201 (1987). 89. J. E. Fry, A. Barnason, R. B. Horsch, Plant Cel! Rep. 6, 321 (1987). E.-C. Pua, A. Mehra-Palta, F. Nagy, N: H. Chua, BiolTechnology 5, 815 (1987). 90. N. Basiran, P. Armitage, R. J. Scott, J. Draper, Plant Cell Rep. 6, 396 (1987); M. C. Jordan and A. McHughen, ibid. 7, 281 (1988). 91. P. Umbeck, G. Johnson, K. Barton, W. Swain, BiolTechnology 5, 263 (1987); E. Fitroozabady et al., Plant Mol. Biot. 10, 105 (1987). 92. A. R. Barnason and J. E. Fry, private communication. 93. D. Catlin et al., Plant Cell Rep. 7, 100 (1988). 94. E. A. Shahin et al., Crop Sa. 26, 1235 (1986). 95. M. Deak, G. B. Kiss, C. Koncz, D. Dudits, Plant Cell Rep. 5, 97 (1986). 96. H. P. Hernalsteens et al., EMBO J. 3, 3039 (1984). 97. F. Kohler, C. Golz, S. Eapen, H. Kohn, O. Schieder, ibid. 6, 313 (1987). 98. A. J. Trulson, R. B. Simpson, E. A. Shahin, TReor. AppL Genet. 73, 11 (1986). 99. C. David and M.-D. Chilton, J. Tempe, BiolTechnology 2, 73 (1984). 100. C. David and J. Tempe, Plant Cell Rep. 7, 88 (1988). 101, T. Noda et al., ibid. 6, 283 (1987). 102. D. Tepfer, Ce1137, 959 (1984). 103. J. J. Fillatd et al., Mol. Gen. Genet. 206, 192 (1987); F. Pythoud, V. P. Sinkar, E. W. Nester, M. P. Gordon, BiolTechnology 5, 1323 (1987). 104. G. H. McGranahan et al., BiolTechnology 6, 800 (1988). 105. D. J. James et al., Plant Cel! Rep. 7, 658 (1989). 106. M. E. Horn, R. D. Shillito, B. V. Conger, C. T. Harms, ibid., p. 469. 107. We thank X. Delannay, D. Fischhoff, P. Sanders, C. Lawson, A. Barnason, J. Fry, and J. Leemans for giving us pertnision to cite their work prior to publication. We thank G. Kishore, S. Rogers, H. Klee, J. Callis, D, Gunning, N, Turner and S. Brown for help with the content, readability, and references in the manuscript. Special thanks to all other members of the Plant Molecular Biology Group at Monsanto, i I 16 JUNE 1989 ARTICLES 1299
Page 154: brs52e00
ANOTOPJ 25 Plus 0.1,um filters are designed to remove Mycoplasma from tissue culture media and sera. ANOTOP Plus 0.1 ~rm syringe filters have been shown in independent tests to remove Mycoplasma*. 10 mis each of three common human Mycoplasma (M. hominis, M. salivarium, M. fermentans) and two the name of the ANOTEC distributor nearest you, call 1-212/751-3770 or write: At Synthecell, Vue Foresaw the Need ... and Responded Introducing S-0LIGOS Anti-Sense DNA for Experimentation in Living Cells ~~-~--_ -~ - ~ ~S OLfC:(DS ARF SCA Ft 1R r)~RIV4Tf7Fn [it°ti:rin t frf GnTinGc ~._.. ~ ~,CHARACTERISTICS - • MORE CELL PERMEABLE _ • RESISTAtiT TO I ~ f CLE SE - S(GMFICANTLY SLOCKED _La FOR A BIBLIOGRAPHY ON S-OLIGOS, OR INFORMATION ON OUR OTHER OLIGONUCLEOTIDE PRODUCTS, PLEASE CALL 1-800-336-7455 SYNt'hiECELL SYMHECELL SYNTHECELL SYNTHECELL SYNTHECELL SYNTHECELL CAiI 2096 Gaither Road, Rockville, MD 20850 USA Circle No. 19 on Readers' Service Card common contaminants of fetal calf serum (M. arginini and Acholeplasma Laidlawii) at a concentration of 104 organisms/ml were filtered through ANOTOP Plus filters at 75 psi. No Mycoplasma could be cultured from any of the filtrates. '99 99% or qreater removal effiaency observed. For more information and lnwganx Memhrane kchr?dagy Anotec Separations 226 E. 54th Street New York, NY 10022 1-212/751-3770 FAX: 1-212/751-0191 Anotec Separations. which is part of the Alcan Group of Companies, is a Ilcensetl user of lhe trademarks ANOTEC ANOPOAE, anaANOTOP FUDAN INTERNATIONAL SYMPOSIUM ON NEW FRONTIERS OF GENETICS September 10-14, 1989, Bao-Long Hotel, Shanghai, China. Organizing Committee - C.C. Tan (Honorary Chairman), S.D. Kung (Chairman), C.H.Y. Chu, (Vice Chairman). Program Committees: Recent Advances in Drosophila Genetics: B. Judd, Chairman; New Approaches to Human Genetics, E.H.Y. Chu, Chairman; Impact of Genetics and Genetic Engineering on Agriculture: R. Wu, Chairman; Microbial Genetics and Molecular Evolution: J.T.F. Wong, Chairman; Local Arrangements: J.L Xue, Chairman Program: Mon., Sept 11: Opening Ceremony & Keynote address: Howard M. Temin; Plenary Session: Seymour Benzer, Lawrence Bogorad, Yuet Wai Kan; Session I - Drosophila Genetics: Spyros Artavanis-Tsakonas, Yuh Nung Jan, Elliot M. Meyerowitz, Ruth Lehman, Michael Young; Session II - Human Genetics: Savio Woo, David A. Williams, Y. T. Zeng, C. C. Liew, Dean Hamer, Zai-Ping Li, Barbara Hamkalo; Session IIl - Plant Genetics: Ray Wu, Marc Van Montagu, Roger Beachy, Y. T. Qian, Ning-Sung Yang, Zhang-Liang Chen; Session IV - Microbial Genetics & Molecular Evolution: J. Tze-Fei Wong, Jeffrey Miller, Alastair Matheson, Robert Cedergren, Ke-zhong Tong, Haruo Ozeki;Tues., Sept 12: Plenary Session: Gerald Fink, Nam Hai Chua, C. Thomas Caskey, Charles Langley;Poster Session:Banquet C.C. Tan Birthday Celebration; Keynote Address: Joshua Lederberg; Wed., Sept 13: Plenary Session: David Hogness, Gurdev Khush, James Neel, Rita CoIweIl;Session I - Drosophila Genetics: LY. Jan, Bruce Baker, Michael Ashbumer, William Engels, Chung-I Wu, Hampton ~ Carson;Session II - Human Genetics: Ernest H.Y. Chu, Robert ~ Moyzis, Elbert Branscomb, Lap-Chee Tsui, L.C. Sze, Larry Deaven, ~ John J. Wasmuth; Session Itt -Plant Genetics: Thomas Hodges, A. ~ Hirai, John C. Gray, Shain-dow Kung, Shyam Dube, Alan Teramura, C5". C.C. Chen; Session IV - Microbial Genetics & Molecular Evolution: Edmund C.C. Lin, Frank Maley, Paul E. Sadowski, Paul O.P. Ts'o, Pei-Xuan Guo, Temple F. Smith;Thurs., Sept 14: Plenary Session CP ~ & Closing Ceremony: Eric Davidson, Thomas C. Kaufman, Michael Smith, Zu-Jia Sheng. For further information & registration contact: Helen Phillips, Ctr. for Agricultural Biotechnology, Q ~ University of Maryland, College Park, Maryland 20742, USA, . ~ Telephone: (301) 454-6056 or 8312; FAX: (301) 454-8143. Registration Fee: $200; Bao-long Hotel - $35 per night - , < A _ ~ RESI LT !._,REPLICATIOti, TRANSCRIPTION 4~ . -.- .. .-.--. - ANrS TRA,\iCt eTi(St-l _ ' .... Circle No. 232 on Readers' Service Card
Page 155: brs52e00
Fluorescezlt Probe Analysis Announcing the addition of :1T-b:ued image analysis to Tracor \orthern's Fluoroplex III. This offen a lower cost method of intracellular cation anahsis in cell and cell colonies. I i r ® Tracor Northern. Inc. a subsidiary of Tracor. Inc. 2551 West Beltline Highway Middleton, Wisconsin 53562-2697 Telephone (608) 831-6511 FAX: (608) 836-7224 Circle No. 250 on Readers' Service Card With LTQ Aldehyde Activated Columns, you're bound to succeed. For complete information, call toll-free. ae ChromatoChem, Inc. 2837 Fort Missoula Road Missoula, MT 59801 Call toll-free: 800/426-7227 Circle No. 183 on Readers' Service Card Develop a New Attachment Now create your own custom affinity support, just by passing your protein or peptide ligand through a HiPACT"`Aldehyde Activated Luer Tip Quick (LTQT"') Column. ' To immobilize your ligand to silica, inject a solution of the li- gand and NaCNBH3 into the LTQ column. Allow to react (20 to 60 minutes), then wash the column. All you need is an LTQ and a syringe. Once the ligand is immobilized to silica, it only takes about 5 minutes to purify a sample. And when it's time to scale up, transfer the immobilization protocol directly to a HiPAC ~ analytical or prep-scale HPLC column. The last thing you need is faulty reagents. Good research is difficult enough to do. Let Irtom pernide yvu with the best quality chemiral and cell cul2ure producis avat'lable. BIOCHE"14G4LS Inovar Chemicals Division is the primary manufacturer of a diverse line of specialty biochemicals for research and pharmaceu- tical use. Unique synthesis capabilities include indigogenic and other colorimet- ric reagents, thyroid hormones and stereo• chemistries via stereo-selective reductions and separations. . Indigogenic Fnzyme  Stereo-SpeciBc c7temLstry Substrates  Reagents for  'Itryroid Hormones BioOechnology  Biochemkals  Gustom Synthesis BIOLOGICAIS Inovar Biologicals Division features its unique serum processing using ultra- centrifugation and state•of•the•art sterile filtration and filling. This novel approach to biofluids processing results in substan• tially virus free products that insure the For a free sample best cell growth possible. or tedmiral baclFup:  Ce11 Gilture producls  Complete Grace's Call 1-800-782-2778 • Anlmal Sera Media / IrU41  Hormone Supplements  Vinis PuriHration • Contract Cell Ctilture l~NOU/11~ IBIOLOGICALS 7831 Cessrn Ave. •(iai.fftersbmg, Md.20879 st CH EM ICALS 1-301-963-1890 I~X:1-301-963 '966 i M C O t I O 1 A f 1 D Circle No. 245 on Readers' Service Card Real Time Confocal Inspection of Living Tissue Only with Ts1r! Ofal3r frorri ~ Tracor Northern! Carassius auratus live nerve cell: 60 x obj. The TSNt cunfocal light microscope from Tracor \urthern is the onh inarument (if its kind.+hich xuous real time nh,eneuon and true uptic:d sectioning of Ihing tissue. Uixocer the power of cnnEoc:d microscnpr for cuur application. t:all Tr.tcor \nrthern or circle the reader sersice card uKl;r%. Tracor Northern ® Tracor Northern. Inc. a subsidiary of Tracor. Inc. 2551 West Beltline Highway Middleton, Wisconsin 53562-2697 Telephone (608) 83t-6511 FAX: (608)836-7224 Circle No. 218 on Readers Service Card ,
Page 156: brs52e00
h ;er I 1 *a e uwxco„>s `S'~"ea~: . ~. u..... b 0.0 o s p.0 i.1 i. f M1/U SPEm [an i ~) The graphs above were sent to us by our customers. They were created using Sigma-P/W the leading PC software for the production oF publicatian-quality , charts and graphs for scientists. Sigma-Plat graphics have been published in literally hundreds of scientiFic journals, including Science and Nature. And it's no wonder, because Sigma-Plot is designed to create graphs the way cLou want to uour specifications. It includes essential scientific Features:  Automatic error bars >. Multiple plots per page . Polynomial curve Fitting • Log, semi-log, linear scales 65 Koch Road a Carte Madera, Califomia 94925 ibll Free 800-874-1888  Inside CA 415-924-8640  FAX: 415-924-2850 a Telex: 4931977 0 `--J-+-~- - 6 30 secINiERVP1 O10 secINTERVFL S } 0 - Y205 (GIV) __ -] (G u,M) .s sc ss s.o _ , _ 7ames Cherry, Ph.O. ` Prof. Maurica REMnk Boston universlty Univ. of Al4ississippi° 'alicrocomputer 7boLv for the Scientist" too xoa Surtace Crystal EO%A Spectra s STATHF1iIN ( trom viaB,panwu: to stabilite ) M ) ~t NHZ- ASP-SER-SQl-(LU-GLU-LYS-PHE-LIII-PRG-/JEG itE-GLY-IAG-PHE-GLY-iYR-GLY-TYR-OLY-PAO ttR-GLN-P RO-VN.-PRO-OLU-CLM-P RO-LE(l-n'R PRO-GIlI-PRO-IIR-GLN-PRO-GLV-ttR-Gl/-GLN ttR-1HR-PHE- -00H Hardware Requirements: IBM PC, XT. AT P5/2 or true compatible with 640k mem• ory. CGA, EGA, VGA, arHerc. graphics. Sup• ports HP plotters, LaserJet and Laserwriter printers, and se/ected dot•matrix printers. In Europe: RJA Handels GmbH Grosser M~iihlenweg 14A, 4044 Kaarst 2, FRG Phone: 2 /0 1 /6 66268 FAX: 2101 /64321 Circle No. 226 on Readers' Service Card  Exporf capability to iAlordperfect 5.17, Pagemaker a And much mona... Customers regularly teA us that Sigma-P/ot is one of the finest applica- tions programs they have used. And at under $400. Sigma-Plot is in reach of nearly any budget. Find out yourse/f why over 12,000 leading researchers have cfiosen Sigma-Plat. For a FREE brochure or to order your awn copy, caN us today. Maney-back guarantee. Medt Thegraphsabovewerareprintedwlthpermiss/onof: 1.)QiochemistryJournal198B,Vo1.27,pp7565-71,Fig.2.© 19B8AmerlcanChemical5aciety; 2.)(3rainResearchaulletin,Vol. 21,1ssue3.pp.445•450,F1p.2, © 1988PergamonPress; 3.)CanadianJoumalofQotany,67,No. 1, 1989,NatlonalResearchCouncllofCanada; 4.)Endocrinology, 122:242•253(88), ©198877reEndocrlneSocletyc 5.)B/achemistryJoumal, inpress. Oc 1988AmericanChemicalSociety. Theirusadoesnotimplyendorsementbyourcustomers'employarsorpublishers.
Page 157: brs52e00
SETTING THE PACE IN ANTIBODY BASED TECHNOLOGY C entocor was founded in 1979 to employ emerging biotechnologies for the development of diagnostic and therapeutic products for human health care. Today, Centocor is a leading intemational biopharmaceutical company developing monoclonal antibody-based products for the detection and treat- ment of cardiovascular, infectious and immune-related diseases and cancer. Our diverse product portfolio offers the opportunity to work at the forefront of medical research and development. Our fast-paced, interactive and challenging work environment stimulates technological innovation and fosters career growth. We currently have a number of openings for individuals with M.D.'s, Ph.D.'s, Master's and Bachelor's degrees to work in the following fields: • Molcular Biology • Biostatistics • Immunobiology R& D • Computer Operations • Mammalian Cell Culture • Project Management • Protein Chemistry • Clinical Research • Bioanalytical Chemistry Centocor offers competitive salaries, a fully paid benefits package, relocation assistance, and the chance to participate in the develop- ment of a major new biopharmaceutical company. The Company's headquarters, located in Malvern, Pennsylvania, and our facilities in Leiden, The Netherlands and Tokyo, Japan employ o-ver 475 employees. For confidential consideration, please submit your resume to: Centocor, Inc., Human Resources Department S-R&D, 244 Great Valley Parkway, Malvern, PA 19355. Centocor is an equal opportunity/affirmative action employer. Co cEKrocoR U.S. Public Health Service Epidemiology Training Program Applications are being accepted for the 1990 U.S. Public Health Service Epidemiology Training Program. APPLICATIONS ARE DUE SEPTEMBER 1, 1989. Training will begin approximately July 1, 1990. Features: The first year, trainees attend a university to study epidemiology, biostatistics, and related subjects. The subsequent two years, they will perform research with senior epidemiologists at one of the following: National Institutes of Health (NIH), Food and Drug Administration (FDA), National Center for Health Statistics (NCHS), or Alcohol, Drug Abuse, and Mental Health Administration (ADAMHA). First year salaries are currently $32,000 for physicians and $24,000 for non-physicians, with an increase in salary of $2,000 each year. Educational costs and allowable relocation expenses for the first year are provided. Eligibility: M.D., D.C., Doctorate in an allied health profession, or Ph.D., in a biomedical or behavioral science or equivalent, 3pS1- one year of postdoctoral training or experience by July 1, 1990; U.S. citizenship as of September 1, 1989; acceptability to an accredited university offering an MPH or equivalent, or more advanced public health degree. To obtain an application and more details, send your name and home mailing address to: NIH Training Center, PHS Epidemiology Training Program, 9000 Rockville Pike, Building 31/B2C31, Bethesda, MD 20892. ~RESEARCH ASSOCIATES PROTEIN BIOCHEMISTRY Amgen is an innovator in the discovery, development and production of new protein therapeutics through recombinant DNA technology. As a result of our continued growth, we have an immediate need for Research Associates in our Protein Biochemistry group to contribute to on-going research pro- grams in the purification and characterization of natural and recombinant proteins including various cellular growth factors and immunomodulators. Candidates must have a BS or MS degree in Biochemistry or a related field with 2 years' research experience in Biochemistry. Experience with LC and HPLC/FPLC and a background in Analytical Biochemistry, Cell Biology or Molecular Biology are essential. Amgen offers an excellent compensation and benefits package as well as the unique opportunity to contribute to the develop- ment of significant new human pharmaceuticals on the cutting edge of biotechnology. If you have the necessary qualifications and would like to be a part of a company that places a high priority on its human resources, please send a resume, in confidence, to: AMGEN, INC. Recruitment, Dept. #403 1900 Oak Terrace Lane Thousand Oaks CA 91320 Equal Opportunity Employer Industrial Postdoctoral Position Oncogene Research Monsanto Agricultural Company is seeking a Postdoc- toral Scientist to study the role of oncogene activation and expression in our chem ical carcinogenesis at ou r En- vironmental Health Laboratory in St. Louis, Missouri. Candidates are required to have a PhD with research ex- perience in molecular biology. Previous research expe- rience in oncogenes is preferred. This position is renew- able on an annual basis with an anticipated duration of two years. New laboratory facilities are available. Exter- nal publications and participation in the scientific com- munity will be highly encouraged. Monsanto provides a generous compensation package relative to your responsibilities and qualifications. Inter- ested candidates, please forward your resume to: C.D.R.; Mail Zone B3NA; MONSANTO COMPANY; 800 N. Lind- bergh Blvd.; St. Louis, MO 63167. An Equal Opportunity Employer M/F/HN. ~ ~ ~ ~ ~ Gy Careers for people with ideas ~ Monsanto i
Page 158: brs52e00
' Junior Biologist Transgenic Research Greenford, England Following the creation of a new Transgenic Research laboratory at Glaxo Group Research, we now have a vacancy for a Junior Biologist. Working as part of a team of young and committed scientists, you will be maintaining and characterising embryonic stem (ES) cell lines, as well as assisting with microinjection procedures and associated recombinant DNA techniques. You will have the opportunity to use the latest state-of-the-art equipment, and work at the forefront of this exciting new technology. In addition to possessing good basic qualifications in Biology (to A' or HNC level), previous experience in the maintenance of cell lines would also be useful. In return, depending on your experience, you will receive a salary in the range of ~8.5K-.~13K inclusive of guaranteed bonuses and Outer London allowance, as well as other benefits such as 25 days' holiday, flexible working hours, subsidised restaurant and a thriving sports and social club. You will also have the opportunity to study for further qualifications. Please send a full c.v. or telephone for an application form to, Fiona David, Personnel Officer, Glaxo Group Research, Greenford Road, Greenford, Middx. UB6 OHE, England. Telephone 01-422 3434 ext. 2934, quoting reference no. G89087. FACULTY POSITION Chairman, Department of Comparative and Experimental Pathology. The University of Florida, College of Veterinary Medicine, under the new leadership of Dean R.E. Dierks, invites applications and nominations for a tenure-track position at the level of Chairman. Letters of application or nomination should include a curriculum vitae outlining citizenship, aca- demic training, teaching and practice experience and present professional activities. Also needed are a list of publications, a statement of professional goals, and the names of three persons who can provide letters of reference. Salary will be commensurate with training and experience (and academic rank) of the successful applicant. The mission of the department is to acquire and disseminate knowledge in the areas of veterinary and experimental pathology and immunology. It has three principal means with which to accomplish its mission: teaching, research and an academically oriented Anatomic Pathology service. Faculty members participate in the Graduate Program in the College of Veterinary Medicine and share a Graduate Program in Experimental Pathology and Immunology with the Department of Pathology in the College of Medicine. Current research interests include bone and nutritional pathology, molecu- lar mechanisms of disease and host defense, and pathobiology of muscular diseases. As one of six colleges in the University's Health Sciences Center, the College of Veterinary Medicine provides excellent opportunities for collabo- rative programs in many aspects of biomedical research, and through its affiliation with the University's Institute of Food and Agricultural Sciences it fosters interests in food animal medicine and tropical diseases. Qualifications for the position include a DVM degree (or equivalent); a doctoral degree in biomedical sciences; an established record of excellence in research; a commitment to excellence in veterinary and graduate training; and a commitment to academic service programs. Board certifica- tion in pathology is desired, but not required. Applicants or nominees should be eligible for appointment to Full Professor and membership in the Doctoral Faculty of the University of Florida. Detailed position description is available upon request. Application deadline is 15 of August, 1989. Position No. VM-8821. Dr. Emerson Besch, Search Committee Chairper- son, College of Veterinary Medicine, University of Florida, Box J-137, JHMHSC, Gainesville, FL 32610-0125. The University of Florida is an Equal Opportunity/Affirmative Action Employer. ~ Research in Molecular Plant Pathology at The University of California-Berkeley & The USDA Plant Gene Expression Center Barbara Baker Transposon Insertional Mutagenesis in Tomato and Arabidopsis Lynn Epstein Physiology of Fungal-Plant Interactions Andrew Jackson Molecular Genetics of RNA Plant Viruses Steven Undow Ecology of Epiphytic Ice Nucleating Bacteria She1a AhcCormidc Molecular Genetics of Pollen Development Jadc Morris Molecular Biology of Plant-Viral Interactlons David Ow Molecular Biology of Plant Stress Nlckolas Panopoulos Molecular Genetics of Phytopathogenic Bacteria Brian Staskawicz Molecular Genefics of Plant-Bacteriaf Interactions A McKnight Fotmdation program of interdisciplinary research in molecular plant pathology is announced. Pre-doctoral and post-doctoral training in Molecular Genetics of Plant-Pathogen Inter- actions will be available July 1, 1989. Train- ees will participate in projects involving staff in the Department of Plant Pathology and at the nearby Plant Gene Expression Center. Projects will address the basic molecular mechanisms invofved in the interactions between bacterial, fungal and viral patho- gens and their respective hosts. Ph D applicants for postdoctoral positions with research experience in plant biology, molecular biology, biochemistry and/or physiology may apply by sending a state- mern of research interest, curriculum vitae and names of three referees. Salary range is from $24,000 depending an experience. Appointments are tor a minimum of two years. Applicants to the Graduate Program should contact the Department of Plant Pathology for application materials. Acceptance into the program will be contingent upon meeting the admission requirements of the University Graduate Division. Application materials and enquiries can be obtained by calIing or writing: Mc Eileen Bell Graduate Student Administrator Department of Plant Pathology University of California Berkeley, CA, 94720 TeL 415-b42-5121 Fax 415ti42-4612 Tte U,Ivenity or Gluw-c;. u,n ec-i oppornwry ArNm,GVe nnlm F=pk:rsr. FACULTY POSITIONS IN THE MOLECULAR PHARMACOLOGY OF CANCER The Department of Pharmacology and the Lineberger Cancer Research Center of the University of North Carolina at Chapel Hill are seeking to recruit one or more outstanding individuals in the area of basic research related to cancer. Tenure track faculty positions will be available as of January 1990; rank will be commensurate with ability and experience. Preference will be given to individuals with demonstrated competence in applying modem techniques of molecular biology, biochemistry or biophys- ics to fundamental problems in cancer pharmacology. Potential areas of interest would include, but not be limited to the following: regulation of gene expression by oncogenes or growth factors; molecular bases of drug resistance; mechanisms of action of anticancer drugs; molecular modeling of drug-receptor interactions. Successful candidates will be expected to establish well-funded indepen- dent research programs, to participate in the graduate and professional educational actitnties of the Department, and to interact closely with members of the Lineberger Cancer Research Center. Applicants should send a curriculum vitae, a statement of research plans and the names of three referees to: R, L Juliano, Ph.D. Professor and Chairman Department of Pharmacology CB #7365-S, 1106 Fac. Lab CNftce Bldg. The University of North Carolina at Chapel Hill Chapel Hill, NC 27599-7365 Women and minority candidates are encouraged to identify themselves Candidates are urged to apply prior to September 1, 1989. The University of North Carolina at Chapel Hilf is an equal opporn.rniry/afirmaUve action employer. 20470":J201A
Page 159: brs52e00
A ~ (1`l MIM I c M 0 ~ Y1l~~„~-•,.-_.-~-..,..~•,~ ~ ~~ ~~e ar a- ~ ~..~ovo Biorab,f~ ~ne ot Ce!! Culture Reagents are e~ava~(ak~l~ ~ ~afaie ~r irx~riduai sizes Stiil at fow, rrtanc~a~t~rFe~ ~ 9_,: st:~~r r u~~.~ wa~ e~me:~ .,_ 0 ~._ airecf prrCes ; • mone}r with a j uarant~ inati€m4ree ' ~ ~' feagei~s. This ccx~iin~nei~~i~ ~acfe BiaLabs For more information and a free brochure describirzg ~ the worfd's largest producer a~ aEM-supplier; ~ Nova BioLabs' fulf line t~ Ce(I:',,~rfti.~re;Reac~ents, contact ~ ~ • enzyme artd horrrioneprC~ L Circle No. 257 on Readers' Service Card ~ ~~ NovO~BiaLabs in U-SA > -No~ 86abs I na 33 Turrr Roart, Dantuxy, Cf t7684a USA Tel: ($OO)344-6~ f (1~} 79~}-2Z70 I .• ~5~~. Norno arxfuO A5, N DK-2880 82gs&erd. Detimarfi . ' Tef4529823339
Page 160: brs52e00
The Ec and Not CD4 Receptor Mediates Antibody Enhancement of HIV Infection in Human Cells JACQUES HOMSY, MIA MEYER, MASATOSHI TATENO,* SARAH CLARKSON, JAY A. LEVY Antibodies that enhance human immunodeficiency virus (HIV) infectivity have been found in the blood of infected individuals and in infected or immunized animals. These findings raise serious concern for the development of a safe vaccine against acquired immunodeficiency syndrome. To address the in vivo relevance and mechanism of this phenomenon, antibody-dependent enhancement of HIV infectivity in peripheral blood macrophages, lymphocytes, and human fibroblastoid cells was studied. Neither Leu3a, a monoclonal antibody directed against the CD4 receptor, nor soluble recombinant CD4 even at high concentrations prevented this enhancement. The addition of monoclonal antibody to the Fc receptor III (anti-FcRIII), but not of antibodies that react with FcRI or FcRII, inhibited HIV type 1 and HIV type 2 enhancement in peripheral blood macrophages. Although enhancement of HIV infection in CD4' lymphocytes could not be blocked by anti-FcRIII, it was inhibited by the addition of human immunoglobulin G aggregates. The results indicate that the FcRIII receptor on human macrophages and possibly another Fc receptor on human CD4+ lympho- cytes mediate antibody-dependent enhancement of HIV infectivity and that this phenomenon proceeds through a mechanism independent of the CD4 protein. T HE HUMORAL IMMUNE RESPONSE to HIV includes the formation of a heterogenous population of antibod- ies that can have inhibiting, promoting, or no effect on the virus pathogenicity in vitro (1-5). Neutralizing antibodies and antibod- ies mediating cellular cytotoxicity (ADCC to HIV (1, 2) represent important responses sought for in an effective HIV vaccine. Antibodies that enhance HIV infectivity in vitro have been shown to occur in the serum or plasma of infected individuals and infect- ed and immunized animals (3-5). These None H Ea2 Leu3a OKT3 OKT3 ~/ L ~ None Leu M3 Leu3a LeuM3 antibodies have been invoked as a possible explanation for the apparent lack of protec- tion of neutralizing or cytotoxic antibodies against HIV pathogenesis in vivo (3). En- hancing antibodies are a particular concern activitv in an established T cell line in the presence of fresh complement (3). This observa- tion suggested that the complement receptor could mediate antibody-dependent enhance- ment (ADE) of HIV infectivity. We and others have found that decomplemented sera from both immunized and infected subjects can also have enhancing properties not only in established T cell lines, but also in CD4+ lymphocytes and fully differentiat- ed rnacrophages derived from the peripheral blood (4, 5). Moreover, nonmacrophage- tropic strains of either HIV-1 or HIV-2 subtype can productively infect these cells in the presence of enhancing sera (Table 1). Finally, decomplemented antisera lose their HIV-enhancing activity when the Fc por- tion of immunoglobulins (Ig) is removed and Ig aggregates compete with this activity (5). These observations have pointed to the Fc receptor as a likely mediator of ADE of HIV. The aim of the present study was to identify further the receptor or receptors mediating this HIV enhancement in various cell types. Therefore, we performed block- ing experiments on potential ADE recep- tors. To facilitate the interpretation of re- sults, we used sera with high titers of en- for the development of a safe and effective HIV vaccine because any immunogen that would elicit their formation could pose seri- ous risks to the immunized population. It has been reported that a large propor- tion of neutralizing and nonneutralizing sera obtained from seropositive individuals could enhance HIV infectivity and mask neu 1"i a J. Homsy, M. Meyer, M. Tateno, J. A. Levy, Department of'.~fedicine and Cancer Research Institute, School of Medicine, University of California, San Francisco, CA 94143. S. Clarkson, Rosalind Russell Rheumatology Labora- torv, San Francisco General Hospital, San Francisco, CA 94103. *Present address: Department of Pathology, Sapporo City General Hospital, Chuoku Sapporo, 060 Japan. B 800 Fig.1. The effect of blocking the CD4 protein on ADE of HIV infection of lymphocytes and mac- rophages. rophages. This figure is representative of at least E three different experiments. PBMC were isolated ~ from fresh blood obtained from HN seronega- o tive individuals by Ficoll-Hypaque separation (7). V 400 CD4' cells were separated from PBMCs by im- w munoadsorption on a polystyrene plate by using -' Leu3a (Becton Dickinson) according to the meth- ~ / od of Wvsocki and Sato (20). After separation, ir / '7~ these CD4+ cells were treated for 45 m.in with 0 leucine methyl ester (Sigma) to lyse monocytes, and thev were stimulated with phytohemaggluti- nin (PHA) (3 µg/ml) for 3 days before use (7). The final cell population obtained in this way was 10 srCD4 (µg/ml) 50 usually ?95% Leu3a-positive by FACS. Monocytes were isolated as described (Table 1) and used by day 10 to 12 to ensure full maturation of monocytes into macrophages (4). Open bars, neutralizing serum; dosed bars, enhancing serum; hatched bars, control serum. (A) CD4+ lymphociltes (105) or approximately 5 x 105 macrophages were washed with phosphate-buffered saline (PBS) and resus- pended with 25 µg of Leu3a, OKT3, or no antibody for 30 min at room temperature. Infection was carried out as described (Table 1) by using HIVsFi2sA [100 median tissue culture infectious dose (TCID.o) per milliliter] and the chimpanzee and control sera (at 1:20 dilution). The TCID50 was determined in PBMCs as described (21). A human neutralizing serum used at the same dilution was included as an additional control. At day 3, 2 x 105 CD4' lymphocytes were added to each lymphocyte culn.ire. RT activity was monitored at 3-day intervals (9). Results represent the peak RT activity of supematants (8) from HN-1-infected cultures after 6 to 9 days for lymphocytes and 12 to 15 days for macrophages. Similar results were obtained with the guinea pig serum (10). (B) PHA-stimulated PBMCs (106) were infected as described above with HN- 1sFiZ8A that had been incubated 1:1 (voUvol) for 30 min with srCD4 (10 or 50 µg/ml), then with guinea pig enhancing or control serum diluted 1:50. Re- sults are shown after 3 days of culture. Similar results were obtained when the sera were incubated with srCD4 before mixing with HIV. 16 JUNE 1989 REPORTS 1357
Page 161: brs52e00
FELLOW/SENIOR FELLOW IN NONLINEAR OPTICS, RESEARCH SCHOOL OF PHYSICAL SCIENCES THE AUSTRALIAN NATIONAL UNIVERSITY The Optical Sciences Centre (Head: Professor A.W. Snyder FAA, FTS) is seeking to appoint an outstanding research scientist in the field of nonlinear optical waveguides with an interest in chaotic phenomena. The Centre works at the forefront of theoretical research in optical wave- guide devices as well as in visual information processing by humans and machines. As the Centre is presently collaborating with the Laser Physics Centre (Head: Or B. Luther-Davies) in the establishment of a nonlinear optical waveguide laboratory, an exceptional opportunity exists for a joint appointment for an applicant with a strong theoretical background plus an ability in experi- mental research. Enquiries may be directed to: Professor A.W. Snyder (062) 492430 or to Dr.B. Luther-Davies (062) 494244. Closing date: 30 September 1989. Ref: PS 11.5.1. SALARY: Sen- ior Fellow: AS47,564 -AS55,292 pa.; Fellow; AS35.683 -AS47,503 p.a. APPOINTMENT: Fel- low/Senior Fellow, tenurab!e. APPLICATIONS should be submitted in duplicate to the Registrar, The Australian National University, GPO Box 4, Canberra ACT 2601, Australia, quoting reference number and including curriculum vitae, list of publications and names of at least three referees. The University reserves the right not to make an appointment or to appoint by invitation at any time. Further information is available from the Registrar. THE UN/VERSITYIS AN EQUAL OPPORTUNITY EMPLOYER ~.;-. .y ..~~-. Research Scientists IDEON CORPORATION, a biotechnology research and development company located in Redwood Co. CA, is growing and is looking to fill several positions at different levels. IDEON's research focuses on the de/elopment of therapeutic products in the areas of infectious and autoim- mune disease and cancer, using novel immunotherapeutics, recombinant anti- bodies and immunomodulators. Protein Chemistry Group Leader Individual will assume overall respon- sibility for leading research groups inwlved in several aspects of protein chemistry including purification and protein engineenng. In addition to a Ph.D., the successful candidate will have a minimum of five years of professional experience and accomplishment within an academic or industrial setting. Protein Chemists/ Molecular Biologists Several positions eKist at the Ph.D. and B.S./M.S level. Ex,ertise in the protein and/or genetic engineering of immuno- conjugates, antibodies and other immunoregulatory molecules is desired. These positions wiUi IDEON CORPORAf10N ofter excellent salary, substantial equity participation and other benefits. An equal opportunity employer 11 IDEOM Please forward your resume in confidence to: IDEON CORPORATION, ATTN: R&D Department, 515 Galveston Drive, Redwood City, CA 94063. t Research Scientists THE SQUIBB INSTITUTE FOR MEDICAL RESEARCH is recognized internationally as a leader in research and develop- ment of novel therapeutic agents for the treatment of cardio- vascular and infectious diseases. We are greatly expanding the scope of our research programs and currently have several excep- tional opportunities available for scientif`ic professionals to join our Dept. of Pharmacology. Cardiovascular Electrophysiofogist (Ph.D)- Conceive, implement, and supervise in vivo test systems for the cardiac electrophysiological evaluation of new therapeutic agents affecting cardiac and vascular function with emphasis on conditions related to myocardial isehemia. Participate In col- laborative planning with scientists involved in cardiovascular re- search programs. Requires a minimum 6 years of relevant research experience. Cardiovascular Enzymologist (Ph.D)- Conceive, implement and supervise enzymatic and biochemical test systems for the evaluation of new therapeutic agents affecting cardiac and_wascular function with emphasis on conditions related to myocardial ischemia. Participate in col- laborative planning with scienrists involved in cardiumscular re- search programs. Requires a minimum 2 years of relevant research experience. Receptor Pharmacologist (Ph.D)- Implement radioligand-receptor binding assays in phar- macological systems of interest for drug discovery and develop- ment in the area of cardiovascular research. Charaeterize, by molecular pharmacological techniques and in collaboration with other scientists within Squibb Institute, natural products to be pursued as leads for organic synthesis. Requires a minimum 2 years of relevant research experience. Cardio-Renal Pharmaco[ogist / Physiologist (Ph.D.)- Conceive and implement advanced technological pro- cedures for measurement of in vivo cardiovascular and renal function in conscious..roden-s, Conductresearch using the con- scious rodent preparation on potential new avenues of therapeutic interventions for cardiovascuiar and renal diseases, Requires a minimum 2 years of relevant research experience, Receptor Pharmacologist (B.S./M.S.)- Perform receptor pharmacology experiments in the area of cardiovascular research. Utilize radioligand-receptor bin- ding techniques with the goal of characterizing pharmacologic agents and their speciflc receptors. Requires a minimum 2 years of relevant research experience. These positions are based in Princeton, NJ, a pleasant semi-rural community located mid-way between New York City and Philadelphia. For consideration. please send your resume to: Human Resources Department 549, The Squibb Institute for Medical Research, P.O. Box 4000, Princeton, NJ 08543-4000. Equal Opportunity Employer, M/F. SQUIBB~
Page 162: brs52e00
POSITIONS OPEN DIRECTOR OF PEDIATRIC ENDOCRINOLOGY DEPARTMENT OF PEDIATRICS UNIVERSITY OF MINNESOTA MEDICAL SCHOOL MIINNEAPOLIS, MINNESOTA The University of Minnesota, Department of Pediat- rics, is seeking a Director of the Division of Endocrinol- ogy. This is a senior position and has high priority in the Department of Pediatrics and the Medical School. The candidate should have leadership, clinical and research experiences necessary to direct an Endocrinology and Metabolism Program in a strong academically oriented department. Qualifications: Candidate must have an M.D. degree or equivalent. This position will be a tenured/associate or full professor with the rank to be commensurate with the years of experience and accomplishments. The cand date must have demonstrated professional distinction in re- search and writing, have an active ongoing research program which has attracted national funding and have demonstrated effectiveness in teaching and advising. Candidate must be approved by the Promotions Com- mittee of the Department of Pediatrics and the Medical School. Last date for receipt of application is 31 July 1989 with the earliest start date being 2 Januarv 1990. Applications and nominations (indude names and addresses of three referees) should be sent to: S. Michael Mauer, M.D. Chairman, Search Committee for Head of Pediatric Endocrinology and Metabolism University of Muutesota Medical School Box 491 UMHC 515 Delaware Street S.E. Minneapolis, MN 55455 The University of Minnesota is an Equal Opportunity Educator and Ernployer and speci(tcally invites and encourages applicatioru. FACULTY POSITION: DIRECTOR OF OB/GYN ANAEROBIC BACTERIOLOGIC RESEARCH LABORATORY Ph.D. microbiolog~st needed to establish and manage an Ob/Gyn Anaerobic Bacteriologic Research Labora- tory. Requirements include the ability to use specialized culture media to identify, speciate, and determine antimi- crobial sensitivities of all anaerobic organisms common to the vagina and to Ob/Gyn infections. Candidate should also have experience in research regarding the possible infectious etiology of pre-term labor and/or premature rupture of the membranes. Salary and rank commensurate with experience. Please send curriculutn vitae to: John C. Hauth, M.D., Professor and Director, Division of Maternal Fetal Medicine, Department of Obstetrics and Gyne- cology, The University of Alabama at Birmingham, UAB Station, Birmingham, AL 35294. Deadline for applications: 30 September 1989. An Affrrmative .4ction/Equal Eanployment Employer. FACULTY POSITTONS IN THE MACROMOLECULAR STRUCTURES GROUP OF THE DEPARTMENT OF BIOLOGICAL SCIENCES PURDUE UNIVERSITY The Department of Biological Sciences invites applica- tions for tenure-track faculty positions that would au - ment and complement the interests of the current et t members of the macromolecular structures group. e Department also has strong research programs in molec- ular and cell biology and microbiology, and is a major component of an mterd sciplinarv, campus-wide, bio- chemistrv program. We are seeking an individual with an interest in molecular biology of vinsses at an assistant professorial level, but qualified candidates at a more senior level are welcome to applv. Qualifications include a Ph. D. in a relevant field, at least 2 years of postdoctoral experience, and a demonstrated record of research ac- complishments. Applications will be accepted until 1 October 1989 or until the position is filled. Applicants should send curriclilum vitae, bibliography, names of three references, and a statement of their research inter- ests to: Michael G. Rossmann, Department of Bio1og ical Sciences, Purdue University, West Lafayette, IN 4790i. An Equal Opporhutity/Affirmative Action Employer. RESl,:f1 1i z.CH SCIENTIST Wyeth-Ayerst Laboratories, a leading pharmaceutical firm in the development and production of prescription drugs, biologicals and infant nutritionals, currently has a Research Scientist position available in our Biotechnology and Microbiology department in Radnor, PA. This is a highly specialized position performing independent sophisticated research as well as problem solving and providing technical expertise to management and peer scientists. Specifically you will perform experimental procedures for biologicals research and development and be responsible for training in same procedures. Our successful candidate will possess a Ph.D. with a minimum of I to 3 years Molecular Biology, Virology, Microbiology or Biochemistry research experience. You will enjoy working in our modern, well- equipped facilities in Philadelphia's prestigious Main Line suburban area. Besides an environment which fosters discovery, we offer a competitive salary, excellent benefits, and superior career opportunities. !w'AWYREISI-Ti Respond immediately by forwarding your CV and salary requirements, in confidence, to: Position #39, Recruitment Manager, Wyeth- Ayerst Laboratories, Inc., P.O. Box 8299, Philadelphia, PA 19101. Equal Opportunity Employer, M/F/H/V responses encouraged. DEAN, COLLEGE OF AGRICULTURAL AND ENVIRONMENTAL SCIENCES UNIVERSITY OF CALIFORNIA, DAVIS The University of California, Davis, invites applications and nominations for the position of Dean-College of Agricultural and Environmental Sciences and Director of Programs of the Division of Agriculture and Natural Resources (Davis). The College and Division conduct fundamental and mission-oriented teaching, research, extension, and public service relating to all aspects of agriculture, food, fiber, the environment, and human and natural resources. The College enrolls approximately 6,000 students in 41 undergraduate and 54 graduate programs. The College and the Davis unit of the Agricultural Experiment Station currently have more than 450 full-time faculty and about 2,000 other academic and nonacademic employees. There are over 1,000,000 assignable square feet of building space, 1,900 acres of land at Davis, ten off-campus field stations, and an annual budget in excess of $85,000,000. The responsibilities of the Dean are to provide leadership in developing and maintaining high quality programs of instruction, research, extension, and public service; to develop and implement policy for the College; to represent the College, Experiment Station, and Cooperative Extension to the Campus and University Administration, government, and the general public; to manage resources of the College; to serve on agricultural boards and panels; and to participate in the development of state and national policy. We seek candidates with a deep commitment to academic excellence who can lead the College in its continuing development. Qualifications include a distin- guished record of research, teaching, and professional service; demonstrated ability for creative leadership and management; and the energy and vigor necessary to translate ideas into action. Salary will be commensurate with experience and qualifications. The starting date will be 1 July 1990, or as negotiated. Nominations and applications are desired by 1 September 1989 and should be sent to Theodore L. Hullar, Office of the Chancellor, University of California, Davis, CA 95616. Applications should include a curriculum vitae and the names, addresses, and telephone numbers of five references. The position will remain open until filled. An Equal Opportunity Affirmative Action Employer. t394
Page 163: brs52e00
I. nin, 'mcrease the cellular mass of diacylgly- cerol (8), an activator of PKC, suggesting that receptors in these cells can mediate activation of PKC. Therefore, we examined regulation of the Cl- channel by PKC. To assess the effect of PKC on C1- chan- nels in the intact cell, we used phorbol 12- myristate 13-acetate (PMA), which is mem- brane-permeant, to activate PKC and mea- sured t'51- effiux as an index of Cl- channel activation (9). PMA increased t25I- effiux (Fig. 1A), but the degree of stimulation was smaller than that produced by forskolin (10 µlU) plus 3-isobutyl-1-methyl-xanthine Table 1. Activation of Cl- channels by PKC or depolarization at low CaZ' concentrations. Voltage was -40 mV throughout. Data are from two groups of studies, each with its own controls. Patches were from 30 dog and 20 human cells. The intemal (cvtosolic) surface was exposed to purified PKC (12), ATP (1 m.bl), and either DiCS (1 µg/ml) or PMA (100 n1f), as indicated. If no channel activated during 8 min, the membrane was progressively depolarized (3) to voltages up to + 140 mV. The number of channels activated during the intervention period was different for PKC and control groups (P < 0.002 by )(` analysis). Intervention Ca=` Total h Patches with activated d channel uring: Blank t h patc es Intervention Depolarization pa c es Control <10 n:Vi 15 0 11 4 PKC, DiCB, ATP <10 n.Yt 23 9 5 9 Control < 10 na1 5 0 5 0 PKC, PNLA, ATP <10 n.w 7 5 0 2 A B 1 Ccntrol.(Oa") <10nM . . . . . . . . . . . . . . . ~ . . . . . . 2 PKC. DiCB, ATPR and (Ca2+l <10 nM 1 Controi ,~ 2 ATP 3 PKC. DiCB. ATP.P and fCa2'J >10 µM a ~ Lm2os ns N C 1 Control 2 PKA and ATP 3 PKA, ATP. PKC, and DC8 ~,°',1205 m8 ""'1!"w"7r,"'I"'""~}"~'"/~I'~'"'"'`"I'W1''MN --- t(~N1~ --- 3 PMAandATP "'"~"I«w+t,~L~+ ~,?', . . . ! ~"I0,10rr-joj~ 4 PKC, PMA, and ATP 5 Control (wash) I " ,01ht1~tr ; 11111'~ 6 PKC, PMA, and ATP (IBMX) (500 µA1) [a treatment that in- creases cellular cAMP (10) ]. In contrast, addition of PMA before fors- kolin plus IBMX attenuated cANSP-induced 1z5I- e$iux (Fig. 1C). These results suggest that PKC can either stimulate or inhibit the Cl- channel, depending on the physiologi- cal status of the cell. They are also consistent with studies showing that PMA partially stimulated Cl- secretion, but also inhibited cAMP-induced Cl- secretion (11). To assess more directly the effect of PKC on the Cl- channel, we used the single- channel patch-clamp technique to obtain cell-free, inside-out membrane patches from primary cultures of human and canine air- way epithelia. PKC-dependent phosphorvl- ation requires adenosine triphosphate (ATP), phosphatidylserine, and a tumor- promoting phorbol ester or diacylglycerol (6). Therefore we added PKC (12), ATP (1 m111), and dioctanoylglycerol (DiC8) (1 µg/ ml), and the cell membrane served as the source of phospholipid. At a low Ca2'- concentration (<10 n.M), PKC activated Cl- channels (Fig. 2A and Table 1). Activation occurred an average of 126 s after addition of PKC, DiC8, and ATP (maximum time, 210 s). In contrast, channels did not activate during 8 min of observation in paired patches not exposed to PKC (Table 1). Activation required the presence of PKC, ATP, and either DiC8 or PMA; addition of only two of the reagents was insufficient (13). In some patches PKC, ATP, and DiC8 did not activate a channel within 8 min of addition, even though subsequent depolarization (3) showed a channel present in the patch (Table 1). When we increased internal Ca'`+ to > 10 µM, the channel that had been activated by PKC at low Ca`+ inactivated (Fig. 2A); in two of three other patches that could be adequately evaluated, increasing CaZ+ con- centration inactivated channels in an average of 25 s, indicating that at high Ca`+, PKC had an effect opposite to that observed at low Ca-+. At high Ca`+ concentration (1 µ:VI), PKC also prevented voltage-dependent channel activation (Table 2A). In control patches, no channels activated during the 6 min intervention period, but subsequent depo- larization (3) showed that most of the patch- es contained Cl- channels. In paired experi- ments, we added PKC, PMA (100 n-V), and ATP to the internal surface of the patch; in contrast to results obtained at low Ca=+ concentration, channels were not activated. In fact, PKC prevented subsequent channel activation in response to large membrane depolarization. At high Ca`+ concentration, PKC inacti- vated Cl- channels that had previously been N . . _.._ ,. ._ .Q. ......... Fig. 2. Regulation of Cl- channels by PKC. m 205 ms Tracings are examples from excised, inside-out N patches from canine (A) or normal human (B and C) airway epithelial cells (21). Inward current is shown as a downward deflection (A); outward current is shown as an upward deflection (B and C); the current level when channels are closed is shown by the dashed line. (A) PKC activation of a CI- channel at low Ca2' (<10 nM). Membrane voltage was -40 mV throughout. (1) Control; (2) PKC, DiCB (1 and ATP (1 mRd) were added to the internal solution, and the channel activated 132 s later; (3) internal CaZ` was increased to > 10 µM by addition of CaCIZ to the bath and the channel inactivated 52 s later. (B) PKC inactivation of a depolarization-activated Cl- channel at 1 µA1 Ca". Holding voltage was -40 mV and tracings were obtained at +40 mV. After channel was activated by depolarization, recordings were made under the following conditions: (1) Control, no additions (probability of the channel being in the open state (Po) = 0.80); (2) ATP (1 mM) (Po = 0.89); (3) PMA (100 nM) and ATP (Po = 0.73); (4) PKC, PMA, and ATP (Po = 0); (5) control conditions after removal of PKC, PMA, and ATP from the internal solution (Po = 0.71); (6) readdition of' PKC, PMA, and ATP (Po = 0). (C) PKC inactivation of a PKA-activated Cl- channel at high (1 µAl) Ca'-1. Voltage conditions as in (B). (1) Control; (2) catalytic subunit of PKA and ATP (1 m-bi) added as described in (3); (3) PKA, ATP, PKC, and DiC8 (1 1354 204d6~z0l8 SCIENCE, VOL. 2q4
Page 164: brs52e00
i 2. R Rass, :V. Ertgl. jMed. 314, 488 (1986); P. L bby, S. j. C. W amec et al., ibid. 318, 1493 (1988); T. B. Barrett and E. P. Bendirt, Proc. ,Nad. Acad. Sa. U.S.A. 85, 2810 (1988). 3. R. F. Furchgott and J. V. Zawadzki, Nature 288, 373 (1980); B. C. Berk, R. W. Alexander, T. A. Brock, M. A. Gimbrone, R. C. Webb, Science 232, 87 (1986); R. M. J. Palmer, A. G. Ferrige, S. Moncada, Nature 327, 524 (198-7. 4. J. S. Reitman, R. W. Mahley, D. L. Fry, Atherosde- rosis 43, 119 (1982). 5. The endothelial cells exhibited growth characteris- tics and morphology typical of porcine endotheGum in tissue culture. They also expressed receptors for rhe acetvlated form of low density lipoprotein (AcLDL), in contrast to fibroblasts and other mes- enchymal cells [R. E. Pitos, T. L. Innerarity, J. N. Weinstein, R. W. Mahley, Arteriosclerosis 1, 177 (1981); T. J. C. Van Berkel, J. F. Nagelkerke, J. K. Kruijt, FEBS Lett. 132, 61 (1981); J. M. Wilson, D. E. Johnston, D. M. Jefferson, R. C. Mulligan, Proc. Nad. Acad, Sri. U.S.A. 85, 4421 (1988)]. More than 95% of the cultured cells contained this recep- tor, as judged by fluorescent AcLDL uptake. Cell cultures were incubated with (1,1'-dioctadm'l- 3,3,3',3'-tetramerhylindocarbacyanine percfilorate) (Dil) AcLDL (Biomedical Technologies) (10 µg/ ml) for 4 to 6 hours at 37C, followed by three rinses with phosphate-buffered saline containing 1% paraformaldehyde and visualized by phase-contrast and fluorescent microscopy to detect AcLDL up- take. These cells also contained von Willebrand factor, detected in cDNA by the polymerase chain reaction. 6. Endothelial cells containing this vector were selected for their ability to grow in the presence of G418. Greater than 90% of selected cells synthesized P- galactosidase by histochemical staining (Fig. 2B). The endothelial cell nature of these genetically al- tered cells was also confirmed by analysis offluores- ccnt AcLDL uptake and von Willebrand factor detected in cDNA by using the polymerase chain reaction. Infection by BAG retrovirus was fiirther verified by DNA blot analysis, which revealed the presence of intact proviral DNA at approximately one copy per genome. J. Price, D. Turner, C. Cepko, Proc. Nati. Acad. Sa. U.S.A. 84, 156 (1987). 7. 8. P. M. Starkey, and A. J. Barrett, in Proteinases in Mammalian Cells and Tissues. A. J. Banxtt, Ed. (North-Holland, Amsterdam, 1977), pp. 663-696. 9. R. Mann, R. C. Mulligan, D. Baltimore, Cell 33, 153 (1983); C. L. Cepko, B. E. Roberts, R. C. Mulligan, ibid. 37, 1053 (1984); M. A. Eglitis and W. F. Anderson, Biotechniques 6, 608 (1988). 10. S. G. Ellis et al., Circulation 77, 372 (1988); L. Schwaztz et al., N. Engl. J. b4ed. 318, 1714 (1988). 11. P. C. Block, R. K. Myler, S. Stcrtaxr, J. T. Fallon, N. Engl. J. Med. 305, 382 (1981); P. M. Steele, J, H. Chesebro, A. W. Stanson, Circ, Res. 57, 105 (1985); J. R. Wllentz et al., Circulation 75, 636 (1987); W. McBride, R. A. Lange, L. D. Hillis, N. Engl. J. Med. 318, 1734 (1988). 12. T. Matsumura, T. Yamanka, S. Hashizume, Y. Irie, K. Nitta, Jpn. J. Exp. Med. 45, 377 (1975); D. G. S. Thilo, S. Muller-Kusel, D. Heinrich, I. Kauffer, E. Weiss, .9nery 8, 259 (1980). 13, A. M. Dannenberg and M. Suga, in Methods for Saaiying Monomtclear Phagorytes, D. O. Adams, P. J. ~',delson, H. S. Koren, Eds. (Academic Press, New York, 1981), pp. 375-395. 14. We thank C. Cepko for the p-galactosidase-trans- ducing MoMuLV vector; D. Ginsburg for provid- ing help&1 advice and reagents; J. Crudup for surgical assistance; and W. Burkel for assistance in establishing endothelial cells. 5 January 1989; accepted 7 April 1989 Implantation of Vascular Grafts Lined with Genetically Modified Endothelial Cells JAMES M. WILSON, * Louis K. BIRINYI, ROBERT N. SALOMON, PETER LIBBY, ALLAN D. CALLOw, RIcxARD C. MuLLIGAN The possibility of using the vascular endothelial cell as a target for gene replacement therapy was explored. Recombinant retroviruses were used to transduce the lacZ gene into endothelial cells harvested from mongrel dogs. Prosthetic vascular grafts seeded with the genetically modified cells were implanted as carotid interposition grafts into the dogs from which the original cells were harvested. Analysis of the graft 5 weeks after implantation revealed genetically modified endotheliai cells lining the luminal surface of the graft. This technology could be used in the treatment of atherosclerosis disease and the design of new drug delivery systems. YOCARDIAL INFARCTIONS, strokes, and amputations due to lower extremity occlusive disease are the clinical sequelae of atherosclerosis and the major causes of mortality in our society despite concerted attempts at pre- vention and treatment (1). One important clinical intervention in advanced disease states is the replacement of stenotic or oc- cluded arteries with bypass grafts. In large diameter vessels, this can be accomplished through the use of autologous veins or arteries or by using prosthetic conduits com- posed of materials such as dacron or expand- ed polytetrafluoroethylene (2). Bypass of smaller diameter, low flow vessels (for exam- 1344 ple, coronary arteries and some peripheral arteries) usually requires the use of autolo- gous vessels, since the performance of pros- thetic vascular grafts is poor (2). We have considered whether the perform- ance and versatility of prosthetic vascular grafts might be improved by lining the luminal surface with endothelial cells geneti- cally modified to promote repopulation, prevent thrombosis, or secrete therapeutic proteins. As a first step, we implanted into dogs vascular grafts seeded with autologous retrovirus-transduced endothelial cells by means of a technique that has been used in the study of graft thrombosis (3). External jugular veins harvested from adult mongrel dogs were used as a source of endothelial cells. The cells were plated in culture and expanded in vitro for 10 to 14 days. Cells from each animal were divided into two portions and infected with a replication- defective retrovirus or were mock-infected. Small diameter Dacron grafts were seeded at subconfluent densities with endothelial cells and surgically implanted as carotid interpo- sition grafts into the dog from which the cells were harvested. Each dog received a graft seeded with the genetically modified cells (subsequently referred to as the geneti- cally modified graft) and a contralateral graft seeded with mock-infected cells. Five weeks after implantation the grafts were harvested and analyzed. Replication-defective retroviruses with amphotropic host range were used to intro- duce a reporter gene into the genomic DNA of the endothelial cells. The Escherichia coli lacZ gene was used as the reporter gene because its product of expression, R-galacto- sidase, can be detected in situ through the use of enzymic histochemical assays that stain the cell's cytoplasm blue (4). Two retroviral vectors that express the lacZ gene, BAG and BAL, were used in this study (5). Viruses derived from these vectors were used to infect primary cultures of endotheli- al cells derived from each dog. Approxi- mately 5% to 15% of the endothelial cells exposed to the BAG virus were infected, whereas 40% to 60% of the endothelial cells exposed to BAL virus were infected (Table 1). At the time of seeding, the cultures were analyzed for endothelial cell-specific func- tion [uptake of acetylated low density lipo- protein (LDL) and the presence of von Willebrand's factor] and for the presence of antigens specific for smooth muscle cells (a- and y-actin isoforms). These analyses indi- cated that >98% of the cells from each isolate were functional endothelial cells. Dogs 1 to 3 received implants seeded with BAG-infected endothelial cells, whereas dogs 4 to 7 received implants seeded with BAL-infected endothelial cells. After 5 weeks, the grafts were explanted and divided longitudinally into thirds for analysis. The analyses included fixation and scanning elec- tron microscopy, fixation and histochemi- cal characterization for (3-galactosidase-ex- J. M. Wilson and R. C. Mulligan, Whitehead Institute and Department of Biology Massachusetts Institute of Technolo~y, Cambrid~e, MA 02142. L. K. Binnyi, R. N. ~alomon, P. Libby, A. D. Callow, Deparzments of Surgery and Pathology and Medicine, Tufrs Univcrsiry New England Medical Center, Boston, MA 02111. "Present address: Howard Hughes Medical Institute, Departments of Internal Medicine and Biological Chem- istr,v, L'niversity of Michigan Medical School, Ann Ar, bor, MI 48109. 20476~2u98 SCIENCE, VOL. 2q-#-
Page 165: brs52e00
POSITIONS OPEN The Collcge of Dentistry, University of Iowa, is presently conducting a search to fill a full-time FACUL- TY POSITTON in the Dows Institute for Dental Re- search with major respon sibilities for the Oral Soft Tissue Research Program. The position will be available 1 July 1989; screening will begin immediately. Applicants must have a Ph.D. and expenence in the area of cell and tissue culture; expertise in btochcmistrv/molectilar biology is desirable. Academic rank and salary will be commensu- rate with qualifications and experience. Submit curricu- lum vitae to: Dr. C. A. Squier, Professor and Assistant Dean for Research and Director of Dows Institute, College of Dentistry, University of Iowa, Iowa City, IA 52242. The University of Iowa is an Equal Opportuni- ty/Affinnative Action Employer. FACULTY TERM POSITIONS in geology and phvsics, Eastern New Mexico Universitv (ENMU), be- gt"g 22 August 1989. Responsibilities for geology position: introducton• and advanced undergraduate courses in mineralogs~, crystallolgraphy, and petrology. Responsibilities for phvsics position: introductory and advanced undergraduate courses in physics. Ph.D. pre- fen~ed. Send letter, rEsume, transcripts, names of three references to: Search Committee, Physical Sciences, ENMU, #33, Portales, NM 88130 bv 28 Julv 1989. E1VMU hires only U. S. dttzens arud aliens lawfully aiathorized to work in the United States and is an Affinnative Action/Equal Opportunity Employer. INSTRUCTOR OF PSYCHIATRY (RE- SF.ARCH POSITION) to perform clinical research studies on test patients to determine biological and physiological factors that influence and cause substance abuse (specifically alcohol and cocaine). Major focus of studies is effect of abused substances on neuroendocrine and reproductive hormone function in women; specific duties include: evaluate all potential research subjects; ensure all preselection tests and questionnaires are accu- rate and complete and all laboratory tests are within acceptable ranges; perfotm complete medical examina- tions on all subjects who are candidates for proposed studies; conduct studies where intravenous catheteriza- tions and administration of intravenous substances for provocative tests are imolved; supervise support staff during conduct of all clinical research studies; ensure all research tests are complete and accurate; assist in plan- ning and development of research projects as well as carrying out independent research projects; interpret results of all research tests and supervise analysis of data; participate in preparation of scientific publications, pre- sentations, and reports. Candidate must possess M.D. in medicine. Must also possess certification of Massachu- setts Board of Registration in Medicine; expertise in endocrinology; eCpertise in performance of computer- aided data analvsis. Salarv: 533,000 per }ear for 5-day, 40+-hour work week. Rrsumes onlv to: Massachusetts DET, CF Hurley Building, 19 Staniford Street, Bos- ton, MA 02114. Job Order #9908. Equal Oppomutity Employer. KINESIOLOGY/HUMAN MOVEMENT SCI- ENCE. The Rehabilitation Research and Development Center at Edward Hines Jr. Veterans Affairs Hospital has an immediate opening for a person with interests and skills in the area of human motor behavior. Candidates must have a thorough knowledge of kinesi- ologv and human motor control, and a proven track record of funding in these areas. Prior experience in the application of nonlinear dynamical systems theory to human motor behavior is desirable. Familiarity with the use of motion analysis equipment and com p~ uter pro- gramming (C and Fortran) would also be helpfirl. The successful candidate will be expected to develop a strong research program in the control of human loco- motion. The primary focus of this program will be studies on the use of optical and non-opncal information in the control of locomotion and the application of the theor,v of nonlinear dynamical systems to the studv of human movement coordination. The salary range for this position is $34,580 to $48,592 per year, depending on qualifications. The initial appomtment will be for a period of 3 years with the possibility of extension to a maximum of ten total years. Send curriculum vitae, three references, and copies of recent publications to: John Trimble, Ph.D., Direc- tor, Rehabilitation Research and Development Cen- ter, P.O. Box 20, Hines, IL 60141. An Ajfinnative Action/Equal Opportunity Employer, :WF/H. Supervisor of Neurochemistry Use your talents to hel p us ach ieve our goals. We're Anaquest, a division of the BOC GROUP and a recogniz- ed leader in the development and manufacture of specialized pharmaceutical products. Our continuing growth has created an exceptional opportunity for a Supervisor of Neurochemistry. The individual we are seeking for this position will have a Ph.D. in Pharmacology/Biochemistry and up to 5 years' relevant work experience with receptor binding, enzymatic and neurochemical assays, and familiarity with various analytical instrumentation. You should also have demonstrated experience coordinating work activities, conceptualizing and presenting ideas effective- ly, and motivating and guiding people toward a common goal. In addition, you will act as spokesperson for the Neurochemistry Group. In return, Anaquest offers a competitive compensation package which includes an excellent salary, comprehensive benefits, and an outstanding relocation package, as well as a highly profes- sional work environment. For jmmediate confidential considera- tion, please send your resume to: Shawn Powell, Human Resources Supervisor, Anaquest, 100 Mountain Avenue, Mur- ray HiII, NJ 07974. We are an equal opportunity employer M/F/H/V. Anaquest ,~ BOC Health Care Biachemists /f p ursuing ph a rina c e uti c a/ b re a kt/i ro ug gh s wi th a$3 -, b i//i o n/ea de r is whatyoU have ifl inind, corne to Scheriflg=P/ougIi Research. Worki ng as part of an i nterdisci pli nary team, you wi II be given research challenges which fully utilize your professional background, education and talent to help create medical breakthroughs in the areas of athero- sclerosis and lipid metabolism. We require a BS or MS degree in anyof the Biological Sciences and laboratory experience with the above areas. We have the environment and resources that foster professional growth. Our salary and benefits package is generous. For prompt, confidential consideration,sendresumeto: Ms. P. Valendo, Schering-Plough Research, 60 Orange Street, Bloomfield, NJ 07003. An equal opportunityemployer. lvhatyou /iave in mind, we putin action, 46 Schering-Plough r398
Page 166: brs52e00
I reached m the cultures receiving enhancing serum before or at the same time as the peak RT activity of control infections. Moreover, we have shown in other experiments that RT activity mirrors viral antigen (p25) as well as the amount of infectious virus production (19). Thus, HIV enhancement is characterized not only by accelerated kinetics of viral replication but also by increased virus progeny. 9. A. D. Hoffman, B. Banapour, J. A. Levy, Virology 147, 326 (1985). 10. J. Homsy et al., unpublished observations. 11. A. Dalgleish et al., Nature 312, 763 (1984); D. Klatzmann et al., Science 225, 59 (1984); J. A. Hoxie et al., ibid. 234, 1123 (1986); J. S. McDougal et al., ibid., p. 382; D. H. Smith et al., ibid. 238, 1704 (1987); R. A. Fisher et al., Nature 331, 76 (1988); R. E. Hussey et ai., ibid., p. 78; K. C. Deen et al., ibid., p. 82; A. Traunecker, W. Luke, K. Karjalainen, ibid., p. 84. 12. M. Tatcno, F. Cmnzales-Scarano, J. A. Lecy, Proc. Natl. Acad. Sci. U.S.A. 86, 4287 (1989). 13. Human osteosarcoma (HOS) cells were infected with H1V-1SF33 (12) in the presence or absence of enhancing sera (1: 20 dilution). In brief, DEAE- dextran (25 µg/ml)-treated HOS cells were infected with 0.1 ml of HIVsF33-containing fluid (RT activi- tv, 106 cpm/ml) that had been incubated with an equal volume of test (immunized guinea pig or infected chimpanzee) and control serum (1:10) for 1 hour at 37C. After overnight incubation at 37C, the cells were trypsinized three times (500 µg/ml) during 9 days, washed in Hanks buffer, and coculti- vated with MT-2 cclls for 3 davs. MT-2 cells were then removed and cultured alone. HIV production was monitored by measuring p25 antigen levels (Dupont HIVp24 kit) [J. Goudsmit et al., Lancet ii, 177 (1986)] in the MT-2 cell supernatants. Cvto- pathic effect (CPE) was assessed by the presence of multinucleated giant cells and balloon formation in MT-2 cells. The p25 and CPE were detected only in the presence of enhancing setum and as early as day 3 and 7, respectively, after initiation of cocultures. 14. J. C. Unkeless, E. Scigliano, V. H. Freedman, A nzu. Rev. Immunol. 6. 251 (1988). 15. P. M. Lydyard and M. V. Fanger, Immunology 47, 1 (1987); L. Moretta et al., Immunol. Rev. 56, 141 (1982). 16. J. Homsy, M. Mever, J. A. Lcvy, in preparation. 17. W. J. W. Morrow et al., Clin. Immunol, Immunopath- al. 40, 515 (1987). 18. J. A. Le~7,, C. Cheng-Mayer, D. Pina, P. A. Luciw, Science 232, 998 (1986). 19. L. A. Evans et al., ibid240, 1522 (1988). 20. L. J. Wysocki and V. L. Sato, Proc. Natl. Acad. Sn. U.S.A. 75, 2844 (1978). 21. J.. S. McDougal et al., J. bnrnunol. Methods 76, 171 (1985). 22. We thank C. Cheng '14ayer and L. Evans for com- ments and advice during the course of this study; Becton Dickinson and R. Sweet for gifts of Leu3a MAb and soluble recombinant CD4, respectively; A. Barboza, F. Ferro, F. Hsueh, H. Legg, and G. Thomson-Honnebier for technical assistance; and D. Wong for preparation of the manuscript. Sup- ported by NIH grants AI-26471 and RO1-AI- 24499. 15 February 1989; accepted 21 April 1989 damage (10). We have obsen,ed that PCP and MK-801 protect against this type of damage (11). However, the protected brains, although appearing normal in re- gions typically vulnerable to seizure-related brain damage, displayed neuropathological changes (vacuolization of neuronal cvrto- plasm) in the posterior cingulate and retro- splenial neocortices, changes that are subtly different from those typically associated with kainic acid treatment. Examination of the brains of control animals treated onlv with MK-801 or PCP revealed these same changes in cingulate and retrosplenial neu- rons, even though these animals had not been exposed to any convulsant and had not experienced any seizures. No such changes could be found in control animals that re- ceived no drug treatments. Because the vehi- cle was water (12), it could not have caused the changes. Therefore, we evaluated the possibility that PCP and MK-801 might have cytotoxic effects on CNS neurons. Adult, female Sprague Dawley rats (300 g) were injected subcutaneouslv (sc) with an aqueous solution (12) of MK-801 (0.05 to 1.0 mg per kilogram of body weight, sc) or PCP (0.5 to 5.0 mg/kg sc) and were killed 4 hours later for histopathological evaluation of the brains by light and electron microsco- py (13). Both compounds caused a dose- dependent vacuolar reaction detectable by light microscopy in cingulate and retrosple- nial neurons, the ED50 (14) being 0.18 mg/kg (0.12 to 0.24) (n = 36) for MK-801 and 2.83 mg/kg (1.72 to 3.93) (n = 36) for PCP. Adult, male Sprague Dawley rats (450 g) were also susceptible but at a slightly higher dose, ED50 being 0.32 mg/kg (0.25 to 0.39) (n = 24) for MK-801 and 4.29 mg/kg (2.87 to 5.70) (n = 20) for PCP. Electron microscopic evaluation of the affected neurons 2 to 4 hours after PCP or MK-801 treatment corroborated that the changes consisted of the formation of multi- ple vacuoles of heterogeneous size occupy- ing the cytoplasmic compartment (Fig. 1, A and B). At 2 hours, when vacuoles first became evident, it appeared that they were forming from saccules of endoplasmic retic- ulum, that mitochondria or other cytopias- mic components were being incorporated within them, and that the incorporated structures were undergoing a process of dissolution. At 4 hours, the cytoplasmic compartment of an affected neuron ap- peared to be packed with vacuoles and de- void of mitochondria. The vacuoles varied in diameter from 3 to 15 µm. A time course study by light microscopy revealed that the vacuoles were detectable 2 hours after a Pathological Changes Induced in Cerebrocortical Neurons by Phencyclidine and Related Drugs JOHN W. OLNEY, JOANN LABRUYERE, MADELON T. PRICE Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatorv amino acids such as glutamate and aspartate. There is growing interest in the potentiai application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP. T HE DRUG PCP, A DISSOCIATIVE AN- esthetic, is best known as an abused street drug with potent psychotomi- metic properties. PCP binds with high afl"in- itv and specificity to a unique class of mem- brane receptors in the mammalian central nervous system (CNS) (1), suggesting that the CNS may contain a vet to be identified PCP-like peptidergic neuromodulator and that dysfunction of this neuromodulatony system might underlie psychotic disorders such as schizophrenia (2). PCP receptors are colocalized with :'V-methvl-D-aspartate (NMDA) receptors (a subtype of glutamate receptor) (3), and PCP antagonizes NMDA receptor-mediated neuroexcitatory (4) and neurotoxic (5) phenomena. MK-801 is a PCP-like compound that displays even greater potency than PCP in binding to the PCP receptor and in antagonizing the excit- atory (6) and toxic (7) actions of NMDA. MK-801 or PCP can protect CNS neurons against hypoxic-ischemic, hypoglycemic, or epilepsy-related brain damage (all of which are postulated to be NMDA receptor-medi- ated processes) (8, 9). Here we report that, in addition to their potent neuroprotective properties, these agents induce pathomor- phological changes in certain CNS neuronal populations when administered subcutane- ously to adult rats. Treatment of rats with kainic acid causes persistent limbic seizures that result in a distinctive pattern of seizure-related brain i36o Department of Psvchiatny, Washington Univetsin' School of Medicine, St. Louis, MO 63110. 204 ~o~2ti2~ SCIENCE, VOL. 7.{--}.
Page 167: brs52e00
t A1-3 and A1-4 intron could render other target genes cold-sensitive as well. We have inserted these cold-sensitive introns into the Stu I site of the yeast URA3 gene ( UR-13- A13, UR.43:,114). As expected, the yeast strain having either the URA3-A13 or the URA3-A14 gene on a 2µ plasmid showed a cold-sensitive URA phenotype (Fig. 2C). It is not likelv that cold sensitivitv is due to the genetic background, since experiments with another nonisogenic strain gave the same results (14). In this report we have described an ap- proach to the control of gene expression by an artificial cold-sensitive intron. This ap- proach can be applied to foreign gene expression driven by a strong promoter whose expression is difficult to control. Fur- ther modification of the artificial intron will be necessarv, however, to obtain optimal expression in the induced state and no expression at the low temperature. This intron makes it possible for investi- gators to disrupt gene Function conditional- ly, which will be helpful in studying the function of essential genes and in isolating mutants. For mutagenesis, it may be neces- sary to mark the cold-sensitive intron with a genetic marker. In addition, the artificial intron can be modified in many other ways. For example, an operator sequence could be inserted to control transcription of a target gene by binding of a repressor. A native intron that has self-regulated splicing can also be used. Such a native intron cassette can be easily obtained by amplifying only the intron se- quence by polymerase chain reaction (PCR) methods (22). This type of native intron cassette as well as artificial introns would allow us to control any gene in yeast in a variety of ways. REFERENCES AND NOTES 1. G. R. Fink Cel149, 5(1987). 2. G. P. Larson et al., Gene 22, 31 (1983); R. Ng et al., Nature 314, 183 (1985). 3. M. D. Daveva et al., Proc. Nad. Acad. Sci. U.S.A. 83, 5854 (1986). 4. M. R. Green. Annu. Rev. Genet. 20, 671 (1986); R. A. Padgett et al., Annu. Rev. Biochem. 55, 1119 (1986). 5. R. Parker et al., Cell 49, 229 (1987 ); B. Seraphin et al., EMBOJ. 7, 2533 (1988). 6. C. W. Pikielnv et al., Cell 34, 395 (1983); C. J. Langford, F-J. Klinz, C. Donath, D. Gallwitz Cell 36, 645 (1984); J. Teem et a1., Nucleic Ands Res. 12, 8295 (1984). 7. J, L. Teem and M. Rosbash, Proc. Natl. Acad. Sci. U.S.A. 80, 4403 (1983); C. W. Pikielnv and M. Rosbash, Cell 41, 119 (1985). 8. U. Vijavraghavan et al., EMBO J. 5, 1683 (1986). 9. J. D. Boeke et al., Cell 40, 491 (1985). 10. L. Guarente and E. Hoar, Proc. Natl. Acad. Sci. U.S.A. 81, 7860 (1984). 11. R. J. Leer et al., Nudeic Acids Res. 10, 5869 (1982). 12. M. Rose et a/., Gene 29,. 113 (1984). 13. The 2µ plastnids were constructed as follows: An artificial intron was inserted into UR.43 on plasmid YIpS. An Sph I-Pvu II fragment containing URA3 was released from the plasmid, then cloned into the 1348 Sph I-Pvv II site of 1'Epl3, which contains the 2µ origin and LEL'2, 14. T. Yoshimatsu and F. Nagawa, unpublished obser- vations. 15. The Mbo II cleavage site at the initiation codon ATG of yeast PGK gene [S. M. Kingsman, Nudeic Acids Res. 10, 2625 (1982); R. A. Hitzeman et al., ibid., p. 7791] was converted to a blunt end with T4 polyrnerase, then ligated with the Nsi I linker (TGCATGCATGCA) in order to generate the Sph I site that overlaps with the initiation codon. The resuhing plasmid was digested by Sph I and treated with T4 polymerase to generate the blunt end just after the ATG. A Bgl II linker (GCAGATCTGC) or the artificial intron fragment (previously ligated with the Bgl II linker at the 3' end) was ligated to the blunt end. The fragments (1.7 kb and 1.6 kb) containing the PGK promoter and ATG with or without the intron were released bv Hind III and Bgl II, then ligated into the Hind HI-Bam HI site of plasmid pFN8 (25), which contains the Escherichia coli lacZ gene (from the eighth codon to the end) and URA3 as a selectable marker. The resulting plasmids were used to transform the veast strain NY6A (.YfATa, ura3-32, leu2-3, leu2-112, his4-519). 16. A 33-bp Pst I-Sna BI fragment containing the 5' consensus sequence 5' GTATGT 3' was released from the pUC-AI plasmid (Fig. 1). This fragment was inserted between Pst I and Klenow-treated Xba I sites of the pL'C _AI plasmid. The resulting plasmid is called pUC AI-1. 17. A 38-bp Sac I-Pvu II fragment containing the TACTA.AC box was released from the pUC-Al plasmid (Fig. 1). This fragment was inserted be- tvveen Sac I and Klenow-treated Xba I sites of the pUC-Al plasmid. The resulting plasmid is called pUC AI-2. 18. Plasmid pUC AI-1 (I6) was digested with Pst I and then treated with "Slow" Bal 31 nuclease (Takara shuzo) for 5 to 120 s. Xba I linkers were added to the ends, and the fragment containing the 3' half of the intron was released by Xba I and Sea I, then ligated with the Xba I-Sca I fragment of pUC-rli (which contains the 5' half of the intron). 19. Plasmid pUC AI-2 (17) was digested with Sal I and then treated with "Slow" Bal 31 nuclease as de- scribed (18). Xba I linkers were added, and the fragment containing the 5' half of the intron was released by Xba I and Sca I, then ligated with the Xba I-Sca I fragment of pUC-AI, which contains the 3' half of the intron. 20. Each plasmid containing a deleted intron was used to transform the yeast strain NY6A. Transformants were transferred to X-gal plates (24). Plates were then incubated either at 36'C or at 16'C for 3 days. 21. .41-3 retains a 13-bp inverted repeat. Al-I deriva- tives retaining 17-bp and longer or 10-bp and shorter inverted repeats were not cold-sensitive (14). AJ-4 retains a 17-bp inverted repeat. AI-2 derivatives retaining 21-bp and longer or 13-bp and shorter inverted repeats were not cold sensitive (14). 22. R. K. Saiki et al., Science 230, 1350 (1985); R. K. Saiki et al., ibid. 239, 487 (1988). 23. F. Sherman, G. R. Fink, J. B. Hicks, Methods in Yeast Genetics (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1986). 24. M. Rose and D. Botstein, Methods Enzymol. 101, 167 (1983). 25. F. Nagawa and G. R. Fink, Proc. :Vatl. Acad. Sn. U.S.A. 82, 8557 (1985). 26. We thank K. Miyoshi and T. Kawazoe for providing oligonudeotides, and Y. Shimura, D. A. Shub, and S. Ohno for critical reading of the manuscript. 22 December 1988; accepted 28 March 1989 Isolation of Single-Copy Human Genes from a Library of Yeast Artificial Chromosome Clones BERNARD H. BRORrNSTEIN,* C'sARY A. SILVERMAN, RANDALL D. LITTLE, DAVID T. BURKE,T STANLEY J. KORSMEYER, DAVID SCHLESSINGER, MAYNARD V. OLSOhI A recently developed cloning system based on the propagation of large DNA molecules as linear, artificial chromosomes in the yeast Saccharomyces cerevisiae provides a potential method of cloning the entire human genome in segments of several hundred kilobase pairs. Most applications of this system will require the ability to recover specific sequences from libraries of yeast artificial chromosome clones and to propagate these sequences in yeast without alterations. Two single-copy genes have now been cloned from a library of yeast artificial chromosome clones that was prepared from total human DNA. Multiple, independent isolates were obtained of the genes encoding factor IX and plasminogen activator inhibitor type 2. The clones, which ranged in size from 60 to 650 kilobases, were stable on prolonged propagation in yeast and appear to contain faithful replicas of human DNA. N APPLICATIONS THAT REQUIRE THE analysis of large tracts of genomic DNA, the yeast artificial chromosome (YAC) cloning system has a number of potential advantages over conventional cloning methods (1). Its open-ended capa- city for large inserts has allowed the cloning of segments of human DNA that are ten times larger than those that can be cloned in cosmids (1, 2). As a eukarvotic host, yeast provides a substantially different environ- ment than Escherichia coli in which to propa- gate the DNA of higher organisms. The ease B. H. Brownstein, D. T. Burke, M. V. Olson, Depart- ment of Genetics and Center for Genetics in Medicine, Box 8031, Washington Universiry School of ;viedicine, St. Louis, MO 63110. G. A. Silverman, Department of Pediatrics, Box 8116. Washington University School of Medicine, St. Louis. MO 63110. R. D. Little and D. Schlessinger, Department of Micro- biology and Immunology and Center for Genetics in Medicme, Box 8093, Washington University School of Medicine, St. Louis, MO 63110. S. J. Korsmever, Department of Medicine and Howard Hughes Medical Institute, Box 8045, Washington L'ni- versity School of Medicine, St. Louis, MO 63110. *To whom correspondence should be addressed. tPresent address: Department of Molecvlar Biology. Princeton, N7 08544. 204''7652o1z SCIENCE, VOL. 2-}.}
Page 168: brs52e00
dissimilar CNS distribution of sigma and NMDA receptors suggests that they are not colocalized or functionally linked. Thus, our evidence does not support involvement of sigma opiate receptors in the effects of PCP on cingulate cortical neurons but is consist- ent with involvement of the NMDA-PCP receptor-ion channel complex. Vacuolization in response to PCP or.MK- 801 becomes increasingly severe in the first 12 hours and then gradually diminishes in the next 12 hours; repeated treatment does not result in cumulative effects. Rather it appears that the vacuolar reaction, at least at low doses, mav be self limiting and is sub- ject to a mechanism wherebv, after a single treatment at a given dose, vulnerable neu- rons become insensitive to further treatment at that dose, unless the first and subsequent treatments are separated by a significant drug-free interval• This response profile has intriguing features of a tolerance phenome- non. Behavioral tolerance and apparent de- pendence-withdrawal phenomena have been reported in both monkeys and humans after self-administration of PCP (17). The above description of the time course and apparent reversibilin, is preliminary and is based onlv on light microscopic observa- tions. Our evidence pertaining to ultrastruc- tural changes in the rat is limited to an acute time interval (2 to 4 hours) after a single treatment with PCP or.\IK-801. However, because the changes noted at that time were quite striking, particularlv with respect to the apparent lytic degradation of the major- itv of mitochondria in the cytoplasm of affected neurons (Fig. 1B), an effect detect- able onlv by electron microscopy, we cannot rule out the possibility that other treatment regimens would result in progressive patho- morphological changes detectable only by electron microscopy. We are not aware of reports of neuropathological changes in hu- mans exposed to either PCP or ketamine (18). Because PCP causes schizophrenia-like psychotic symptoms in the human, the find- ing that specific neurons in the cingulate and retrosplenial cortices are selectively N•ulnera- ble to an apparent neurotoxic action of PCP potentially implicates these neurons in the psychotic effects of PCP and, conceivably, in the pathophysiolog}' of schizophrenia; that is, if it is a peculiarity of these neurons, in the human as in the rat, to respond patho- logically to PCP receptor stimulation, the pathological response might be expressed as a toxic psychosis when exogenous PCP is the stimulant, or as an endogenous psycho- sis (schizophrenia) when an endogenous PCP receptor ligand is the stimulant i 2). It is known that schizophrenics are sometimes remarkably unresponsive to pain (19), that a major function of cingulate cortical neurons is to mediate affective responses to pain (20), and that dissociative anesthetics (PCP and ketamine) are particularly effective in de- pressing pain appreciation at thalamocorti- cal levels (14). Benes et al. (21) have de- scribed structural abnormalities in the ante- rior cingulate cortex of individuals with schizophrenia. Whether such changes might also be present in the posterior cingulate or retrosplenial cortices of schizophrenics re- mains to be determined. The neuroprotective properties of PCP and MK-801 (5, 7, 8) have generated inter- est in using these agents for therapeutic or prophylactic purposes in various neurode- generative conditions, A major concern is the possibility that thev might induce psv- chotomimetic side effects. However, it has been reasoned that they might be used to protect against brain damage associated with stroke, cardiac arrest, or perinata] as- ph)xia because these are acute conditions in which the drug would only need to be given on a one-time basis, and, even if the patient were to suffer a transient psychosis, this might be acceptable in trade for protection against permanent brain damage. REFERENCES AND NOTES 1. J. P. Vincent, P_ G. Kartalovski, J. M. Katnenka, ,14. Lauiunski, Proc. .\'atl. Acad. Sci. U.S.•A. 76, 4b78 (1979); S. R. Zukin and R. S. Zukin, ibid., p. 5372. 2. T. L. O'Donohue et al., in Proceedings of the Ei,qhth Arnericart Pepride Symposium, D. J. Hrubv and D. H. Rich, Eds. (Picrce Chemical Co.. Rockford, IL, 1983), p. 433; S. H. Snvder, Nature 285, 355 (1980). 3. W. F. Maragos, D. C. 1M. Chu, J. T. Greenamvre, J. B. Pennev, A. B. Young, Eur, J. Pharrnacol% 123, 173 (1986): P. C. Contreras, R. Quirion, T. L. O'Dono- hue, Veatrosci. Latt. 67, 101 (1986). 4. D. Lodge and N. 1. Anis, Eur. J. Pharmacal. 77.203 (1982); D. Lodge et al., in Excitatory Amino Acid Transmissiort, T. P. Hicks et al., Eds. (Liss, New York, 1987), p. 83; J. Lehmann et al., ibid., p. 91. 5. J. W. Olnev et al., -Veurosci. Lett. 68, 29 (1986). 6. E. H. Wong et al., Proc. .Vatl. Aead. Sci. U,S,A. 83, 7104 (1986); J. A. Kemp, A. C. Foster. E. H. F. Wong, Trends Neurosci. 10, 294 (1987). '. J. Olney et al., Eur. J. Phannaml. 141, 357 (1987). 8. J. Labruvere et al., Soc. Nettrosci. Abstr. 12, 344 (1986); R. Gill et al., Neurosci. 7, 3343 (1987); J. J. Lawrence et al., Soc. Netaosci. Abstr. 13, 1079 (1987); J. W. MacDonald, F. S. Silverstein, M. V. Johnston, Bur, 1. Phantmml. 140, 359 (198;'i, C- Pazk, D. G. Nehls, E. Ozvurt, D. I. Graham, J. MeCulloch, Soc. Vetvosci. Abstr- 13, 1029 (19871; J. W. Olnev, C. Ikonomidou, J. L. Mosinger, G. Frierdich, J. Veurasci., in press; A. Kochhar, J. A. Zivin, P. D. Lvden, V. biazzarella, Arch. .\'eurol. (Chicaqo) 45, 148 i 1988); T. Wieloch, I. Gustafs- son, E. Westerberg, in Frontiers in F-~,citatory Arnino Acid Researdt, E. Cavalhiero, J. Lehmann, L. Turski, Eds. (Liss, New York, 1988), p. 715. 9. On the basis of the obsen-ation of H. Bem'eniste, J. Drejcr, A. Schousboe, and N. H. Diemer [J. .\'euro- chem. 43, 1369 ( 1984)] that endogenous glutamate and aspartate accumulate in high concentrations in the cxtracellular compartment of rat brain under cerebral ischcauc conditions, it is assumed that .tnv condition that reduces the energy resources of the brain mak• cause endogenous excitotoxins i tor exam- ple, glutamate .u d aspartate) to leak out of cells and accumulate in the extracellular compartment where they can exert excitotoxic action at receptors on the dendritic and somal surfaces of CNS neurons. Pre- sumablv, reduced efficiencv of energ}'-dependent reuptake mechanisms for the excitotoxins contrib- utes to the toxic accumulation of these agents. 10. M. P. Honchar rt al., Science 220, 323 (1983): J. W, Olnev et al., Basic :Llechanistns oj the Epilepsies: lfolecu- lar and Cellidar .ipproadtes, A. V. Delgado-Escueta- d. A. Ward, D. M. Woodburv, R. J. Porter, Eds. (Raven, New York, 1986), p. 857, 11. J. Labruvere et al., Soc. .\'etvosci. Abstr 12, 3-1-4 (1986); D. Clifford et al., ibid. 14, 863 (1988). 12. PCP, MK-801, and tiletamine were received in cn•stalline form as the hydrochloride and were dis- solved immediatelv before use in distilled water titrated to neutral pH (7.3 = 1) with NaOH. Our source of ketamine was the commerciallv avallable preparation, Ketalar (Parke, Davis), which comes dissoh•ed in isoronic saline with benzethonium chlo- ride (s0.1 mg/ml) added as preservative. 13. J. W. Olnev, J. 1V'etaopathoL Exp. Neurol. 30, 75 (1971), 14. ED~o (dose that caused vacuole formation in 50% of treated animals) was determined by linear regression analysis with the 25th and 75th percentiles defining the confidence limits. 15. Intormation pertaining to the use of ketamuie in anesthesia is summarized in The Physicians' Desk Reference (Medical Economics. Oradell, NJ, ed. 40, 1986), p. 1356. 16. The values given for MK-801. PCP, and ketatnine are from precioush, published works (5, '). The observations pertaining to tiletamine are from J. Olnev, J. Labruvere, and M. Price, unpublished data. 17. R. L. Balster, in Phencyclidine: An L'pdate [\'atl. inst. Dntg Abuse Res. Sfatogr, 64, 148 (1986)). 18. Ketamine has been used for a number of vears in human anesthesia and is not known to cause neuro- pathological changes in the brain; however, it does cause an "emergence" reaction (psychotic svmp- toms, including hallucinations) in approximatelv 12% of patients (15). Although such reactions n•pi- callv are transient, in some patients hallucinations recur unpredictably days or weeks after recovery from anesthesia [H. L- Price, in The Phannacological Basis o/ Therapeutics, L. S. Goodman and A. Giiman, Eds. (Macmillan, New York, cd. 5, 1975), p. 1011. Several decades ago, when PCP was briefly intro- duced into clinical medicine as an anesthetic, it was found to induce a similar "emergence" reaction in 30% of patients [F. E. Greifenstein, M. Devault, J. Yoshitake, J. Gajewski, Anesth. Analq. (Cleveland) 37. 283 (1958)j. The psychotic symptoms induced bv PCP, especiallv in subjects with a preexisting schizophrenic diathesis, may persist for many weeks after PCP exposure [P. V. Luisada, in Phenryclidine (PCP) Abuse: .9n Appraisal, ;VatL Inst. Drug Abuse Res. ,Lfonogr. 21, 241 (1978)]. That such prolonged psvchotoxic reactions to PCP in panicularlv suscep- able individuals might be associated with long- lasting struLYUral changes in cerebrocortical neurons warrants consideration. The fact that ketamme has a much shorter duration of action and is a relativefv w-eak ligand for the PCP receptor is consistent with the idea that ketaniine has a lower psychotosic and neurotoxic potential. 19. J. Apter, J. Med. Soc. .V.J. 78, 679 (1981); «'. .Marehand et al., .V. Engl. J. Med. 250, 680 i 19591: D. Fishbain, .9rut. Etnerqency ,tfed. 11, 630 { 1982). 20. B, A. Vogt, in Cerebral Cortex, A. Peters and E. G. Jones, Eds. (Plenum, New• York, 1985), vol. 4, pp. 89-149; J. C. White and W. H. Sw•eet, Pain and the . Nettro.aurqeon (Thomas, Springfield, IL, 1969); I. M Tumbull, Surq. Gynecol. Obstet. 134, 958 (1972). 21. F. M. Benes, J. Davidson, E. D. Bird, Arch. Gcn. Psychiatry 43, 31 (1986). 22. Supported in part by National Institute of Sfentai Health Research Scientist Award MH 38894 tJ.«'.O.) and National Institute of Drug Abuse grant DA 53568. We thank Merck Sharp & Dohme Laboratories for supplying MK-801. A. H. Robins Co. for supplying dletamine, and the National Insti- rute of Drug Abuse Research Technolog}• Branch for providing PCP. 21 February 1989; accepted 11 April 1989 r362 SCIENCE, VOL. ?.14 20 1 r01", ~ >1) 191.0 6-
Page 169: brs52e00
of his personal and professional papers shortlv before he died, Buckley was able to find a good deal of his personal correspon- dence in the papers of colleagues such as Robert Yerkes (Yale) and Adolf Meyer (Johns Hopkins). In addition, Buckley has skillfullv exploited a rich monographic liter- ature in the historv of psychology that has developed in the last 20 years as cultural and social historians discovered the potential of the history of scientific professions and as many psychologists turned to historical in- vestigation as a means of gaining needed perspective on their discipline. Mechanical Man definitively dispels a number of myths concerning Watson, such as the claim that he was dismissed from Johns Hopkins be- cause of controversial sex research. Buckley's biography is especially strong as a work of cultural historv that interprets Watson's popular appeal. Buckley does not have a strong interest in the historv of psychology as an intellectual discipline, however, and those who seek a more sympathetic account of Watson's achievements as a scientist may turn to Robert Boakes's Frorn Darwirt to Behaviourism: Psychology and the Minds of Ani- mals (Cambridge University Press, 1984) and to Watson's scientific publications. Bucklev provides a convincing case study, however, for those who believe that reduc- tionism is a poor strategy for intellectual historians regardless of their primary aca- demic aff'iliation. John Watson's science was an expression of his energetic and tortured search for self control and social status. Buckley shows why Watson wanted to ban- ish consciousness from intellectual dis- course, and why he failed. Mechanical Man deserves a wide audience. JAMES REED Departrnent of History, Rutgers University, New Brunswick, NJ 08904 Books Received The Anasazi in a Changing Environment. George J. Gumerman, Ed. Cambridge University Press, New York, 1988. xxii, 317 pp., dlus. $49.50. School of American Research Advanced Seminar Series. Based on a seminar, Santa Fe, NM, Oct. 1981. Animal Clinical Biochemistry. The Future. D. J. Blackmore et al., Eds. Cambridge University Press, New York, 1988. x, 386 pp., illus. 559.50. Les Automatismes Cognatifs. Pierre Perruchet, Ed. Mardaga, Brussels, 1988. 196 pp. Paper, BF 950. Psvchologie et Sciences Humaines. Basement Correlation Across the North Atlantic. Jean-Pierre Lefort. Springer-Verlag, New York, 1989. xii, 148 pp., illus., + plates. $59. Translated from the French by M. S. N. Carpenter. Cathedrals of Science. The Development of Colo- nial Natural History Museums During the Late Nine- teenth Centurv. Susan Sheets-Pyenson. McGill-Queen's University Press, Montreal, 1988. xii, 144 pp. + plates. $24.95. Cell Biology of Virus Entry, Replication, and Pathogenesis. Richard W. Compans, P.ri Helenius, and Michael B. A. Oldstone, Eds. Liss, New York, 1988. xx, 449 pp., illus. $86. UCLA Symposia on Molecular and Cellular Biology, vol. 90. From a symposium, Taos, NM, Feb.-March 1988. Dying for Work. Workers' Safety and Health in Twentieth-Centurv America. David Rosner and Gerald Markowitz, Eds. Indiana University Press, Bloomington, 1989. xx, 234 pp. Paper, $10.95. Reprint, 1987 ed. Forensic Engineering. Kenneth L. Carper, Ed. Else- vier, New York, 1989. xviii, 361 pp., illus. $46.95. Image Recognition by Holography. G, I. Vasilenko and L. M. Tsibul'kin. Consultants Bureau (Plenum), New York, 1989. x, 332 pp., illus. $85. Translated from the Russian bv Albin Tvbulewicz. Mental Illness and Substance Abuse, A Profile of Health and Disease in America. Wrvnn Smith. Facts on File, New York, 1989. xii, 174 pp., illus. $35. Pesticides and Polities. The Life Cvcle of a Public Issue. Christopher J. Bosso. Universit,v of Pittsburgh Press, Pittsburgh PA, 1989. xvi, 2941p. Paper, $14.95. Pitt Series in polic}~ and InstitutionaStudies, Reprint, 1987 ed. The Skin Ego. Didier ?.nzieu. Yale University Press, New Haven, CT, 1989. vi, 246 pp. $30. Translated from the French edition (Paris, 1985) by Chris Turner. Theories of Carcinogenesfs. Olav Hilmar Iversen, Ed. Hemisphere, New York, 1988. xxii, 327 pp., illus. $59.95. Theories on Alcoholism. C. Douglas Chaudron and D. Adrian Willcinson, Eds. Addiction Research Founda- uon, Toronto, 1988. xxxviii, 498 pp. Paper, $49.50. Theory and Application of Microbiological Assay. William Hewitt and Stephen Vincent. Academic Press, San Diego, CA, 1988. xiv, 323 pp., illus. $45. Getting biosequence information has never been easier! Now you can receive important protein, peptide, and nucleotide sequence information from both journals and patents! CAS Biosequence Informa- tion will give you on-demand, custom searches of amino acid and DNA/RNA sequence databases. Our team of experts will search for you on GenBank, EMBL, PIR, and the new sequence file from Chemical Abstracts Service, containing protein and nucleotide data from patents since 1981. We'll give you homology search results, including similarity scores and sequence alignments, with bibliographic references. You can choose expedited delivery, such as express mail or telefax. Call for more information, 800-848-6538, ext. 3707 or 614-447-3707. CAS Biosequence Information from Chemical Abstracts Service" Chemical Abstracts Service is a division of the American Chemical Society. i 16 JUNE 1989 Circle No. 241 on Readers' Service Card BOOK REVIEWS 1387
Page 170: brs52e00
Products &;Materials Solar-Powered pH Meter Model 100500 is a pH meter with a precision of 0.01 pH unit that operates by solar power. Its replaceable electrode is at- tached by a 1-m-long cable so that it can be easily immersed. The end of the electrode has a miniature bayonet Neil-Concelman (BNC) connector. Ordinary laboratory or outdoor lighting can power the 100500, and the power supply's power reserve lasts as long as 200 hours. The meter measures 107 by 34 by 19 nun and weighs 0.2 kg. The model 100500 features 0° to 50°C manual temperature compensation and cali- bration and slope fimctions. $149. Extech Instruments. Circle 482. Software for Mathematical Surfaces, Vector Fields Fields&Operators is a software package for demonstrating visually the action of a differential operator in three dimensions. It can instantly compute and display the diver- gence, gradient, curl, Laplacian, or time derivatives in closed form. It also supports dot products, cross products, and integral flows. Fields&Operators can also generate and store a sequence of frames, then play them back. $59. Lascaux Graphics. Circle 486. Densitometry Software Scan Analysis is a software package for densitometry analysis for gel electrophore- sis, autoradiography, or thin-layer chroma- tography. Images are acquired by a Thun- derScan scanner, MacVision, and a Quick- Capture video digitizer or gray-scale scan- ner. The program can integrate user-selected Newlv offered instrumentation, apparatus, and lab- oratorv materials of interest to researchers in all disci- plines in academic, industtial, andgo vernment organiza- nons arc featured in this space. Emphasis is given to purpose, chief characteristics, and availabilitv of prod- ucts and materials. Endorsement bv Science or AAAS is not implied. Additional information may be obtained from the manufacn rers or suppiers named by circling the appropriate number on the Readers' Sen•ice Card and placing it in a mailbox. Postage is free. regions on polyacrytamide and agarose gels and also has an automatic peak-sensing mode. Data files may be imported directly into word processing and spreadsheet pro- grams. Plots are stored in PICT format, which is readable by most graphics pro- grams. Scan Analysis operates on Macintosh 512KE, Plus, SE, II, and IIx computers equipped with version 6.0 or later of the system folder. 5399. Biosoft. Circle 483. Computer Interruption- Protection Hardware The UniSaver 100 is a computer peripheral that automatically freezes data, program, and memory if power is interrupted. It then shuts down the computer until power re- turns, at which time it restores the previous- ly executing program at the precise point at which it was interrupted. The UniSaver 100 accomplishes this by transferring conven- tional memory into nonvolatile random- access memory (RA.~.) and transferring ex- panded or extended memory onto the hard disk. An internal battery holds the informa- tion in RAM for at least a week. Then, when power is restored, the system transfers ev- erything thus saved back to computer mem- ory. No data are lost. The peripheral is especially appropriate for long-duration cal- culations in which loss of data would be verv inconvenient or disastrous. The UniSaver 100 operates on the IBM PC family, PS/2 model 25, PS/2 model 30, and compatible computers. $1195. Universal Vectors. Cir- cle 478. IgG Purification Kit MAbTrap G purifies monoclonal and po- lyclonal immunoglobulin G(IgG) from as- cites fluid, serum, and cell culture superna- tants in one step. The kit comes with the buffers already prepared and the disposable column already packed. The packing binds only IgG and its subclasses, separating out albumin and immunoglobulins A, M, and D. The MAbTrap G kit contains enough materials to perform at least 20 purifica- tions. Pharmacia LKB Biotechnology. Cir- cle 480. Desktop RISC Workstation The SPARCstation 1 is a RISC (reduced instruction set computing)-based super- computing UNIX workstation that operates at 20 MHz and is smaller than an IBM PC. Its floating point coprocessor performs ap- proximatelv 1.4 million floating-point oper- ations per second (MFLOPS), double-preci- sion Linpack. Also, the workstation can draw 400,000 nvo-dimensional vectors or 175,000 three-dimensional vectors per sec- ond. Yet, the system draws only as much power as a lightbulb does. The system fea- tures an IBM-compatible 3.5-inch floppy disk drive, built-in digital audio capability, DOS sofnvare emulation, preloaded operat- ing system, two serial ports, and two ports for Ethernet and SCSI-II peripherals. Be- cause the workstation is binary compatible with all Sun-4 products, the more than 500 sofnvare programs available for the Sun-4 also operate on the SPARCstation 1. From $8995. Sun Microsystems. Circle 479. Literature Glass Biocatalyst Carrier Biomat is a data- sheet about a glass-mat biocatalyst carrier for eukarvotic cell culture applications. Manville BioChem Products and Services. Circle 493. XRF News is a semi-annual newsletter of x-ray fluorescence applications and instru- ments. Kevex Instruments. Circle 494. SteriIGARD Class II, Type A/B3 is a brochure about a laminar-flow biological safety cabinet. Baker. Circle 495. Portables is a catalog of small pH meters, dataloggers, conductivity meters, oxygen meters, calculators, and labware. Markson. Circle 496. STN 'hlentor: STN Overview is a comput- er tutorial for searching the STN database with a Macintosh computer. Chemical Ab- stracts Service. Circle 497. Downstream Processing of Biornaterials with Centrifiigal Partition Chromatography is a re- port that describes methodologies for sepa- rating, isolating, and purifying products of genetic engineering and biotechnology. Sanki Laboratories. Circle 498. SEPA CF Membrane Cell is a product bulletin about a laboratory-scale cross-flow membrane filtration unit. Osmonics. Circle 499. SIL-9A Auto Injector is a 10-page brochure about a stand-alone automation system for high-performance liquid chromatographs. Shimadzu Scientific Instruments. Circle 500. Cell Culture Media Filtration is a brochure featuring filters and devices for prefiltration and sterilization of cell culture media, vacu- um line protection, and bioreactor venting for the prevention of airborne contamina- tion. Gelman Sciences. Circle 502. Living HPLC Catalogue features polymer- based high-performance liquid chromatog- raphy (HPLC) columns. Hamilton Bona- duz (Switzerland). Circle 503. SCIENCE, VOL. 24.} 1 1388 204l V:J 2 V i1 O
Page 171: brs52e00
POSITIONS OPEN POSTDOCTORAL RESEARCH ASSOCIATE in plant molecular biolog~ . A research position is available to study the moleculaz genetic events associated with maturation, or phase change, in conifers. This research is part of an ongoing collaborative effort to understand the genetic basis for growth and development in the conifer- ous plants. Funding is available for 2 years, with salary being dependent upon quali.ficatioiu (522,000 to 525,000). Experience in molecular genetic techniques is desirable. Send curriculum vitae and the names of three references to: Dr. Keith W. Hutchi<on, Department of Biochemistry, 177 Hitchner Hall, University of Maine, Orono, ME 04469. Telephone: 207-581- 2827. An Equal Opportunity/Affinnative Action Employer. U.S. DEPARTMENT OF AGRICULTURE (USDA) AGRICULTURAL RESEARCH SERVICE TWO POSTDOCTORAL RESEARCH ASSO- CIATE POSITIONS are open in the Plant Molecular Biology Laboratory, USDA, Beltsville, Maryland. (i) Molecular biologv of the regulation and synthesis of ethylene during senescence (P.I. Autar Mattoo). See PNAS 85, 8810 (1989) and Senescence and Aging in Plants (Nooden and Leopold, Eds.), pp. 241-280 (1988). (ii) Molecular biology of cell-spectfic and devclopmentally regulated genes in soybean (P.I. Mark Tucker). See Plant Physiolqqy 88, 1257 (1988) and Plant Molecular Bioloqy 9, 197 (1987). Salaries arc 528,852 per annum. Send curriculum vitae and three letters of reference to: Dr. A. K. Mattoo, Research Leader, Plant Molecular Biology Laboratory, USDA, Building 006, Room 200, BARC-West, Beltsville, MD 20705. Applications must be marked 9E008. An E.p al Oppommity Employer. RESEARCH ASSOCIATE POSITIONS available immediately for cvtokine immunologist, biochemist and molecular biologist to purifv and characterize mediators of immunosuppression and study molecular aspects of host-cell invasion by parasite. Send curriculum vitae and the names and addresses of three references to: Dr. F. Kierszenbaum, Department of Microbiologv, Michi- gan State University, East Lansing, MI 4$824. An Equal Opponunity/Affinnative Action Employer. RESEARCH FELLOW IN ENDOCRINOLOGY DIVISION OF NUTRITION AND ENDOCRINOLOGY A postdoctoral position is available to study the inter- actions of dietarv lipids and hormones in human breast cancer, and investigate the effects of antiestrogens on the synthesis of specific hepatic proteins. Experience in endo- crine assay techniques and/or steroid biochemistrv is required. This aPpo or ntment is well su ted to an individual sttking etther a career n clin cal laboratoryendocrinol- ogv basic endocr ne reseazch at a modern, well- eqiupped research facifitv located in northern suburb of 1`ew York Citv. Please submit curriculum vitae to: Dr. David P. Rose, Division Chief American Health Foundation Division of Nutrition and Endocrinology 1 Dana Road Valhalla, NY 10595 An Equal Opportunity Employer .'vf/F/H/V. RESEARCH SCIENTIST-conduct research to in- vesrigate how phosphorylation of erythrocyte membrane skeleton controls entrv of malarial parasites into ervthro- cytes from panents with hereditary disorders. Duties include supervision of students, te;hnicians, and other research associates in the laboratory, as well as teaching courses at a leading medical school. Requirements in- clude Ph.D. in biochemistrv or related field with at least 3 years of postdoctoral research experience in the above; strong background in erythrocyte cytoskeleton; phos- Phon'lation of inembrane proteins and malarial parasite tnvasion assavs; detailed knowledgc of the techn ques of protein chemistry and immunodhemistry including FLPGHPLC; immunoassays; as well as cloning and sequencing of membrane proteins. Salary: 532,000 per year. Forty hours per week. Respond with resume only to: Job Order #9884, Massachusetts Department of Employm ent and Training, Special Programs Depart- ment, 19 Stani.ford Street, Boston, MA 02114. 16 JUNE 1989 PROJECT SCIENTISTS NSI'Ibchnology Services Corporation is recruiting Project Scientists for the Global Climate Change Program in Corvallis, Oregon. Incumbents will assume a leadership role in developing and implementing team research along with publishing results in peer-reviewed journals. Biogeographer: PhD in plant geography, plant ecology, plant physiology, biogeography, paleoecology, climatology, or related field. Preference will be given to those with research experience in synoptic climatology, or in determining the factors limiting the distribution and abundance of species. Experience work- ing at a variety of spatial and temporal scales, and a background in remote sen- sing or computer simulation are desirable. Landscape Systems Scientists (2 vacancies): PhD or equivalent experience in earth sciences (watershed sciences, ecology, geography, or related field). Preference will be given to those with a demonstrated ability to perform spatial analysis of watershed or ecological systems. Background in remote sensing, image processing, geographic information analysis, artificial intelligence or ex- pert systems is advantageous. Physical Climatologist: PhD in physical climatology or related field. Preference will be given to those with expertise in surface boundary la, er processes and some background in water resource science. Background in remote sensing or quantitative analysis, and experience working at a variety of spatial and tem- poral scales is advantageous. Limnologist/Aquatic Ecologist: PhD in limnology, aquatic chemistry, en- vironmental engineering, aquatic ecology or related field. Preference will be given to those with expertise in aquatic biogeochemistry in both lake and stream systems. Background in quantitative analysis and assessment, and experience working at a variety of spatial and temporal scales is advantageous. Agricultural Scientist/Soil Scientist (2 vacancies): PhD in agronomy, agriculture. soil science, or related field. Preference will be given to those with expertise in one or more of the following: quantitative analysis of the response of crops to changes in their physical environments; agricultural soils; and transport of pesticides, nutrients, and soil from agricultural sites. Background in spatial analysis, computer simulation, or remote sensing, as well as experience in a variety of spatial scales and agricultural systems, would be advantageous. Ecophysiologist/Plant Physiologist: PhD or equivalent experience in botany, ecology, chemistry, plant physiology, plant biochemistry, environmental engineering or related field required. Applicant must have technical experience with measuring gas fluxes from plant foliage. Background in remote sensing and geographic information systems is advantageous. Systems Ecologist: PhD in biological sciences, preferably in population, com- munity, ecosystem, landscape or regional ecology. Knowledge of factors affec- ting biodiversity, and a high level of computer literacy required. Experience in a variety of ecological systems, as well as a background in remote sensing and geographic information analysis, would be advantageous. Water Resource Scientist: PhD and two years of experience or equivalent ex• perience in water resource science or related field. Preference will be given to those with expertise in synthetic hydrology or stochastic methods for distributing hydrologic processes across large regions or landscapes utilizing remote sens- ing and geographic information systems. Experience in analyzing water resource- climate interactions at a variety of spatial and temporal scales, as well as a background in computer techniques, would be advantageous. Application materials are to include cover letter (specifically relating qualifica- tions to above position), curriculum vitae, and the names, addresses, and telephone numbers of three references. Initial review of the applications will begin July 1. 1989 and collection of applications will continue until each position is filled. Human Resources NSI Technology Services Corporation 200 SW 35th Street Corvallis, Oregon 97333 A subsidiary of Man Tech International Corp. An EEO Employer
Page 172: brs52e00
fff,~l ' fs.'~. -~ f .1 1 f ~ ~ }-~ . . ~'` c'-1~11T~-'.. { ..TG __~N1 I L.I _I_C}NS OF I-R'ES. ~r F` YOUR TuR.. ~ ~. -~ -~t Pr~crrt N1uloKir tudrv ~~imtr'rrrng tltr r1r~i~ar. mrutufarturP i ~ f I ~ q nui nunkvtJrt-z ujvarriur.+ ... eo(dti+Nrated, thrs)vrkaxgin,q ~~ru~(r\ livrs-right riuru. - I .41 l'raxt,, tvu'll help impr„vr the rlualitt' oja lot o(Iivrti. Inclttdirtz 1 wat uu~rt. Our Nurltr,ler, .A'Y'rrsearrh liuilitv is located wiihitt j- --- vasc rvruh nJ some of A'nu ybrk sYatr't most attrnr/itw rttlluraL . . ,•dunNir- and rorrrrttiutt rronurrrc ..... MOLECULAR BIOLOGY/ GENETICS 11'c• arc 1nokinK fitr a 1'h.l). " ith 2.5 vears' experiencc n ihe nxilecular binlog Nt/genetics of expressiuu of' foreigu nes i bin ct t b i l n recum ge an .i er .t srstems. IMMUNOLOGY nced an ImmunodnKi+t no decelop and mwnitor ° ~tINAir I cell retprnIc•, ancilt r mucttsal immw in t~ '.,!, iou, nutdidate• %ac( ine aniif;eu, in e\perimentaI U .iniin; l. 1'nu should h.ne;t I'h.l), in Immunnlc t,n ~cith -") w,u•.' eAperience in e•caluutiug cell meeii:ued immwtit.: I,prticntc• in oot'king o ith lg.-1 ct'stems is a plu+. ~ 1i Pra.ti~. %ou'l1 anjoc a urolessional utmosphere unel ihc ~ kind ol.alan und I>c•nefits pack,iKe %nu'd expect Crom t . ~ in<lir.nc leader. I'Icau• c•ncl cuwrecuntc to: Human ~. Resources Department. 300 East Riser Rd., Rochester, ~ NY 14623.:\n Equ,tl Upptirtunin lanplrnrr \1/E , F R A X B i0t. 0 G t ca ~ The Sartorians say new labs need perfect balance. Your new lab is about to take its first steps into the world of science. The Sartorians can help you start off on the right foot with absolute precision and accuracy. The Sartorians bring you perfect balance. In fact, from heavy-duty floor balances to ultra-sensitive super micros, the Sartorians offer the world's most technologically advanced scientific balances. This is no time to waver Call us at (800) 544-3409 and find out about how the Sartorians can give your lab perfect balance. We'll send you complete information. sart401rius perfect balance. RESEARCH SCIENTISTS CoCensys Inc. is an innovative start-up company focused on the frontier of molecular therapeutics as it relates to diseases of the central nervous system (CNS). We are seeking highly motivated research scientists to add to our outstanding scientific team. Research and developement will be con- ducted at the University of Southern California Health Sciences Campus. Current opportunities include: MEDICINAL CHEMISTRY - SENIOR SCIENTIST AND RESEARCH ASSOCIATES Synthetic organic chemist at the Ph.D. level and research as- sociates (MS/BS) with at least 2 years experience desired. Individuals with experience in the preparation of prodrugs for CNS active agents preferred. NEUROPHARMACOLOGY - RESEARCH ASSOCIATE MS degree or BS with 2 or more years of research experi- ence in neuropharmacology or a related area is essential. Knowledge and experience in the in vivo and in v't screen- ing of CNS active agents preferred. We provide highly competitive industrial scale salaries/fringe benefits in an academic setting. Send resume and three ref- erences in strictest confidence to: Personnel Director, CoCensys Inc., Box 123, USC School of Pharmacy, Los An- geles, CA 90033-1086. CoCensys is an equal opportunity employer. C oCen s BUILDING A N EW LAB? LET THE SCIENCE FREE PRODUCT INFORMATION SERVICE PUT YOU IN TOUCH WITH THE VENDORS WHOSE PRODUCTS YOU WILL NEED. SIMPLY WRITE US A LETTER STATING THE SPECIFICS ABOUT YOUR PROPOSED LAB AND WE WILL DO THE REST. WRI TE TO: SCIENCE MAGAZINE NEW LAB SERVICE DEPT. 1515 BROADWAY NEW YORK, N.Y. 10036 ~
Page 173: brs52e00
fYas rerersrbe in ttuee of six patches. Thus P1CC-dependent inactivation of C1- chan- nels is normal in CF. Our data allow us to draw several infer- ences about regulation by PKC of C1- chan- nels in normal and CF cells (Fig. 3). The inactivated (2) Cl- channel (Fig. 3A) can be activated by membrane depolarization via an unknown mechanism or by phosphorylation with PKA (Fig. 3B). At low Ca`+ concen- tration, PKC also activates the channel (Fig. 3B). At high Ca2+ concentration, PKC maintains the channel in an inactivated state (Fig. 3C): it prevents activation by depolar- ization; it prevents or attenuates activation by PKC and PKA; and it inactivates chan- nels that were previously activated by depo- larization, PKA-dependent phosphoryl- ation, or (low Ca' ') PKC-dependent phos- phorylation. Both activation and inactiva- tion appear to result from phosphorylation; neither can be explained by down-regulation of PKC. There are several possibilities to explain the different effects of PKC on the Cl- channel. The channel may have two different phosphon'lation sites for a single PKC, and Ca2+ might determine which site is phos- phorylated. This could happen in any of several ways. (i) CaZ ` might change channel conformation, making different sites accessi- ble to PKC. (ii) Since the Ca'`' dependence of PKC can be influenced by the nature of the substrate (15), the phosphorvlation site on the Cl- channel might determine the Ca`+-dependence of the enzyme. (iii) The interaction of PKC with the membrane might be Ca'`' dependent: in the absence of Ca'`+ PKC could phosphorylate an extrin- sic site on the channel (or on a regulatory protein) and in the presence of Caz+ PKC might phosphorvlate a site on the channel that is associated with the membrane. Alter- natively, different effects could be caused by isozvlnes of PKC (16) that phosphorylate different sites-a Ca2+-independent form that activates the channel and a Ca'-'-depen- dent form that inactivates the channel. The purified PKC preparations we used proba- bly contained more than one isozvme (12, 17). Each of these alternatives require that PKC show substrate specificiry (18) for two different phosphorylation sites on the chan- nel: one activating and one inactivating. Dual regulatory effects of PKC (stimulation and inhibition) have also been proposed for a cardiac Ca'`+ channel (19). The demonstration that PKC, in the pres- ence of high Ca'-+, can cause channel inacti- vation raises the question of whether an abnormal interaction between PKC and the Cl- channel is responsible for the regulatory defect in CF. We cannot be certain, but we speculate that this is unlikely because depo- Iarization-dependent activation is normal in cystic fibrosis, but depolarization does not activate channels in the presence of PKC. The observation that channels from pa- tients with CF cannot be activated by either PKA or PKC at low Ca`~ concentration suggests that both enzymes might regulate the Cl- channel at the same site (20). Ab- normal regulation by these two enzyTnes suggests a defect in CF either in the ability of the channel to become phosphorvlated or in the mechanism bv which phosphorylation results in channel activation. REFERENCES AND NOTES 1. M. J. Welsh, Physiol. Rev. 67, 1143 (1987). 2. We refer to an inactivated channel as one that is unstimulated or quiescent, and always in the closed state. There mav be more than one inactivated state, but thev are electrically indistinguishable. An acti- vated channel is one that has been stimulated and spontaneously flickers back and forth between the open and closed state. 3. M. Li et al., .Nature 331, 358 (1988); R. A. Schou- macher et al., ibid. 330. 752 (1987). 4. M. J. Welsh and C. M. Liedtke, ibid. 322, 467 (1986); M. J. Welsh, Science 232, 1648 (1986); R. A. Frizzell et al., ibid. 233, 558 (1986). 5. M. J. Welsh and R. B. Fick, J. Clin. Invest. 80, 1523 (1987); R. C. Boucher etal., Lung 161, 1(1983); P. M. Quinton, Nature 301, 421 (1983). 6. U. Kikkawa and Y. Nishizuka, Annu. Rev. Cell Biol. 2, 149 (1986)- 7. J. Farley and S. Auerbach, Nature 319, 220 (1986); C. Hammond et al., ibid. 325, 809 (1987); S. A. DeRiemer et al., ibid. 313, 313 (1985). 8. M. P. Anderson and M. J. Welsh, FASEB J. 3, A562 (1989). 9. The Cl- channel in the apical membrane of airway epithelium has a higher conductance for I- than for CI-, and I- is not carried by the anion cotransporter [J. H. Widdicombe and M. J. Welsh, Am. J. Physiol. 239, C112 (1980); J. P. Clanca' and M. J. Welsh, in preparation]. "I- efliux was stimulated by secre- tory agonists and cAMP, stimulated efflux was volt- age-dependent, and efflux was inhibited by agents that inhibit the apical Cl- channel but not by inhibitors of CI' cotransport [J. P. Clancv, M. Li, J. D. ~icCann, FASEB J. 3, A562 (1989)]. Airway epithelial cells were studied 3 to 4 days after plating on cover slips. Cells were washed with a standard solution containing 135 mA4 NaCI, 1.2 m.bf CaC1E, 1.2 mA4 MgCl,, 2.4 m:L1 KzHPOa, 0.6 mAl KHaPO,, 10 mM glucose, and 10 m.W Hepes (pH 7.4 with NaOH). Cells were loaded with tracer by incubation in standard solution containing "SI- (15 µCl7ml) for 1.5 to 2,0 hours. Tracer loading and experiments were performed at ambient CO, and room temperature. C;ells were washed and then effiux was measured by transferring the cover slips through a series of petri dishes containing 3 ml of standard solution and the desired reagents. The radioactivity in the el$ux solutions and cell h'sate was measured, and results were normalized as per- cent effius per minute (cpm of efflux in each petri dishttotal available counts at the beginning of that interval times the length of the interval in minutes). 10. In parallel experiments, cellular levels of c AMP were measured with an assav kit (Amersham Internation- al, United Kingdom). Baseline cAMP was 1.6 = 0.5 and 1.7 = 0.4 pmol of cAMP per milligram of protein for control cells and for cells exposed to 100 rvLf PM.S for 10 min, respectively. Addition of 10 µ,kf forskolin plus 500 µ.V IBMX increased cAMP to 46.2 t 1.8 and 57.9 = 11.3 pmol of cAMP per milligram of protein for control and PMA-exposed cells, respectively. Data are means of three experi- ments, each pertormed in triplicate. 11. M. J. Welsh, Am. J. Physiol. 253, C828 (1987); R. A. Barthelson et al., ibid., p. C802. 12. Highly purified PKC was prepared from mouso brain [U. Kikkawa, Y. Takai, R. Minakuchi, S. Inohara, Y. Nishizuka, J. Biol. Chem. 257. 13341 (1982)] or from rat brain [J. R. Woodgett and T. Hunter, ibid. 262, 4836 (1987)]. PKC was partiallv purified through the DEAE-cellulose step [T. P, Thomas, R. Gopolakvishna, W. B. Anderson, -Veth- ods Enzymol. 141, 399 (1987)] from canine trachea. The purified preparations transferred approximately 3 µmol of 3-P per tninute per mi.lligram of protein; the final concentration in the solution bathing the patch was 0.25 µg of protein per millliter. The canine epithelial preparation transferred approxi- matelv 220 pmol of 32P per minute per milligram of protein; the final protein concentration in the solu- tion bathing the patch was 6 µg per milliliter. Purified PKC was stored at -70°C and thawed immediately before use; canine tracheal PKC was prepared and used the same day. PKC and cofactors were added to patches after excision from the cell. 13. Activation has been reported by T. C. Hwang et al., FASEB J. 3, A1149 (1989). 14. The order of addition of PKC, ATP, and PMA or diac,'lglycerol was varied. In nine patches channels remained active when a single agent was added, but then inactivated after addition of the other two. In nine other patches, two of the three agents were added, but the channel did not inactivate until the third agent was added. 15. M. D. Bazzi and G. L. Nelsestuen, Biochemistry 26. 1974 (1987). 16. Y. Nishizuka, Nature 334, 661 (1988). 17. Y. Kosaka et al., Biochetn. Biophys. Res. Cornmun. 151, 973 (1988); S. Ohno, Y. Akita, Y. Konno, S. Imajoh, K. Suzuki, Cell 53, 731 (1988). 18. There are suggestions that PKC isozymes show substrate specificitv [K.-P. Huang, F. L. Huang, H. Nakabayashi, Y. Yoshida, JBiol. Chem. 263, 14839 (1988)]. Substrate specificity for isozvmes of catalvtic subunit of cA'vSP-dependent protein kinase has been demonstrated [T. Toda, S. Cameron, P. Sass, M. Zoller, M. Wigler, Cell 50, 277 (1987)]. 19. A. E. Lacerda et al., Nature 331, 249 (1988). 20. By "site" we mean a region of the channel or an associated protein. However it is possible that the site might be the same amino acid residue; there is a precedent for phosphorvlation of an identical resi- due by PKC and PKA on tvrosine hydroxylase [K. A. Albert et al., Proc. Nat(. Acad, Sci. U.S.A. 81, 7713 (1984); D. G. Campbell, D. G. Hardie, P. R. Vulliet, J. Biol. Chem. 261, 10489 (1986)]. 21. We used the excised, inside-out single-channel patch-clamp technique [O. P. Hatnill, A. Marty, E. Neher, B. Sakmann, F. J. Sigworth, Pfieugers Arch. 391, 85 (1981)] adapted for airway epithelial cells (3, 4). The pipette (external) solution contained 140 m:W NaCI, 2 m.Vf MgCla, 2 mM CaCIZ, and 10 mAf Hepes (pH 7.4 with NaOH). The bath (intemal) solution contained 140 mM NaCl, 2 mM MgCl,, and 10 m.1-f Hepes (pH 7.3 with NaOH). Intemai estimated free Ca'-` concentration was I µ:11 (0.87 mlvf CaCIZ and 1 md-f EG'I'A), 150 nlll (0.5 m:Li CaCl, and 1 m.Af EGTA), or <10 n:tif (no added CaCl, and 0.5 m'l4 EGTA). Cells were studied at room temperature (21° to 23°C) 1 to 4 days after plating. Voltages are reported in reference to the external surface of the membrane. Cells from canine tracheas, from nasal polyps and tracheas of normal subjects, and from patients with CF were obtained, isolated, and cultured [C. M. Liedtke and B. Tandler, Am.J. Physiol. 247, C441 (1983) and (4)]. Cells from eight dogs, five normal humans, and four subjects with CF were used. Patch-clamp studies with dog and normal human cells were identical; therefore they are combined in the tables. CI- channels were identified by their 1-V relation (in- duding conductance and characteristic outward rec- tification), activation by depolarization, and, in a few cases, by their ion selectivity (3, 4). 22. We thank P. Karp and G. Wascovich for technical assistance. Supported by grants from the NIH (HL29851, HL42385, DK27651, and MH39327) and the National Cystic Fibrosis Foundation. LD.M. was supported by the March of Dimes Birth Defects Foundation. J.P.C. is an American Heart Association student fellow. 7 February 1989; accepted 27 April 1989 1356 204 ~ U _ 2 0 ~ ~ SCIENCE, VOL. Z4-~}
Page 174: brs52e00
POSI710NS OPEN INS'TRUCTOR--TROPICAL ECOLOGY The Or~anization for Tropical Studies (OTS) seeks a tropical biologist to provide leadership and continuitv for Tropical Biology: An Ecological Approach, an 8-week field course taught in Costa Rica. The half-time position is for 2 years, possibly renewable, with responsibility for coordination of four successive courses beginning as early as January 1990. Ruearch and teaching experience in neotropical biology required; previous experience with OTS courses preferred; candidate must be bilingual to work effectively in Latin America. Send curriculum vitae, names of three referees, and a letter of interest to: Dr. Lucinda McDade. OTS, Box DM, Duke Station, Durham, NC 27706, Telephone: 919-684-5774. Deadline 15 Julv 1989. Equal OpportunityiA~'innative Action. MOLECULAR BIOLOGIST A position is available 1 August 1989 for a person, preferablv with a Ph.D. degree, with molecular biology background. Research project includes the demonstra- tion of the role of cvtokines (IL-1, II.-6, TNF, IFN-y) in human endometrial ph~~siology and function, as well as the relation to the effect of sex-steroid hormones. Send curriculum vitae to: Dr. S. Tabibzadeh, Department of Pathology, Mount Sinai Services, Elmhurst Hospital Center, 79-01 Broadway, Elmhurst, NY 11373, or call 718-830-1685. An Equal Opportunity Employer. NEUROSCIENCE BAYLOR COLLEGE OF MEDICINE The Division of Neuroscience was formed in Januarv 1989 as an inde endent, basic science division of the medical school. ~,'c are now embarking on a major Egram of expansion in the areas of structure and cnon of the central nervous system. Our initial re- cruiting efforts will be directed towards neuroscientists investigating aspects of hippocampal anatomy, bio- chemistry, t~ehavior, elcctrophvstolog5~, or modeling. Successfiil applicants will join a facttlry working in a highly interactive and congenial environment within a major medical center and will be expected to develop a vigorous research program in their area of specialization. Teaching responsibiliues are minimal. and excellent op- portuniucs exist for interactions with scientists in other basic science and clinical dePartments. Applications are invited for tenure-track positions at the ASSISTANT AND ASSOCIATE PROFESSOR levels. Send curric- ulum vitae, statement of research interests, and names of three references to: Dr. James Patrick, Head, Division of Nettroscience, Baylor College of Medicine, 1 Bay- lor Plaza, Houston, TX 77030. An Affinnative Action/ Equal Opportunity Employer. POSTDOCTORAL FELLOW. CLONING AND EXPRESSION OF INTERFERON RECEPTORS. Position starting immediately or as late as 1 December 1989 for 2 years. Studies of interferon receptors, particu- larly by cloiiing and expression of native or genetically- engineered receptors in eukarvotic systems. Other recep- tors may be similarly studied. Ph1D. with experience in recombinant DNA 'and eukarvotic expression sy~stems preferred. Send curriculum vitae and names of three references to: Dr. Jerome A. Langer, Department of Molecular Genetics and Microbiology, UMDNJ- Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, Zr'J 08854-5635. Telephone: 201- 463-5224. POSTDOCTORAL FELLOWS, HUMAN MO- LECULAR GENETICS. Positions beginning immedi- ately for 2 vears. Apply methods of genetic linkage, somaticl cel.l hybrids and long-rangc physical mapp ng techniques to either X-linked A1part svndromc, another X region of interest or familial colon, breast or skin cancer. Or develop YAC technology and/or alternate strategies for generating overlapping clone banks and long-range physical maps on chromosomes 17 or X. Apphcants eligtble for prestigious ($35,000) Hollacnder fellowship. Send curriculum vitae with three letters of reference to: Dr. David F. Barker, Genetic Epidemiol- ogy, Universitv of Utah Research Park, 410 Chipeta Way #105, Salt Lake City, UT 84108. Chemistry A health care company that markets prescription and proprietary products for human and animal care has an opening for an Associate Senior Investigator in its Department of Molecular Discovery at its research and development facility in King of Prussia. Pennsylvania. The prlncipal duties of this position include the isolatlon, purification and full characterization of natural products from plant, marine and microbial sources which have been shown in bioassay-directed screens to have potential pharmacological activity; also required is full collaboration with members of the Bioassay Development Group to determine the nature of the active principle in designated ead& The position will be responsible for selecting and utilizing appropriate methodology for the isolation and purification of biological leads; obtaining su table an analytica(and spectral data to characterize and elucidate the structure of isolated compounds; conducting database searches to establish the novelty of isolated compounds and also to find related structures of interest; initiating chemical modification of lead structures for SAR studies; directing a laboratory with at least one subordinate in delegating work and evaluating performance; interacting with other Iaboratories; presenting work at Departmental, Consultant and Program meetings in a clear and concise manner; maintaining familiarity with ongoing research by attending at least one national meeting a year and keeping up-to-date with current literature; keeping full and legible records of all experiments and their results; filing records of invention on promislng leads and publishing research findings when deemed appropriate by both superv sor and the Patent Law Department; keeping supervisor fully informed of progress of leads currently underway and also of any problems that may arise in the laboratory, or with collaborators. The minimum requirements for the position are a Ph.D. in Organic Chemistry, including thesis research in natural product chemistry, plus four years' experience in marine natural product chemistry. These four years' experience must include: Modem isolation and separation techniques Interpretation of spectral data Demonstrated productivity as evidenced by pubiications in the scientific literature. The salary range for this position is S42A00-S62= depending upon years of experience and qualifications. A competitive benefits package is also included. Qualified applicants should submit resume or c.v. to The Philadelphia Job Bank. 444 N, 3rd St., 3rd floor, Phila., PA 19123 and refer to Job Order #4274732. We are an Equal Opportunity Employer, M/F/H/V. CEREAL PATHOLOGIST The Agricultural Research Division of American Cyanamid Company has an immediate opening for a cereal pathologist to join the Fungicide Discovery Department at our laboratory and experimental farm complex ideally located near Princeton, one hour from New York City and Philadelphia. We seek a plant pathologist with several years of ex- perience after the Ph.D. degree, preferably in an agrichemical industry, on wheat and barley diseases. The successful candidate should be familiar with the fungicides used for control of diseases on these crops and have experience in conduc- ting field studies on cereals. You will direct advanced greenhouse screening studies on experimental fungicides for control of diseases on cereals and other field crops, conduct local field trials, and coordinate off-station trials on experimental fungicides for control of diseases on these crops. Again, an experienced cereal pathologist is sought for this position. American Cyanamid Company offers a competitive compensation and benefits package. Interested individuals should send resumes and reference contacts to Employment Office, Dept. SC-616, American Cyanamid, Agricultural Research Division, R 0. Box 400, Princeton, New Jersey 08540. An Equal Opportunity Employer M/F/H/V. M CY.4N.4M/O THE COMMITMENT GROWS EVERY DAY
Page 175: brs52e00
~ ~-- -- -~rr -~~artachmeit and-grovdi-Of - }rourpa-tf-,nlar cultures: liesearchers- _--_offesa_}rave to cmplop coatings such ass collagen, polylysinc, or ft'bronectin, UntIl now. placte& Cuhurewane's revolutionary surface treatments are the alternatives you've txen waiting for: The pLzstek surface treatment is an integral chemical change in the plastic itself, not a coating. Delamination cannot occtu, plastek GYrhurrwane comes sterile and ready for use, in two choices of surface chemistrye pLaKe/te i+a rcSLUaed aaarmu4arrck=t coryor,rrw, plastek G • Positively charged stuface .-. Nitrogen-contaIn;ng functional sarncps • Growth of neuronal cells, for exrunple, Is superior to that achieved on polylysine pla~rek bt • Negatively charged surface • Oxygen-containing functional groups s Eliminates the need for collagen in muscle cell cvltures, among others Why would you want any other alternatives? plastek® G~r.ltareware is avaiiabre in culture dfshes, cluster plate:~ 17asks, cotrrsttps, and microcamers. To order, ca11: 1-800-634-9018 - 1-508-881-6860 (In MtA) Circle No. 248 on Readers' Service Card S 0 F  ~~ A R AutoBiblio AssayZap L ~ " ~ 8ipliopraphic storafls and ratri.vaC"~ ~- l - J a~~= rt.. ~ ~,.,,.,_~tF~tl~nf~.~aa asaa~ t~oF fpr Appl. Macintosh' ~ ~ syatsm for Appli Macintosh ~ ~ " V.rf2:._more faaturss ~ 2~vafties (n stan~turve Ib ~orea referencas and ~abies th®ir ~~~~~ 7~~ I~ CtaN~wn tnw aasred as R1CT 13fea:3rie UND(> 1-= ~itandprh~np h requked tomata. You can create': nslatqn A otrric~ase of (oeratute referatces tud °~ ~ Plemensed, 5everai iaw translatqn aubmat(~y incorporab those cted in ~p~ rtti~a •~~~^~~1t~a~~6~g dtred ~e ofi a tiom--. AuOo8b6o modWes ate as °=~''~'~ ~~Prises~ LKB, pac#iatdc Tk9rtek'and' ~~~{ndCk•seatChes oirwordprocessorSaxian3 ~" ~~'•~~r~~' ^ -~ y eclum10~b~~~~ 10~ ~ t~etised a numbered lists o(refeieixe! k~ * ~ ~ ~~~ ~ ~~ and also inciudes : cait read Tezt Wor and ASCI I filas. The ists sae,_ d ;~ sbred ai dek ~s Texddes ard can be edded ~~ art lntaractlvd+~ c~rve fitt np tacfr~qus wt~ch permits ^ {~ ~atanclardwnes b tie ftted wffiaate+rer ther a ~ ~v a d ~ s M Bit <f d k f t t pro ssot a > o ~e a ma ~~!mrsaCairoiairiris fort~- parameter to~fooi fttr~g ~ _~Jttt6e famat reqtired try ar~y Tbe it , abred on diak as a Fe~Rfile and can be and wei~aed ~ur- paramererlt are <. ~l(rac~Y f~o a pape rfrkh a worQprocesso~ ~ra~',~u~~p ~~ aA prevaus assays aM »~. fe - „IMIi p10.W WICi{t¢NGIY W11p IV N6 fw td' ~ nna t - is txeaares the dat~ase of refe rer~ces k 1 IN ry li IIW ~ ~ ~` rNCilSaflt=adkl0d:. {8t0a a558YS 11D 10 2006 " ~~Ir audprs who wrfoe several papers oadt yse% book raterences. _Reteretises ean 6e orufysi anttkuvwrrmovarecoafstmmonet~etoatb4sef i ~ ar.us nssaY wn maY oe w .. tpDialf0lL A4EaY7.a¢ COr(onn51 tq.-{ is a~arch~r enabrrq you to nnd any term in ff~e ~~e corwanuona of ~s Maa eftertace: uea of tt ~ 1 ~ ~ ~rndows menua ard te Rs databa~e. R.adDB can read refer~cas bom virh~~ an~P~ ~ " : ~ ftcan be rxeprat~ ~~, taur own bbkograpfres ~da~ne .- .~~i alifad i~~ data 1~~4 ~ ~aetrices ~ka~Medlne can at tt w n I i ~ ~ _ h ~ oro n a or3 . e _, _ ~ -~ ~dlxduded routMea wfrc{t ~~ ~1~ µ -~ permkUie klac Io be connectad d~r b data aources AN data and res~ts : . _EAMIBiylAail~ WCS $249 .-it>AYif6pR!<BQStOtadondlBkCrpa89edOntoolllBt .-- ~~ pOPM fatutheranahrsi&s' =m : $299 ~~" '`!]elnarlstralfan version q[ettfw Aroyram, hcludinG doaunonta9o i25 retixdable t ttd versiod purohased ~ S l ~ i p e ~ ~-AldEX1~I AtasietCard a Chedc in htrds d il ar ned[r 'on ap ro d at unts only ~ ~ ` P.O. Box 580, Milltown, New Jersey 08850. Telephone (201) 613 901:3. saaVes}<cin tai hutdedFandeach easay may icudeip `_-; MEDISEARCH ~ C E A MAC®R AND A MODEM makes MEDLINE® easier & faster to access than you thought possible. ~ Now, for the first time on the Macintosh'-... a user-friendl ~ ~ ~ t sensible tool , or doctors, researchers, nurses, students, medical librarians... Automatic and manual search modes support new and expert Medline users. A 10-minute tutorial has new users performing productive searches immediately. Powerful Index feature captures complex terms with the click of a mouse for use in future searches. Update your research with only new articles automatically. Entire sessions & individual selections can be saved in formats compatible with most word processors, databases, & bibliographic E reference systems. MEDISEARCHTM comes with an easy-to-use Hypercard`il app lication to create custom bibliographic reference libraries. MEDISEARCH r`^ $149.00 ppd (CA residents, add area sales tax) Available from: Shoestring Solutions 402 Cortland Ave., San Francisco, CA 94110 24 hour toll-free orders 1-800-333-9462 Visa, MasterCard. Purchase Orders UP TO THE MINUTE MEDLINE3 WHEN YOU NEED IT NIGHT OR DAY E Lfac. ;t4acintosh and HvperCard are regtstered trademarks ot App/e Cornputer Inc. Meai'ne is the registered trademark af wational Lbrarv of Medicine. Circle No. 264 on Readers' Service Card Circle No. 3 on Readers' Service Card
Page 176: brs52e00
1a[ed eid~et bv Y~CC ot I'iCF.. Th~s, several hormonal signals operating via cAIMP-de- pendent and cAMP-independent pathways lead separately to stimulation of Cl- channel activity. Both PKC and PKA are unable to activate epithelial Cl- channels from CF patients. Our data suggest that both kinases act on a common pathway directly involved in Cl- channel gating. If one assumes that CF arises from a single mutation in the CF gene, then this mutation could cause a Cl- chan- nel defect either at a common PKC and PKA phosphorylation site or at a specific domain that couples separate phosphoryl- ation sites to channel activation. REFERENCES AND NOTES 1. M. J. Welsh, Physiol. Rev. 67,1143 (1987). 2. P. M. Quinton, Nan re 301, 421 (1983); M. R. Knowles et al., Science 221, 1067 (1983); K. Sato and F. Sam, J. Clin. Invest. 73, 1763 (1984). 3. R. A. Frizzell, G. Rechkemmer, R. L. Shoemaker, Science 233, 558 (1986). 4. R. A. Schoumacher et al., Nature 330, 752 (1987). 5. M. Li et at., ibid. 331, 358 (1988). 6. P. L. Smith et al., J. Afembr. Biol. 70, 217 (1982). 7. M. J. Welsh, .4rn. J. Physiol. 253, C828 (1987). 8. R. A. Barthelson, D. B. Jacobv, J. H. Widdicombe, ibid., p. C802. 9. Cells were grown in flasks coated with a mixture containing distilled water, fibronectin (10 µg/tnl), collagen (6 mg/ml), and bovine serum albumin (100 µglml) and maintained at 37'C in 5% CO2 and 95% air. Normal f'etal, normal adult, CF nasal potyps, and SV40-infeaed CF bronchial cells were grown in LHC-8 medium (Bioduids, Rockville, MD) with penicillin (100 unit/mi) and streptomycin (100 µg/ mll. For patch clamping, cells were passed onto cover glasses coated as above. Primary bronchial CF cells were cultured in airway medium [P. L. Zeitlin, G. M. Loughlin, W. B. Guggino, Am. J. Physiol. 254, C691 (1988)] containing endothelial cell grow-th supplement (25 µg/ml), T3 (50 p:vf), imi- penem (200 µgiml), and tobramvcin (80 µglml). 10. T. Tamaoki et al., Biochem. Biophys. Res, Commun. 135, 397 (1986). In in vitro experiments stauro- sporine inhibited PKA phosphorvlation of histone f2b at the same concentration required to inhibit PKC (data not shown). 11. H. C. Cheng et al., J. Biol. Chem. 25, 989 (1986). 12. I. B. Levitan, Anmt. Rev, iVeurosci. 11, 119 (1988). 13. R. L. Huganir and P. Greengard, Trends t\'eurosd. 8, 472 (1987); K. Miles and R. L. Huganir, .1-loi. a'eurobiol. 2, 91 (1988); F. Eusebi, M. Molinaro, B. M. Zani, J. Cell Biol. 100, 1339 (1985); R. L. Huganir, A. H. Delcour, P. Greengard, Nature 321, 774 (1987). 14. B. M. Curtis and W. A. Catterall, Biochernistry 25, 3077 (1986); W. Nastainer: k et a/., Enr. J. Biochem. 169, 137 (1987; C. M. O'Callahan, J. Ptasienski, M, M. Hosev, J. Biol. Chern. 263, 17342 (1988). 15. A. B. Cachelin et al., Vanire 304. 462 (1983); B. P. Bean, M. C. Nowvcky, R. W. Tsien, ibid. 307, 371 (1984); A. E. Lacerda, D. Rampe, A. M. Bro vrt, ibid. 335, 249 (1988). 16. K. B. Walsh and R. S. Kass, Science 242, 67 (1988). 17. D. C. Gruenert et at., Proc. Nail. Acad. Sci. U.S.A. 85, 5953 (1988). Presence of SV40 large T antigen, keratin, and a Ca"-dependent cell adhesion mole- cule, cell-C.r~.M 120/80 [M. J. «'heelock et al., J. Cell. Biochem. 34, 187 (1987)1 were confirmed immunocvtochemicallv in the transformed fetal epi- thelial cells. Cells in early passages after transfection showed junctional complex formation, whereas cells subcultured 14 times did not. Early passage transfor- mants showed no colony formation, but cells subcul- tured 14 times after transfection did form colonies with limited growth potential in soft agar. 18. J. R. Woodgett and T. Hunter, J. Biol. Chem. 262, 4836 (1987); E. M. Reimann and R. A. Beham, Me hods Enzymoi. 99, 51 (1983). 19. We thank E. Rohland for technical assistance with cell cultures, V. Rothman for technical assistance in preparing PKC, and D. Raben for many helpful discussions. We thank the patients and families, and surgeons who helped us obtain CF tissue. Support- cd by NIH grant R01-HL 40178 and Cystic Fibro- sis Foundation grant Z028-8 to W.B.G.; NIH Clinical Invesrigator A%vard 1-K08-HL02188 ro P.Z.; NIH grant R01-DK 39619 and Cystic Fibro- sis Foundation Research Development grant to D.C.G. 9 Januarv 1989; accepted 10 April 1989 Regulation of Chloride Channels by Protein Kinase C in Normal and Cystic Fibrosis Airway Epithelia MING Li, JOHN D. MCCANN, MATTHEW P. ANDERSON, JOHN P. CLANCY, CAROLE M. LIEDTKE, ANGUS C. NAIRN, PAUL GREENGARD, MIChL4EL J. WELSH* Apical membrane chloride channels control chloride secretion by airway epithelial cells. Defective regulation of these channels is a prominent characteristic of cystic fibrosis. In normal intact cells, activation of protein kinase C (PKC) by phorbol ester either stimulated or inhibited chloride secretion, depending on the physiological status of the cell. In cell-free membrane patches, PKC also had a dual effect: at a high calcium concentration, PKC inactivated chloride channels; at a low calcium concentration, PKC activated chloride channels. In cystic fibrosis cells, PKC-dependent channel inactivation was normal, but activation was defective. Thus it appears that PKC phosphorylates and regulates two different sites on the channel or on an associated membrane protein, one of which is defective in cystic fibrosis. C HLORIDE SECRETION BY AIRWAY epithelium is controlled in part by C1- channels in the apical mem- brane of the cell (1). These channels are in tum regulated by adenosine 3',5'-cyclic mo- nophosphate (aNIP) -dependent protein kinase (PKA), which phosphorylates the C1- channel or an associated protein, there- by activating (2) the channel (3). In cvstic fibrosis (CF), regulation of this channel is defective: PKA does not activate Cl- chan- nels, although these channels are present in the membrane and can be activated by depo- larization after membrane patches are ex- cised from the cell (3, 4). Defective regula- tion of Cl- channels in epithelium from patients with CF inav contribute to the pathophysiology of this genetic disease (5). PKC is important in regulating secretion (6), and it controls ion channels in several cell types (7). In airWay epithelia, two Cl- secretagogues, isoproterenol and bradyki- M. Li, J. D. McCann, M. P. Anderson, J P. Clancy, M. J. Welsh, Laboratory of Membrane Transport and Pulmonart' Division, hepartment of Internal I Iedicine, University of Iowa College of Medicine, Iowa Cit,v, IA 52242. C. M. Liedtke, C,vstic Fibrosis Center, Depanments of Pediatrics and Physiology and Biophysics, School of Medicine, Case Western Reserve, Cleveland, OH 44106. A. C. Naim and P. Greengard, Laboratorv of:vSolecular and Cellular Neuroscience, Rockefeller University, New York, NY 10021. *To whom correspondence should be addressed. Fig. 1. Effect of PMA and A 2o B cAMP on 1251- effiux. (A) E1$ux was measured under control conditions (Con- ~ trol) or with addition of ~ PMA (PMA) (100 nM) or 8 10 p..Af forskolin plus 500 ~ µM IBMX (cArP) (9). ~ Data are mean t SEIvi m 51 1-1 A A I I T IE ~ (n = 11 cover slips from a three experiments); both PMA and c.~'~iP increased cffiux (P < 0.05). (B) Ei$ug in CF cells; conditions are the same as in Fig. 1A (n = 4 cover slips from one experiment). (C) Effect of PIvIA on the response to cAMP. Cells were exposed to PIMA (100 nNl) or vehicle (Control) for 10 min before addition of 10 µM forskolin plus 500 l.u'1d IBMX (cAMP) (n = 10 cover slips from three experiments). The cAMP-induced increase in efflux was less in the presence of PMA (P < 0.05). Values for all efflux rates were obtained 2 to 5 min after addition of agonists when effiux rate was greatest. Forskolin and IBMX produced comparable increases in cAMP in the presence and absence of PMA (10). In (C) baseline efflux rate was similar in the control and P.'vIA groups because the P.'tiL2-stimulated increase in 125I- e$Jux was transient and had returned to baseline values 10 min after addition of P.'v1A. O, Baseline; , intervention. c 16 TUNE 1989 REPORTS 1353
Page 177: brs52e00
wakedme, discard the first 5 hours of temperature data fiom tbe analysis, and extend the CR at least 8 houLS afcer an unobscured temperature trough has occ.-urred- Our subjects are restricted to absolute bedrest in a semi-recumbent posture, with wakeful- ness enforced by a research technician and verified by continuous polvsomnographic recording [C. A. Cuisler et al., Sleep Res. 14, 295 (1985)] (6). 9. We fit the model to the temperature data using nonlinear least squares (E. N. Brown, thesis, Har- vard University, 1987) and used an average of the minima from the single harmonic and composite waveforms of the model as the reference marker of endogenous circadian phase (ECP,,). 10. We have found that three or more cycles of bright light exposure (for 5 hours per cycle) induced phase shifts of a similiar magnitude, whereas fewer than three cycles of exposure or omission of bright light from the second and third cydes induced qualitative- ly different results, including substantial reduction of ci.rcadian amplitude (22). The endogenous circadian temperature amplitude observed after substantial (> 4-hour) phase shifts induced by the three-cycle stimulus was about 10 to 15 percent below normal. Pilot studies indicate that an additional (4th) cycle of exposure normalized amplitude but did not sub- stantially change the final circadian phase (6t), sug- gesting that the transients which normally precede attainment of a new steady-state phase after an intervention were largely complete prior to the final phase assessment. 11. The initial circadian phase of the light stimulus (c~;) is given as (tL - tt) mod 24, where tL is the time of the brightness-weighted average midpoint of the light stimulus (14). The final circadian phase of the light stimulus ((bt) is defined as (tL - tz) mod 24 (see Fig. 1). The phase shift (Ocb) is calculated as: (tt - tZ) mod 24, where tt is the time ofthe initial ECPo,;n and tZ is the time of the final ECP_ By convention, phase delays (G(~ < 0) represent shifts to a later hour on the reference time scale and phase advances (A(b > 0) represent shifts to an earlier hour. 12. Subjects had no evidence of medical, psychiatric, or sleep disorders as determined by clinical history, physical examination, chest radiograph, electrocar- diogram, clinical laboratory screening tests, and psychological scaerning questionnaire (Minnesota Multiphasic Personality Inventory). Urinary screen- ing verified that all subjects were drug-free at the time of study. Informed consent was obtained from all subjects, who were studied for one to ten trials, depending on availability. In the five subjects with at least four sequential resetting trials, phase resetting responses across a range of initial phases were all close to the estimated response curve derived from the entire group, suggesting that interindividual differences were small. Moreover, when stimuli were repeated at about the same initial circadian phase within a subject, resetting responses were similar, suggesting that intraindividual differences were small. 13. Since the subjects slept during scheduled dark epi- sodes, the apparent effect of room light could be due in part to an effect of the rest-activity cycle on the pacemaker, as recently described in animals [N. Mrosovsky and P. A. Salmon, Nature 330, 372 (1987 ); O. Van Reeth and F. W. Turek, ibid. 339, 49 (1989)]. However, free-running endocrine rhytiuns with an intrinsic period as low as 24.35 hours have been reported in blind subjects whose rest-attivity cycles were constrained to 24 hours [L. E. M. Miles, D. M. Ravnal, M. A. Wilson, Science 198, 421 (1977); D. N. Orth, G. M. Besser, P. H. King, W. E. Nicholson, Clin. Endomnol. 10, 603 (1979); R. L. Sack, T. M. Hoban, A. J. Lewy, Sleep Res. 16, 636 (1987)], indicating a range of entrain- ment of those rhythms to the rest-activity cycle alone of less than 0.35 hour. The range of entrainment for such rhythms is three times larger (about 1.2 hours) in normally sighted subjects whose rest-activity cycle is similarlv constrained to 24 hours, but who are also exposed to a concurrent cycle of ordinary indoor room light and darkness [J. E. Fookson et al., Sleep Res. 13, 220 (1984) ]. We therefore estimate that the rest-activity cycle contributes <_ 30 percent of the total entraining effect of the imposed schedule of ordinarv indoor room light and darkness or sleep. 14. Small displacements of c~ due to changes in the timing of room light can only have a substantive effect when eb; is at the steepest point on the response curve (at the ECP,,,;,,, as in Fig. 4). Using the formula: tL = (k)tBL +(1 - k)tp_L, where tL is the brightness-weighted midpoint of the overall light pattem, tBL is the midpoint of bright light, and tRL is the midpoint of room light. Our working estimate of the weighting ratio [(kl(1 - k)] is 2.7. Other experiments are required for a precise esd- matc. In any event, the phase-resetting curve derived from our data with 6; =(tBL - tt) mod 24 is qualitatively the same as that from (b; =(tL - tt), since the mean difference between the actual value of tBL and that calculated for tL was only 0.66 hour (maximum 1.5 hours) for the resetting trials report- ed here. 15. R. E. Kronauer, Sleep Res. 16, 621 (1987), 16. C. A- Czeisler, S. Pilato, M. C. Moore-Ede, E. D. Weitztttan, Am. J. Physiol. 242, R3 (1982). 17. A. T. Winfree, J. Theor. Biol. 28, 327 (1970). 18. S. Sinha, Chronobiologia 8, 377 (1981). 19. Both O; and (~t were observed with error, arising from uncertainty in their estimation, inter- and intrasubject variabilitv of responsiveness, and poten- tially from incomplete transients in subjects who underwent sequential resetting trials. To minimize these sources of error, only trials in which the endogenous circadian temperature amplitude ex- ceeded 0. 15'C during each initial CR were included. The model goodness of fit (Fig. 5C) suggests that these sources of error were small relative to the phase-shifting effects of the light; resetting responses observed in subjects' first resetting trials were indis- tinguishable from subsequent responses. Analysis of nonlinear errors in variables, along with further experiments, are necessary to quantify further these sources of error. 20. Endogenous circadian rhythms have been reported in diverse functions of the visual system in various species [J. W. Jacklet, Science 164, 562 (1969); J. N. Lythgol and J. Shand, Invest. Opthalmol. Vis. Sa. 24, 1203 (1983); J. Brandenburg, A. C. Bobbert, F. Eggelmever, Behav, Brain Res. 7,113 (1983); M. M. LaVail, Science 194, 1071 (1976); A. Wirz-Justice, M. Da Prada, C. Reme, Netnosa. Let, 45, 21 (1984)], including human visual sensitivity [R. Knoerchen and G. Hildebrandt, J. Interdisc. Cycle Res. 7, 51 (1976)]. While considerable evidence indicates that in some species the eyes contain a circadian oscillator [G. D. Block and S. F. Wallace, Science 217, 155 (1982); T. L. Page, Science 216, 73 (1982); M. Terman and J. Terman, Ann. N.Y. Acad. Sci. 453, 147 (1985)], mammalian studies suggest that the oscillator is synchronized to the light-dark cycle via its neural connections to the central ner- vous system, not by the direct exposure of the eye to light [P. S. Teirstein, A. I. Goldman, P. J. O'Brien, Invest, Ophtha(mol. Vis. Sci. 19, 1268 (1980)]. 21. The peak-to-peak amplitude (PP) and the distance between peaks (W) of the phase transition curve (Fig. 5C) were approximately 11 hours and 5 hours, respectively, as defined by Winfree (17). These values are comparable to those derived from the phase transition curve to 2 hours of exposure to 8000 lux in the mosquito Culex pipiens quinquefasaa- tus [E. L. Peterson, J. Theor. Biol. 84, 281 (1980)]; in both cases, the sawtooth shape of the curves indicates that the strength of the stimulus was just sufficient for strong type 0 resetting [A. T. ~ir'infree, in Biochronometry, M. Menaker, Ed. (National Acad- emv of Sciences, Washington, DC, 1969), pp. 81- 109; The Geometry of Biological Time (Springer- Verlag, New York, 1980); A. T. Winfree, 77te Timing of Biological Clocks (Scientific American Books, New York, 1987)]. Since three cycles of light exposure was just sufficient to induce type 0 reset- ting in our subjects, it is unlikely that strong type 0 resetting can be achieved with a single exposure to a tolerable intensitv of light in normal young men. 22. C. A. Czeisler, J. S. Allan, R. E. Kronauer, J. F. Duffv, Sleep Res. 17, 367 (1988); C. A. Czeisier, R. E. Kronauer, J. J. Mooney, J. L. Anderson, J. S. Allan, Psychiatr. Clfn. N. Am. 10, 687 (1987'); M. E. Jewett, thesis, Harvard University (1987). 23. A. Eskin, in Biochronometry, M. Menaker, Ed. (Na- tional Academy of Sciences, Washington, DC, 1969), pp. 55-80; P. H. Gander and R. D. Lewis, Am. J. Physiol. 245 R10 (1983). 24. R. A. Wever, J. Polasek, C. M. Wildgruber, Pfi'rgers Arch. 396, 85 (1983). 25. The belief that lower organisms arc much more sensitive to light than vertebrates may stem from studies of pupal emergence in Drosophila pseudoobs- ntra [C. S. Pittendrigh Cold Spring Harbor Symp. Quant. Biol. 25, 159 (1960)]. Those pupae are so sensitive to light that 55 seconds of dim blue light (1 W/m=) results in strong type 0 resetting of the circadian pacemaker gating that critically timed event (17). However, adult flies of the same species require 12 hours of white light at 7000 lux to achieve comparable type 0 resetting of their circadi- an activity [W. Engelmann and J. Mack, J. Comp. Physiol. 127, 229 (1978)]. The cockroach Lettco- phaea maderae requires 80,000 lux for 12 hours to achieve strong type 0 resetting of its locomotor activity rhythm [G. Wiedenmann_, Z. Naturforsch. 32, 4fi4 (1977)]. 26. A. J. Lewv, Prog. .Nettro-P>ychopharm. Biol. Psychiat. 7, 551 (1983); A. J. Lewy et al., Psychopharmacol. Bull. 18, 127 (1982); S. Daan, and A. J. Lcwy, ibid., 20, 566 (1984); A. J. Lewy and R. L. Sack, C/in. Neuropharmacol. 9 (Supp. 4), 196 (1986); A. J. Lewv et al., Science 235, 352 (1987). 27. D. N. Orth and D. P. Is1and, J. C(in. Endoctinol. 29, 479 (1969). 28. J. Redman, S. Armstrong, K. Ng, Science 219, 1089 (1983); J. Arendt et al., Ergonomics 30, 1379 (1987); S. M. Reppert, D. R. Weaver, A. S. Rivkees, E. G. Stopa, Science 242, 78 (1988). Initial reports indi- cated that more than 500 lux of light was required to suppress melatonin secretion in normal human sub- jects [A. J. Lewy, T. A. Wehr, F. K. Goodwin, D. r1. Newsome, S. P. Markey, Science 210, 1267 (1980)], but partial melatonin suppression has since been observed in normal subjects at light intensities as low as 300 to 500 lux [C. J. Bojkowski et al., Horrn. Metabol. Res. 19, 437 (1987); A. J. Lewy et al., Am. J. Psychiatry 142, 725 (1985)]. Further studies are required to determine whether or not melatonin suppression is either required for, or an appropriate marker of, the effects of light on the human circadian pacemaker. 29. C. A. Czeisler and J. S. Allan, in Sleep Disorders, R. L. Williams and I. Karacan, Eds. (Wiley, New York, 1988), pp. 109-129. 30. C. A. Czeisler, E. D. Weitzman, M. C. Moore-Ede, J. C. Zimmerman, R. S. Knauer, Science 210, 1264 (1980). 31. C. A. Czeisler et al., Sleep 2, 329 (1980); S. H. Strogatz, R. E. Kronauer, C. A. Czeisler, ibid. 9, 353 (1986). 32. T. H. Monk, M. L. Moline, R. C. Graeber, Aviat. SpaceEnviron..4led. 59, 703 (1988). 33. K. E. Klein and H. M. Wegmann, in Chronobiology, L. E. Scheving, F. Halberg, J. E. Pauly, Eds. (Igaku Shoin, Tokyo, 1974), pp. 564-570. 34. C. A. Czeisler et al., Proc. Eur. Congr. Sleep Res. 9th, in press; C. A. Czeisler, J. S. Allan, R. E. Kronauer, Abstr. 5th Intern. Congr. Sleep Res., Copenhagen, S11 (1987; A. J. Lewy, C. M. Singer, R. L. Sack, Sleep Res. 14, 304 (1985); J. R. Joseph-Vanderpool et al., ibid. 17, 381 (1988). 35. O. Lingjaerde, T. Bratlid, T. Hansen, Aaa Psychiatr. Scand. 71, 506 (1985). 36. C. I. Eastman, Sleep Res. 15, 271 (1986). 37. T. A. Wehr et al., Arch. Gen. Psychiatry 43, 870 (1986); A. J. Lewy, R. L. Sack, L. S. Miller, T. M. Hoban, J. Bioi. Rhythms 3, 121 (1988); N. E. Rosenthal et al,, Am. J. Psychiat. 145, 52 (1988). 38. The bright light was provided by a bank of either cool-white Econ-o-watt (North American Philips Lighting) or Vitalite wide-spectrum (Duro-test) flu- orescent lamps, applicd in addition to ordinary indoor room lighting. The phase shifts induced by these different tight sources were equivalent for a given level of illuminance (in lux). During bright light exposure, each subject was seated facing a vertical bank of fluorescent lamps and instructed to look directly at them for 5 of every 10 minutes. Illuminance was recorded at 5-minute intervals (6). Each subject's daily exposure to ultraviolet (UV) light during the trials was well within safety guide- lines [Documentation of the Threshold Limit Values and Biological Exposure Indices, Foh Edition (American Conference of Governmental Industrial Hygienists. Inc., Cincinnati, 1986); D. H. Sliney, .4m. J. Op- 1332 - SCIENCE, VOL. 2q-} 2 04 7 0" 5 19' 9 b
Page 178: brs52e00
® 0 $~qfAGtf~-' ® 0 0 ._-._.-, r...~ .,pM1'.",~; ® nnn n oo' ® non pana 07fl~ 9 VT u r. C,~i HKpesvfms :SORUA,I:.~,"~~R~;2$S~et~ccien~ ~qslzume,pr for a~uboih ; ~~'''~I~''}}l``~'JRNA nzyy p~ropl ~.pornptem, ttiembrane ~e rauons, y1Cly~IS013tI~1S 21'~fltl]Ntflainµ,y,;,~~hl'~'C'9VUSIatlllty '~ '~~'' 7~~ .tx ii ylal,~, ~ "i ~~~71O1N1 ~SP~iJMOF~~AS ,it ~I y, c,y > Yau can use all V4~I°"sVtpe ~eed"rotors°ft~i your extstuig tnvcutory in the RG2$S ~', sd a.tytde rang of econotnical neu~1S0E~Vt~td.W^Ifixed altglG~ swingtnS ~uc,t-SU~,R~speed' i, }n~p~ s'. E~e up ` ultraspeA~ll:centr~fiige for thrtilongerxI~hez gfoice ', e uoovsg work if ~s'desz~fvt b~'?t~nnn'tg yi~u'Iow end uljra sCparanon's"ui ry ~ the RCa,28S ~',11ri•a'speed Separattoas 4~SUPRAspeed'pr,ces Tbat's ecOnotny EASEUFOPF,R9TIUN ASPECI'RUMOFCONVIIVIENCES Everything on the`'RC-28S has been designed for user cornenience= t? ~ from the new automatic totor recognition system that sets optimum run conditions; to the Za40 Y CD display with multiple programming, RCF, and diagnostic tqessages ;No ;more rotor"codes to tetnember and enter, n o, more concerrS about, proper seating'of ttie rotor the RG28S~takes ` care oftt all. That's cronvenience , SAFETY A SPECTRUM OF PROTECTION BENEFITS i Because the sophisticated rotor.recognition system `of the RC-28S prevents any overspeed condition, your personnel and your capital investments are provided an extra measure of safety.. Also, because the RC-28S can automatically enter optimum tempetature, speed and acceleration/deceleration conditions, protection for your precious sam- ples is assured. That's safet}: f For aa copy of our 12-page RC-28S brochure, call 1-800-551-2121. In Canada, call 1-800-387-2179. In Europe (W Germany):0049-6172-87-Q Or write DuPont Company, Biotechnology Systems, P16-2130, Wil- mington, DE 19880-0016. Microsornms 100,000 ~.. ' :: kY.+.,. VliiochondnA -'Q000xg 5,000xg g ooas g~ ma nsol aooasg This new , ~UP1~Sspte~V `~cel~trifuge is in a class b~' " Itself. It sets nei~ ~tiandahts m versatlLty, eeonomy, ease oF operatlob attc~ sa6et$•'" h10FAPI9ICATIONS s` / aV4RSATI~17 t,A $PECTMJ Irtstead u,gs"tn hqth a,~sup~rs~eg~d d an ultraspeed~,c[enlxtfube to .L~`'~ It bllet~^6#L't._~ ~,!^~~17~ ~~AV ,1~~Kp'~ Working Knowledge in Biotechnology Cirole No. 172 on Readers Service Card
Page 179: brs52e00
POS1TiONS OPEN I POS(TIONS OPEN I POSITIONS OPEN The Division of Neurosurgery of the University of Pennsylvania Medical Center is seeking qualified candi- dates to fill the followin_~ positions. PROFESSOR LEVEL NEUROPSYCHOLO- GIST. Should have a disringuished record of teaching, clinical services, and research. Candidates should have international recognition in the field of head injury and/or other neurosurgtcal diseases with a demonstrated record of teaching and research consistent with appoint- ment at the Professor level, and should hare a minimum of 10 vears in faculty positions. Applicants should have expertise in evaluation of outcome including assessment of surgical and pharmacologic treatments. Qualified can- didates will also have demonstrated experience in estab- lishing and maintaining appropriate clinical services for neurosurQical patients. ASSIStANT PROFESSOR LEVEL NEURO- SURGEON. Candidate must be Board-eligible/certified with a special interest in the spinal cord disorders including trauma, vascular disease and tumors. In addi- non to clinical interest and experience. candidates should have research plans in these fields. ASSISTANT PROFESSOR LEVEL NEURO- SCIENTIST. Candidates should have a primary re- search interest in the field of experimental neural trauma with demonstrated background in the anatomy and physiology of neural injury. Specific fields of interest that are desirable include axonal regeneration and plasticirv, excitotoxicirv and NMDA and non-NMDA receptors, and histopathological responses of CNS to trauma. A strong interest in pharmacological intervention is also desirable. Qualifications include the Ph.D. in an appro- priate discipline, 2 to 3 years of postdoctoral experience, and evidence of potential as a scholar. Applications fran wan