NYSA CTR 1
A unique zinc finger protein is associated
Abstract
A unique zinc finger protein is associated preferentially with active ecdysone-responsive loci in Drosophila
Fields
- Named Organization
- American Cancer Society
- Boehringer, Mannheim
- Kodak
- March of Dimes (Voluntary health organzation concerned with birth defects)
- National Institutes of Health (NIH)
- University of Virginia
- Washington University in St. Louis
- Boehringer, Mannheim
- Named Person
- Adler, Paul
- Amero, Sally A.
- Diani, Jack
- Dietrich, Valerie
- Haynes, Susan
- Kadner, Bob
- Karim, Felix
- Lee, Moon
- Locus, Ann
- Yamamoto, Keith
- Amero, Sally A.
- Date Loaded
- 11 Jan 2006
- Box
- 0001
Document Images
A unique zinc finger protein is associated
preferentially with active
ecdysone-responsive loci in Drosophila
Sally A. Amero,t Sarah C.R. Elgin,2 and Ann L. Beyerx
IDepamnent of Microbiology, University o~ Virginia School o~ Medicine, Charlottesville, Virginia
22908 USA~ 2Department
of Biology, Washington University, St. Louis, Missouri 63130 USA
40000040

A unique, zinc finger p.rotein is associated
preferentially w th active
ecdysone-responsive loci in Drosophila
Sally A. Amero,t Sarah C.R. Elgin,2 and Ann L. Beyer1
IDepanment of Microbiology, University o~ Virginis School of Medicine, Charlottesville, Virginia
22908 USA~ 2Department
of Biology, Washington University, St. Louis, Missouri 63130 USA
Using an immunochemical approach, we have identified a unique antigen, PEP (protein on ecdysone
pul~fs),
which is associated in thizd-instar larvae with the active ecdysone-regtdated loci on polytene
chromosomes;
PEP is not associated with most intermolt puffs and is found on some, but not all, heat
shock-induced puffs.
The distribution pattern changes with changing puffing patterns in the developmental program. We
have
screened an expression library and recovered a eDNA done encoding PEP. PEP possesses multiple
potential
nucleic acid- and protein- binding regions: a glyeine- and asparagine-rich amino terminus, four zinc
finger
motifs, two very acidic segments, two short basic stretches, and an alanine- and proline-rich
catboxyl
terminus. The Pep gone maps by in situ hybridization to the cytological locus 74F, adjacent to the
early
ecdysone-responsive region; however, the gone is not regulated by ecdysone at the level of
transcription. The
pattern of P~p expression through development suggests that maternal Pep gone transcripts are
supplied to the
embryo, and that the abundance of Pep gone transcripts decreases to a lower, fairly constant level
thereafter.
This unusual protein may play a role in the process of gene activation, or possibly in RNA
processing, for a
defined set of developmentally regulated loci.
[Key Words: Drosophila~ ecdysone puffs~ locus 74F~ polytene chromosomes~ zinc fingers]
Received October 3, 1990~ revised version accepted November 19, 1990.
The giant polytene chromosomes of Drosophila rnelano-
gaster provide a unique opportunity to assay the protein
interactions at defined genetic loci, because specific pro-
reins can be localized on the chromosomes through in-
direct immunochemical assays {e.g., Elgin et al. 1988}.
Analyses of this type have provided a general picture of
transcriptional activity in putts and interbands from the
distribution patterns of KNA polymerase II {Sass 1982~
Weeks et al. 19821 and topoisomcrase I (Fleischmarm et
al. 1984}. The presence of heterogenous nuclear ribenu-
cleoproteins, IhnRNPs} [S.A. Amero and A.L. Beyer, un-
publ.} and small nuclear ribonucleoproteins [snlLNPs)
[Sass and Pederson 1984; S.A. Amero and A.L. Beyer,
unpubl.}, which are involved in packaging and processing
of nascent RNA molecules (Dreyhms 1986; Zieve and
Sauterer 1990}, is also observed at these sites.
A coordinated program of developmental gene expres-
sion is visible as a reproducible, temporal pattern of puff-
ing activity on the polytene chromosomes {Ashbumer
1970). Three sets of chromosomal loci are included in
the program, which is initiated in response to eedyster-
old hormones lHodgetts et aL 1977}. The existing inter-
molt puffs {including loci 25AC, 68C, and 90BC} regress;
several "early" puffs {including loci 2B, 22B, 23E~ 63I:,
74F_~, and 75B} apl~ear quickly and then regress. Subse-
quently; >103 "late" puffs appear in a temporal
quence {Ashbumex and Berendes 1978~ Pongs 1988}. A
number ot early genes have been cloned {Burtis et al.
1990~ Segraves and Hogness 1990; Thummel et al. 1990},
and their products may participate in activation of the
late genes IUrness and Thummel 1990~ for review, see
Ashbumer 19901; the products o~ these late genes are
thought to initiate metamorphosis.
A different program of gene expression, and a diHerent
puffing pattern, ensues horn heat shook or a number of
other stresses IRitossa 1962~ Ashbumer and Bonnet
19791. Nine puffs, the sites d the genes encoding the
heat shock proteins {Spradling et al. 1977}, are rapidly
induced at 37-38°C; concomitantly, the developmental
puffs regress as transcription at these loci is repressed
and splicing ot pre-m_RNAs is inhibited I¥ost and
Lindquist 1986}. At least one specific factor, the heat
shock transcription factor, is required in addition to the
basal transcriptional machinery ~or this induction pro-
cess {Parker and Topol 1984~ Wu 1984].
Using monoclonal antibodies to nuclear proteins from
Drosophila embryos, we have identified an unusual pro-
tein, PEP (protein on ecdysone puffs), which possesses a
distinctive distribution pattern on polytene chromo-
somes: PEP is associated preferentially x~fth activated,
hormone-responsive loci, including b~th early and late
gene~ but is not ~ound on most intcrmolt puffs, which
40000041

regress in response to hormone- The pattern of PEP lo-
calization reflects the progression of the developmental
program. In addition, PEP is associated with some, but
not all, heat shock-induced puffs. Cloning of the Pep
gene product has revealed the presence of numerous pu-
tative nucleic acid- and protein-binding motifs in the
unique PEP sequence. In situ hybridization using the
eDNA probe places the gene at locus 741:, adjacent to an
early eedysone-responsive region, but Pep gene expres-
sion is not regulated at the level of transcription by
eedysone. Thus, PEP is likely to be an important com-
ponent of selected active loci, recruited in larval stages
to complement the transcriptional machinery or splicing
apparatus for eedysone-mediated gene expression.
Results
PEP is associated preferentially with active,
ecdysone-induced puffs
Monoclonal antibodies to nuclear proteins trom
phiIa embryos were screened for interesting distribution
patterns on polytene chromosomes by indirect immune-
fluorescence, and mAbs Y1D2 and Y2All were chosen
for further study. These monoclonal antibodies gave an
immunofluoreseenee distribution pattern covering most
visible puffs but few band and interband regions, and no
nueleoplasmie oz cytoplasmic debris {Fig. 1, B}. Rem-
nants of the nueleolus are not stained, mAbs Y1D2 and
Y2AI 1 produce identical staining patterns on the two
salivary glands from the same larva {not shown}. Subse-
quent experiments described below show that the two
monoclonal antibodies recognize separate epitopes in
the PEP antigen.
Fine mapping of the distribution pattern of PEP by the
immunofluorescence assay over two latval and two pre-
pupal developmental stages {Table 1} reveals a tight cor-
relation between visible puffing of the developmentally
regulated loci and the presence of PEP. Excluding the
intermolt puffs, >90% of the visible developmental
puffs are stained. The few visible puffs that are not
stained occur either in the very early or very late stages~
the correlation is perfect in the middle stages. Only in
several eases is staining dereeted prior to visible puffing
Iloci 48B, 52C, and 82F1 or following regression Ilocus
47A}. The protein is not associated with the intermolt
puffs at loci 25AC, 68C, and 90BC in the early puffing
stages but is associated with the intermolt puff at locus
3C [not shown}. Particularly noteworthy is the intense
staining of the ecdysone-responsive puffs at loci 74F_£
and 75B at all stages examined, as these puffs are thought
to undergo early activation and late regression in re-
sponse to ecdysone. Locus 71DE, on the other hand, is
puffed throughout these developmental stages but is as-
sociated with PEP only in the middle stages. On any
given daromosome, the developmental loci listed in Ta-
ble 1 constitute -50% of the total staining pattern for
the PEP antigen; the additional sites may represent de-
velopmental loci not scored in the original list prepared
b7 Ashburner and Berendes 11978]. However, some of
the~c additional sites are consistendy stained, such as
loci 50CD, 52F, 61~-, 70A, and 70D (not shown), and
staining at these sites shows no developmental response
tO ecdysone.
One instructive example of the distribution pattern of
PEP is presented in Figure 1, C and D, using mAb Y1D2.
Most of the developmental [hormone-responsive} loci
that are puffed at stage 2 are stained [loci 22B, 62E, 63F,
69A, 74EF, and 75B} while the intermolt puff at locus
68C and the puffs at loci 21C, 23E, and 71DE ate not.
Some of the latter puffs do become stained at later stages,
however. Two other developmental loci 163E and 66B1
that are induced later in development differ in their
staining characteristics on this chromosome~ locus 66B
is stained rather brightly, while locus 63E is stained at a
much lower level. It is clear by comparison to the dis-
ttibution pattern of RNA polymerase H on the same
chromosome {Fig. 1E} that the sites associated with PEP
are a small subset of the loci associated with tl.NA poly-
merase and potentially engaged in transcription. In sum,
the general features of the distribution pattern of PEP
eorfform to the classical models for a factor involved in
expression of the hormone-induced loci. However, the
additional sites stained indicate that PEP most likely is
involved in other activation systems in addition to that
triggered by eedysone.
The distribution pattern of PEP on chromosomes from
heat-shocked larvae also demonstrates a selectivity for
certain active loci. Of the nine major heat shock-induced
sites, PEP is found at loci 87A, 87C, 93D, and 63BC but
not at loci 95D, 64F, and 70A [Fig. 2B,D}. Low-level
staining is observed at locus 67B (Fig. 2D), and locus 33B
was not scored. The heat shock puffs that are associated
with PEP do not strictly correspond to those heat shock
genes that ate also induced by ecdysone, such as the
small heat shock protein genes at locus 67B {Zimmer-
man et al. 19831 or with heat shock genes containing
introns, the hspS~ gene at locus 63BC {Yost and
Lindquist 19861, and the lasr93D gene at locus 93D
seek et al. 1985~ Garbe and Pardue 1986}. Thus, PEP is
not required for the processes of puffing, transcription, or
RNA processing per se. The protein is associated, how-
ever, with a particular subset of heat shock-induced loci,
as well as a group of developmentally regulated genes
and, thus, overlaps two programs of gene expression.
The Pep gene encodes the YID2 and Y~4.11 epitopes
Western blots of proteolytie digests of chromosomal pro-
teins showed that mAbs YID2 and Y2&11 recognize dif-
ferent epitopes in the PEP antigen. A nuclear extract
from Drosophila embryos was digested with increasing
amounts of trypsin and ~raetionated by eleetrophoresis
in an SDS-polyacrylamide gel, and the peptides were
transferred electrophoretically to a nitrocellulose filter
for Western blot analyses. Identical filters were probad
~Sth either TBS {not sho~n], mAb Y1D2 {Fig. 3A}, or
mAb YZAll [Fig. 3B}. Both monoclonal antibodies rec-
ognize the tl0-kD nuclear PEP antigen~ often, hut not
always, mAb Y1D2, but not mAb Y~ll, recognizes sev-
40000042

Figure 1. Distribution of PEP on polytene
chromosomes from control l~'vae. Poly-
tent chromosomes were squashcd in an
acctic acid-formaldehyde fixative solution
onto a microscope slide and stained with
rnAb YID2, using an indirccr immunot'lu-
orescence method ()'an~ and Elgin 1986),
The chromosomes wezc photographed un-
der phase-contrast and fluorescence illu-
minntion and mapped according to the
designations of Ldcvrc [1976). (A) The
phase-contrast picture of chromosomes
from a puff stagc 2 larva, whcrc thc inter-
molt puffs 68C and 90BC~ ( 0 ), as well as
the ccdysone puffs 42A and 74EF(4), azc
clearly visible. The nucleolus (N] and
chromocentez (C) are also marked. (B) The
fluozesccncc picture of the same chromo-
somcs shown in A, stained using mAb
YID2. (A) The stained devclopmcntal loci;
(0] those not stained. (C) The phase-con-
trast picture of chromosome arm 3L at
puff stagc 2. (4) The developmental loci
that ate active at this stage~ [ 0 ) the inter-
molt puff 68C~ (overlapping • •) dcvclo1~-
mental puffs that will become active at
later devdopmental stages (66B and
ID) Thc fluotcsccRcc picture of the chro-
mosome arm 3L (shown in C) stained with
mAb YID2. The symbol designations arc
dcseribcd in the legends B and C and de-
note the level of fluorescence duc to PEP-
spccific staining. [/~) The fluorescence pic-
ture of the chromosome arm 3L shown in
C and D, restaincd with affinity-purified
antibodies specific Io~ the cathox'y-temai-
hal domain of the largest subunit of RNA
polymerasc II (Fisher ctal. 1989).
eral smaller polypeptides in the original extract, which
are likcly to hc degradation products. The di~erence be-
tween the two cpitopcs is evident from the rctcntion of
the YIDZ cpitope on several smaller tryptic fragments,
while in the same samples, the Y2A11 cpitopc is found
only in the parcntal PEP antigcn. Two prominent signals
(20 and 24 -153] appear in all lanes containing trypsin,
even in the absence o~ nuclear cxtract~ the~a most likely
arise from nonsl~ecific zecognltion d the vast excess o{
tr~-psin in these samples. The filter incubated in TBS
produced no signal.
The mAb Y1D2 wa~ used to isolate a 1.8- -kb Droso-
phila DNA ~agmcnt from a kgtl 1 expression library rep-
resenting cDNAs from 0- to 3-hr embryos [M. Phillip and
D. Brutlag, pers. comm.}. The partial eDNA fragment
was shown to encode both the Y1D2 and Y2.A11 epitopes
from the PEP protein in the Western blot analysis shown
in Figure 4. Bacterial lysates from a X lysogen strain eaz-
rying the 1.8-kb eDNA fragment, both before and a~ter
induction, as well as Drosophila nucleaz proteins ~nd
lysate from a lysogen carrying the unrelated HP1 gene
[James and Elgin 1986), were ~ctionated in an SDS-
l~olyaerylamide gel {Fig. 4A), blotted to nitrozellulose,
and pzohed vrith mA_b Y1D2 IFi~ 4111. The moncelonal
40000043

Table 1o BiuS/nZ ~ PP_2pro~n to ~velo.~me~tally
r~gn/at~d~nffs
Stage 2 Stage 6 Stage
Ann Locus P B P B P
12 Stage 18
B P B
2L 9.1C ......+
211~ - _ ± +_ _ _ _
22A .......
22B'* + ++ ++ ++ - - -
22C - - + + + + ± ±
22d~~* + - + + + + + ±
25AC" + - - ± + -- - ±
34A - - + + X X + +
2K 42,A. + ++ + + ++ ++ ++ ++
46A - - + + + X X - -
46F .... -+ ± + ±
47A .... + ± -
48B -- -+ ± + - - ± ±
52A - - ± + - - X X
52C - _+ ± ± + + X X
55E X X + + + + + + +
58BC ± + + + + - - X X
60B .... X X - -
3L 62~ + + + + + + + + ± + +
63]5 ..... + ± ±
63t=* * + + + + + ± + + + +
66B + + -* +- + + + +
68C" + + ± ++ ± + - + -
69A + + X X - + + +
71DE + ± + + + X X + -
74EF'* ++ ++ ++ ++ + + ++ ++
75B** ++ ++ ++ ++ + + ++ +
75CD - - X X X X ± -
78D - - + + + + + + + +
3K 82Y -- + + + + + ~" + + +
85D + ± ++ +/+ X X + +/+
85F + ++ ++ ++ + + ++ ++
90Be" ++ - - - ++ - ++ -
91D - - ± + ± ± + -
93F .... + + - -
95F - - + + X X + -
98F + - + + ....
100DE - + - - ± + + +
{*) lntermolt puffs; 1"*) eady puffs; all othess are late puffs. The
puffing status of the devdopmental puffs used in this analysis is
presented under the eolmmas ma*ked 1'; puffs were scored as
very prominent { + + ], clearly puffed { + l, slightly puffed {-+), or
not puffed ( - 1. An X denotes a lmff that was not visible in the
field. Two nuclei were averaged 1or stages 2 and 6. Puffing stages
were detemgmed by coml~arison of the puffing patterns to the
tabulations presented by Ashbumcr a~d Berendes (1978}. The
binding of PEP [eolunms marked B}, or the level of fluorescence
at a puff, was scored as intense { + + ), dearly above background
{+b barely detectable above backgro~md I-% or n~ detectable
{ - }. The + / + designation in the binding cokmm for locus 85D
indicates t/mr t~.o distinct fluores=maee sisals were visible at
this locus. The X chromosome was not scored.
antibody recognizes one major protein species of 110 -ld9,
the PEP antigen, in the nueleaz extract (Fig. 4B, lane 11,
and three large p ol~,Tel~tides in the PEP lysogens [Fig. 4B,
lanes 3 and 5), but nothing in the HPl lysogen (Fig. 413,
lane 4]. Although some low-level e.xpression of the
I~-gal/PEP fiasion protein occurs in the absence of IPTG
{Fig. 4B, lane 31, the induction by IPTG is apparent by
comparison [Fig. 4B, lane 5}. The same nuclear and PEP
lysogen extracts were probed also with mAb Y2A11 {Fig.
4C}. The YZA11 epitope is present in the 110-kD nuclear
PEP antigen {Fig. 4C, lane 1) and in the largest of the
induced I~-gal/PEP ~usion proteins, but not in the r~vo
smaller induced polypeptides (Fig. 4C, lane 8}. Therefore,
the 1.8-kb DNA sequence encodes two epitopes ~rom the
PEP antigen, confirming its origin in the Pep gene. This
partial eDNA ~ragme~t was used to isolate a 2.7-kb
eDNA Drosophila clone ~rom a second library made to
optimize synthesis of full-length copies of mRNAs
{Brown and Kafatos 1988). This longer clone was used for
the analyses described below.
The Pep gene maps to the cytological locus 74F
The chromosomal site of the Pep gene was determined
by in situ hybridization to polytene chromosomes of a
biotin-labeled 2.5-kb H/ndlI[ fragment from the eDNA
done. Signal was detected within the proximal portion
oi the puff at the cytological locus 74F {Fig. 5], adiaeent
to the early eedysone-responsive region. The puffing at
this locus appears to be due to the vigorous ecdysoue
induetinn of the neighboring E74 early gene {Thummel
ctal. 1990), rather than the Pep gene [see below). Geno-
mie Southern blot analyses (not shown) suggest that
there is a single copy of the Pep gene covering no more
than 8 kb of the chromosome at this site.
The Pep gane is not regolated by ecdysone
Transcripts from the Pep geue were examined at differ-
ent developmental stages by probing a Northern blot
containing poly{A}+ KNA from staged organisms with
the eDNA probe used ~or the in situ hybridizations
above. In every developmental stage, a single signal rep-
resenting a transcript of ~2.8 kb is visible {Fig. 6J~ the
signal is eahaneed, however, in the lanes containing
samples trorn ovaries and 0- to 3-hr embryos. The load-
ing controls for this filter representing transcripts from
the ribosomal protein gene rp49 (O'Connell and Rosbash
1984) indicate overloading in the lanes containing KNA
fiom 4- to 12-hr embryos and third-instar larvae. From
this analysis we conclude that maternal Pep gene tran-
scripts are supplied to the embryo, and the level of Pep
gene transcripts decreases to a relatively constant level
following embryogenesis. The abundance of Pep gene
transcripts does not reflect the pulses of ecdysone that
occur in mid-embryogenesis {Kraminsky et al. 1980} and
in each larval inst~ IHodgetts et al. 1977} but may be
correlated with the presence of eedysone in ovaries and
the syncTtial zTgote (Richa~ds 19811. Is an additional
e~xperiment, a Northern blot filter containing KNA sam-
pies ~rom isolated larval organs that had been exposed in
vitro to ecdysone or to ecdysone plus cydohexbmide was
191
40000044

Figure 2. Distribution of PEP on polytene
chromosomes from hcat-shocked larvae.
Larvae were maintained at 38° for 40 rain
to induce the heat shock response before
squashing and staining of their polytene
chromosomes. The chromosomes were
photographed and mapped as described in
the legend to Fig. L [A} The phase-contrast
picture of chromosome arm 3R, where the
heat shock puffs at loci 87A, 87C, 93D,
and 95D are deafly visible. [BJ The fluo-
rescence picture of the same chromosome
shown in A, stained using mAb YID2.
Puffs lacking PEP-specific staining~
symbols mark puffs displaying significant
PEP-specific staining. {G} The phase-con-
trast picture of chromosome arm 3L,
where the beat shock puffs at loci 63BG,
64F, 67B, and 70A are deafly visible. ID}
The fluorescence picture of the same chro-
mosome shown in C, stained using mAb
Y1D2. Symbols denote the levd of fluores-
cence due to PEP-specific staining, as de-
scribed in the legend to B.
probed with the same Pep eDNA fragment; the treat-
ments had no effect on Pep gene expression {not showa].
The PEP antigen contains numerous mot//s suggesting
nucleic acid interactions
For sequence analysis, the 2.7-kb eDNA was subeloned
into the BlueScript phagemid {Stratagene} in two over-
lapping pieces, one 2.5-kb H/ndllI 5'-terminal fi:agment
and one 300-bp EcoRI 3'-terminal ~ragment. The nude-
otide sequence was determined on each strand using
nested deletions; aa average o~ six readings pex b~e pair
position was compiled. The anaJno zcid sequmace derived
~rom the primary nucleotide sequence predicts a molec-
ular mass d 77,942 da2tons for PEP {Fig. 7A), rather than
the 110-t33 figure deduced ~rom its eleetrophoretie mo-
bility. The discrepancy may arise as a consequence of the
highly charged domains found in the sequence {see be-
low} and/or PEP may be modified post-tra~slatienally.
Because both ends of the done contain only closed read-
ing £rames~ the done probably covers the euti~e protein-
coding sequence, that is, to the am.ino terminus of the
protein, but does not necessarily extend to the transcrip-
tion start site {Hultmark et al. 1986}. Severn2 potential
tran~latioa start sites axe found within the first 200 nu-
cleotides of o~en reading f:rz_me; of these, only th~ first
40000045

A
12345
B
12345
YiD2 Y2A11
Figure 3. Epitope mapping of mAbs Y1D2 and Y2A1]. Dzoso-
ph.ila nuclear extract was digested with increasing amounts of
trypsin, and identical samples were fractionated by electropho-
zeais m an SDS-polyacrylamide gcI~ the polypeptides were
transferred to nitrocellulose and probed with either TBS {not
shown], mAb Y1D2, or mAb Y2A11. (A) Western blot analysis
of the polypeptidea probed with mAb YID2. (Lane I} Drosopfifla
nuclear pzoteins~ {lanes 2-41 the same proteins digested for 45
rain with 10, 25, or 50 l~g of trypsin/ml; {lane 5) trypsin alone
{50 ~g/ml). [') The position of the nuclear PEP antigen; (el two
nonspeeific signals that may arise from the excess of trypsin in
these samples. (B) A duplicate Western blot analysis using mAb
YZAI i.
and in some RNA-binding proteins [/~Sdller ct aL 1985;
Joho et aL 1990). The PEP fingers are distinctive in
possessing five amino acid residues bet~veen the his-
tidine residues rather than four {Fig. 7B}, a motif
found predominantly in Drosopb_ila finger proteins
{Wingender 1988}; they are not of the type found in
nuclear hormone receptors {Wingender 1988}. The
spacing of the fingers in PEP is unusual; most repet-
itive fingers in other proteins are separated by only
7-10 amino acid residues [Berg 1988; Lee et al. 1989}.
The segment from residues 396-630 in the PEP pro-
rein spans two exceptionally acidic regions }boxed in
Fig. 7A}, which surround a fourth zinc finger of the
type mentioned above {double underline in Fig. 7A}.
Acidic region I 179 residues in lettgth} possesses 9.4
glutamie acid {30%1 and 11 aspartie acid {14%} resi-
dues, with a net charge of -31./mmediately preced-
ing acidic region 1 there is a basic sequence, Lys-Arg-
Lys-Lys-Lys-Pro-Val {overlined in Fig. 7A} similar to
the nuclear localization signal found in the SV40
large T antigen, Pro-Lys-Lys-Lys-Arg-Lys-Val [Ding-
wall and Laskey 1986~. Throughout most of this
acidic region, alanine residues appear every five to six
residues. Zinc finger 4 occurs midway between the
acidic regions. Acidic region 9. {90 residues in length}
possesses 84 glutamie acid [38%} and 9 aspartie acid
two, centered at nudeotides 218 and 297, possess flank-
ing sequences that conform to the Drosophila start site
consensus sequence, {AJC}AA{A/C}AUGG {Cavener
1987}. The scanning model for translation {Kozak 1989}
would suggest that the first AUG in the sequence, which
represents a poor, but acceptable, match to the consen-
sus, is likely to be the initiator eodon for synthesis of
PEP; however, the second site, in phase with the first,
presents a perfect match to the consensus sequence and
might be used. It is possible that multiple sites are func-
tional, as has been shown for the glueocortieoid receptor
{Miesfeld et al.
A number of interesting motifs are discernible within
the deduced sequence for PEP:
1. The amino terminus of the protein consists of a ~e-
gion 166 amino acid residues in length, of which 40
residues 19-4%1 are glyeine and 33 residues 120%1 are
asparagine {both underlined in Fig. 7A}. This segment
is reminiscent of the earboxy-terminal glyeine-rieh
regions that exist in the rat hnRN-P A1 protein {Co-
bianchi et al. 1986}, the Drosophila Hrb98DE protein
{Haynes et al. 1990}, and nude.olin from several spe-
cies {Caizergues-l~e~rer et al. 1989], proteins all
kuovm to bind to RNA.
2. A second putative nucleic-acid binding, segment,
commencing with amino acid 215, contains three
zinc finger motifs {double underline in ~ig. 7A} of the
X~-Cy~-X~-Cys-X~o_~z-His-X~.-His ~,pe, motifs found
in many eu_karyotic transcriptional activators
([ohns~n z~d MeKuight 1989; Struh11989; Berg Lg~0)
Eigure 4. Western blot analysis of fusion proteins produced in
Xgtll lysogens. The 1.8-kb Drosophila DNA fragment identi-
fied from a hgtll ex~pzession library with mAb Y1D2 was used
to produce an IPTG-inducible ~-gal/P~P fusion protein in ~. co//
strain Y1089. A similar k lysogen containing the gene for a
fusion protein with the unrelated Drosopb21a heterochromatin
protein HPI llames and Elgin 1986} was used as a control. ~1
SDS-polyaerylamide gel electroghor~is of Drosopb.ila nuclear
proteins (lane 1], molecular weight markers (lane 2), mxinduced
PEP lysogen proteins {lane 8l, induced HP1 lysogen proteims
(lane 4), mad induced PEP lysogen proteins {lane 5}, stained with
Coomassie blue. The sizes of the molecular mass markers are
giveu in kJ]odaltous (le[t), asterisks mark the position of the
nuclear PEP protein, ~md dots mark the positions of induced
fusion proteins. [B). Western blot analysis of the protei~ in the
gel in A, probed with mAb YID2. [C} Western blot analysis of
Dro~o.~tzi.la nuclear protei~ (lane 1), mole~ula~ mv~ markers
{lane 2), ann pro~ei~ hem the indue_M I?~P 1)~3e~ {lane
u~ing m~b ~7.A11.
40000046

Figure 5. Loealizarion o£ th~ Pep gone on l~oly-
tone chromosomes. Polytene chromos0m~s
from ~d-~s~ la~ae w~¢ sq~shed omo a
micr~s~e s~d~ ~ ~cetic a~d ~d pro~ed
• e 2.5-kb ~ ka~t kom ~e 2.7-kb
eDNA done. ~e only si~l on the c~omo-
somes was mapped to ~e pro~ po~on of
the e~ysone-r~pansive p~ at locus 74F, by
~ference to ~e d~i~afions of Ldewe {1976}.
(10%} residues, with a net charge of -~3; interest-
ingly, a second stretch o£ basic residues, Arg-Lys-Lys-
Arg-Lys-Val, (overlined in Fig. 7A} resides next to
acidic region 2, in a position analogous to the basic
sequence preceding acidic region 1. Several functions
have been observed for highly acidic domains in other
chromosomal proteins (garnshaw 1987}, ineluding
transcriptional activation {Ptashne 1988}, recognition
of histones for polyubiquitination (Sung et al. 1988},
or nueleosome assembly/disassembly (Dingwall et al.
19871.
4. The carboxy-terminal 80 amino acids of P~.P are rich
in alanine {34%}, proline 124%}, and serine and thre-
onine {15% eombined}.
5. The Pep eDNA done contains 377 nueleotides be-
yond the first termination eodon, ending in the se-
quence AAUAAA, the consensus polyadenylation
signal {Proudfoot and Whitelaw 1988}. Because the
eDNA library was constructed by primer extension
from the poly{AI tars of mKNAs, the existence of this
Pep ~
2.8 kb
rp49~
0.6kb
Figure 6. No,them blot analysis of PEP expression during de-
velopment. Samples of poly[A]÷ KNA (1 ~g] from the stagez
indicated {adult males and female carcasses, ovaries, 0- to 3-hr
embryos, 4- to 12-hr embwos, 12- to 20-hr embryos, first-instar
larvae, second-instar larvae, third-instar larvae, early pupae, and
mid-stage pupae} were fracdonated electrophoretically and
transfened to a nylon membrane as described by Haynes et al.
(l~0}. The RNA was probed with a lal~led 2.5-kb HindllI f~ag-
ment fzom Pep eDNA. The size ~£ the Pep lxan~eript wo3 de-
duced b7 eomp~ason to ILNA size mar&ors. The loading con-
trois for this filter represent t~anseripts from the rilmsemal pro-
tein gone r/:49 tO'Connell and Rosba_~J~ 1~$4) ~d~cl indi~te
~.'edoaflin~ of t/~e -qamI~les from 4- to 12-h.r e_mh_r)-~s and third-
6o
canonical sequence at the very end of the e/one,
rather than 20-30 nucleotides upstream, suggests
that the e/one arose by priming from an adjacent AJ
T-rich sequence. Within the ~'-untranslated sequence
is found a nearly perfect match to a 450-bp genomie
sequence reported previously from locus 74F~ the ge-
nomie sequence was reported to hybridize to a 2.8-kb
eedysone-indueible transcript in KC cells {Moritz et
al. 1984}. That genomie sequence contains 29 nucle-
otides not found in our cDNA~ suggesting strain-spe-
cific polymorphism. The 74F genomie sequence was
cloned from Canton-S flies, while the eDNA library
used here was prepared from the Oregon-R strain. The
genomic sequence also contains an A-rich stretch
downstream of the AAUAAA motif~ which may have
served as the start of the primer extension reaction
during construction of the eDNA library. The overlap
with the 74F sequence and the identity o~ the tran-
script sizes suggest that the gone fragment reported
by Moritz et al. {1984} is from the gone we have iso-
lated. Thus, from the prior loealizarion of the 74F
sequence on the chromosomal walk from this region
{Thummel et al. 1990}, we know that the Pep gone
probably resides 15-20 kb in the proximal direction
from the eedysone-responsive E74 gone.
It is interesting to note the linear duplication of seg-
ments in the carboxy-terminal half of PEP, that is, the
repetition of zinc finger, nuclear localization signal,
and acidic domain. A search of Genbank version 63
for proteins found that the PEP sequence is unique.
Discussion
The chromosomal distribution of the PEP antigen sug-
gests a tight correlation between the presence of this
protein and transcription at a defined subfet of active
loci. The pattern changes with changes in the develop-
mental program or following heat shock. The pattera is
more selective than others reported at active loci [topoi-
somerase I (Heisehmann et al. 1984}, RNA polymerase II
(Sass 1982; Weeks et al. 1982}, ImlLtffP proteins
Amero and A.L. Beyers, unpubl.}, and snlLNP proteins
(Sass and Pederson, 1984; S.A. Amero et al., in prep.)]~ as
staining does not appear at most intermolt puffs or in-
terbands, or at certain heat shock-induced puffs. The
strong correlation between PEP and active hormonalIy
re~mlated loci argues for a role for the protein in the
proce~ of eedysone-mediated tmnserip~ional aetivatiom
G £~.'T~S &
40000047

GGTTCGGATCGGAC~:GTAATA'i-I'GC~ATAGGCGGAGTGTTTAGACA.AGG~GGCCATCTTTCT~ ~G ~A~C~A~~
101 TrGACA,AA.TCGCC GTTC, C/~CACCTTG'I'TTAAATAATTTCCTC
GCI-I'AAACACAAACCCTACA'rTACACATCCCAT~CA~CC~~
14 V 8 V K V N G N P ¢~ N R L V g N A K V N G N N A F R G N
203 A.A.ACCCAT~TTATGGTCAC-CGTAAAGGTCAACGGAAATCC GCAGAATC G'rr~AGTGA~TA~C GCAAA G ~CG~T~ ~C
305 CAGAAC C GCAA.CC GCAATTTTGGAGG~GGCAACAACAACTATGGTGGACCCATGGGCGC CAAC CGCATGGGCG~AT~T~C ~ C~G
~TC~G ....
N P G G GQF~N N HR~ GGGQN N A~A "r N LAN NL I.. N _N L F
407 AATCCC GGC a GC GGACA GI"~TGGTAACAACATGCGAC A GGGTGGC GGTCAGATGAAC C~CCAG~T~C~~TCT~T~C~TCT~C
R N ~, _N P P S L L D L P R G G G G N G N R N Q R G G P H V S R ~ G G
509 AGGAA~CAGAATCCACCATCGCTTCTCGACTTGCCCCGCGGC~GCGGTGGCATGGGAAATCGCAACCAA~GT~G~CC~TG~C~G~G~G~- --
X G N R L N N R R G Q G G G F Q N R G A T _G S G P K P P P K Q G G G
611 GC CGGCAATCGTCTCAATAACC GTC GTGGCCAGG GAGGT GGCTTC CAAAATCGTGGC GCCACTG GTA~G ~CC~CCCC~C~GG~G~
G~
G Z R K (~ N A F D R A K K L L A K N A N H K K K E P T P G E K K 1" E
"713 GGTATTCGCAA~TG~TTTTGA.TC GTGCCAAGAAA~GGCTAAAAATGCCAACCATAA/u~AGAAGGAACCCAC TCCTG~ ~~TC ~G
S P T K ¢" S P Y A S V P ~
D H F Y C H L C K K H N ~//
D A N S F E N H
815 AGCCCTACCAAG GAGTCTCCATAC GCTAGTGTGCC GAAC
GACATGTTCTACTGTCATCTGT~,CAAGAAGCACATGTGGC~T~CTC~C ~C~
Z K G R T H L H H R E G "r E E S Y R L K A N 14 -r R Q E A K "r A [ q L
917 ATCAAGGGCC GCACCCATCTGATGATGCGTGAG GGCATTGAGGA GAGCTATC GCCTCAAGGCCAACAT GATCC GT~G ~G~T~
~TC~A~TC
K S Z E F D R L K R 14 G
K S K Q R Q L D Y C T N C D
L N F H G ~ I" S
1019 AAGTC GATC GAGTTTGACC GC'i-rGAA GCGCATGGGCAAAAGCAAGCA GCGTCAGCT GGAC TACTIC ~TGT ~CCT~C~C~TG
~CA~TCTC G
T PI R K s £ G H L Q I. K K F L H P K C 1" E C N K £ F A T R 1" O Y D T
1121 ~CCCATCGCAAGT C GGAGGGACA'tTTGCAGCTGAAGAAGTTCTTGCACCCCAAGTGCA~~C~G~CTC~A~CTAC ~TACT
,,H, L L S A E H L K K A A I~ N N T K V G E R K R ¢~ T L P Z S T E E £ E
1223 CATCTGCJI'GTC~CCGAGCATCTGAAGAAGCCTGCCGAGAACAACACCAAGGTGGGTGA~ ~ ~CA~C~T~ACC~G~G
T R D L R L P Q K R K K K P V K Kit G E A A D G £ A K K E G A G D G |
]325 ACCCGCGATTTC`CGCCTGCCCCAGAAGCG`CAAGAAGAAC`CCGGTCAAGAAGGAGGGCGAA~A~C~TG~G~T~G~GGGT~CG~TG~~
G
A
11 E E E V A L P V D P E D C 1" L D F N D G D E 1" P S E V DIT R L P K
1529 ~GAAGAGGAAGTGGCA~TGCCCGTGGA~CGAGGACTGCATC~TTGAC-~-rCAA~GACGGCC`~TGAGATCcC~G~G~ACCC~CTACCT~C~
N ~ q R A V G P G L Z S K L E C Y E C S V C S K F F D T £ V T A E
1~31 AACT G GCAGCGTGCTGTCG GTC CC G GTCTGATCTCCAAGCTGGAGTGCTATGAGTGCTCGGTGTGCA~C~C ~CAC C~G~CC ~C ~
H S R T A T g H R N F L K F" Z
N E K S S D T K Z A Q K R A A A
A L E
1733 CACTCCC GTAC GGC GACTCATCAC CGCAAC TTCTTGAAGTTTATCAACGAGAA.ATCAAGCGATAC CAAGATC ~ACA~A~T~C ~CCT
G ~ G
V Q T P A P A E P A P P A K T P A K T P T K A A A P A A V A G P A A
2141 GTCCAAACTCCTGCCCC GC-CTGAACCTGCAC CACCAGCCAAC_,ACCCCAGCCAAGACTCC GACCAAGGCAGCT~TC~C~A~CCC~T
A A T S A D A S P S P A K K A T
P A R A A A G A K A T P q R q R
A R
2243 GC GGCAAC GTCG ~,~.AGAC GCCTCTCCATCTC C GGC CAAGAAGGCAAC GCCTGCTC GC GCT~C ~C ~G~C ~C~C~C ~ ~
CC~
G R Y N R Y
~
23,!5 GGTCGCTAP_.AATC GCTACTAAGTAGACGTCGAA~ C-~..A'rTCGTAA~T~T~CC~TATA~~A~C~C~G~
40000048

.~.ezo et a]o
2447 GG~TGAAC-~AAGAACAGAT~'r CGATCTCTT CC C GCAATTTGACATTTGCATC CC AATTTGCATATA~CT~T~T~CT~C G~
2549 C.AACT'I-I'TAGTTGAAACAGTTGAATATATTGTACGAC GAAGCTTCTTGA~ACTGAC GA GGGAGAACA~~TC ~TCGTA~CCT
2651 ACCC GATTC CCCCCTCACAGA~CGCATACCAT GCCAGC C
AGCGAACCAACCATI'~C'I-~ATGTAATCATATA~,ATTCTAT~T~C
BPEP FZNGER MOT~S:
FYCH LCKKHMWDANS F ENH I KGRTH
Figure 7. Sequence o~ the Pep eDNA and protein. (A] The sequence of the 2.7-kb eDNA
from the Pep gone was compiled using the ODBUTIL program {Staden 1980) and trans-
lated using the DM program (Mount and Conrad 1986). Within the deduced protein
sequence are found the tollowing motifs: a glycine (G)- and asparagine {N}-rich segment
(glycines and asparagines are underlined), four zinc finger motifs (double-underlined}, two
acidic regions {boxed areasJ, two nuclear localization-type signals (overlinedJ, and an
alanine (A}- and proline ~P)-rich earboxyl terminus. The overlap with the 74F genomic
sequence [Moil= et al. 1984) is underlined in the 3'-untranslated Pep eDNA sequence.
The probe used for the in situ hybridization and Northern blot analyses is indicated
between the a=owheads. IBJ Alignment of zinc finger motifs in PEP with the consensus
finger sequence from Drosophila proteins IHarrison and Travers 1990}. The conserved
pairs of cysteine (C) and histidine (H) residues are shaded and underlined.
DYCTMGDLNFHGHIST--HRKSEGH
PKCIECNKEFATRIDYDTHLLSAEH
YECSVCSKFFDTEVTAEIHSRTATH
DROSOPHILA CONSENSUS:
L
F.~..~.K.F ..... F..~ .... ~
Y
The additional sites in the PEP distribution pattern sug-
gest a function{s} for the protein in other activation sys-
tems as well.
Our observations complement the regulatory model
proposed by Ashbumer and his colleagues to accommo-
date the salient features of the larval/prepupal ecdysone
system [Ashbumer et al. 1974~ Ashbumer 1990}. The
model suggests that the genes within the early puffs are
directly activated by ecdysone in conjunction with the
ecdysone receptor. Activation of the early puffs does not
require de novo protein synthesis but is strictly depen-
dent on the presence of hormone IAshbumer 1974). Sev-
eral of the early genes have been cloned and shown to
respond directly to ecdysone [Burtis etal. 1990~ Segraves
and Hogness 1990~ Thummel et al. 19901, as expected.
Our finding of PEP on the early puffs, in the early puffing
stages, introduces an additional factor to this process and
suggests that PEP is recruited into early gone activation
or expression. Second, in the Ashbumer model, activa-
tion of the late genes is proposed to involve the products
of the early genes [Ashbu.mer 1974]~ this process is de-
pendent on de novo protein synthesis. This aspect of the
model has been confirmed ~ecently, since the E74 pro-
tein, the product of the E74 early gene, has been localized
on the late puffs IUmess and Thummel 1990}. Our stud-
ies add a new component to this level of eedysone-me-
dinted gene expression as well, because PEP is not the
product of a classic early gene but is found on the late
puffs. Thus~ the evidence suggests that PEP is involved
in ecdysone-mediated gene expression of both the early
and late genes in the Ashburner model, and that PEP
binding at these sites is regulated, perhaps indirectly, by
ecdysone.
The "known properties of the Pep gone and its protein
product--its pattern of expression, sequence motifs, and
reeruiunent to active complexes-would be expected o~
a "coactivator" transcription factor, as described by
Lewin [199D), a protein that adapts the transcriptional
apparatus to specific induction mechanisms, in this ease,
the ecdysone induction mechanism, in this scenario,
PEP may communicate between the basal transcription
factors and the ecdysonc receptor, or early gene products,
using zinc fingers to contact specific DNA sequences
and acidic domains for protein-protein contacts. The
protein may perform a similar traction in other activa-
t-ion systems, possibly at the minor sites in the PEP dis-
tribution pattern. Our observations to date--the tight
coupling with transcription, intense staining within a
puff, and certain sequence motifs~are also consistent
with the possibility that PEP is a component of a ribo-
nueleoprotein complex, and we note the ability of the
t~anseription faetur IIIA, also a zinc finger p~otein, to
contact both DNA and RNA {Miller etal. 1985}. In this
context, PEP may eom_munieate between the hormon-
ally activated transcription complexes, containing the
eedysone receptor or the early gene products~ and the
RNA packaging and processing inaehinery, containing
the transcripts of the early and late genes. It will dearly
be exciting to explore further the ttmetions of this
unique protein.
Methods and materials
Generation of monoclonal antibodies
Drosophila melanoga.ster {Oregon-R} strains were maintained
as a laboratory population in a 25"C growth chamber, as" de-
scribed by Elgin and/~liller (1977). Embryos collected at staged
intervals wexe frozen and stozed at -80"C. Nuclei were isolated
according to the procedures described by Niayfidd etal. {1978)
including centribagadon through a sucrose cushion. Nuclear
proteins from ~50 grams of embryos (6-12 hr} were extracted by
homogenization in a Thomas size B homogenizer in 0.2 m~i
EDTA IpH 8.0), and preboiled RNase A was added to a tlnal
concentration of 1 l.tg/ml. The suspension was incubated at
37°C for30 rain; nuclei were then pelleted by eentdFagation at
16,500g in a Sorvall HB-4 rotor for 10 mln at 4"C. All buffers
u~ed for homogenizing embryos, i~olating and digesting nuclei,
and extracting nuelear proteins contained 5 ~tg leu1~eptin/ml~
02 Ti units .~l~ro~snin/ml, and 0.1 m~i phenylmethylsulfcnyl
flu~ri~e {P?.~SI:I [all trom Sigma] to i~i~it endogenous pro-
teases. The suI:zu~atant c~n~g EDTA-~oluble hue!ear pro-
40000049

reins w~s di~ed a~'~ust 3 liters o~ 0.~ n~.l ~TA ~pH S.0), 0.1
Nu~ p~otm wac ka~onated ~ Trito~accEc
~ca-;olya~ g~s, ~d pzot~s ~ gel ~ w~¢ u~ed
for i~un~on o~ BALB-c ~ as d~cfiEc~ ~y ~o ct
(19~8). F~ions o~ spl~n ~]ls ~d my¢lo~ cogs, production
hybfidoma c~ ~, ~d scre~g for positive hybfido~
w~c ~nducted as d~hed by I~ ~d ~# [1986],
~g ~c proc~cs o~ G~6 md ~lst~ {1982}.
Epitope mapping and Western blot -na/ys~s
Peptide mapp~g e~enta were candu~ted by ~ba~g
120 ~l of EDTA nu~ ~acr in ~e presence of ~creasing
conc~a~o~ o~ ~s~ [Boeh~ger ~e~ Bioche~-
~J, d~ 10~ 25, or 50 ~ ~ 125 ~IT~s-HC1 [pH 6.8}, 1%
SDS, and 7.5% #ycerol [~ter ~e procaine of Clevdand et ~.
1977} at 37"C for 45 m~. The ~estions were stopped by ~e
ad~fion o~ SDS to a final cenc~afion of ~% ~d of
~-mereaptoe~ol to 166 ~, ~e ~pl~ were bored, ~d
id~fi~ a~quots w~e loaded onto 1~% SD~polyac~l~ide
gds [30% : 0.4%}, as d~ibed by Laemmli 11970}. For Western
blot ~yses, proteins were transte=ed from gds to ~troeeHu-
lose filters ~d probed as d~eribed by 1~ and Elg~ [1986J.
Cla~fied as~tes fl~d diluted I : 20 ~ bloe~ng solution was
used as ~e pm~ amibody, ~d l~I-labeled ~ti-mouse see-
onda~ ~tibody [F[ab']2] ~ent {~er~ Co~.l was used
at a $1ufion o~ 1 : 500 ~ bloe~ b~er. The filters were ~-
posed ov~i#t to pr~l~hed Kodak X-Omat film at -80"C
~ ~ ~tensi~g screen.
Screening eDNA libraries
The Xgtll eDNA expression library, subeloned from the origi-
nal kgtl0 library at the EcoR[ sites [M. Philip and D. Bmtlag,
pets. eomm.I, was screened with mAb Y1DP., using essentially
the procedure of Huynh etal. 11985}, as described by lames and
Elgin [19861. However, repeated screening attempts suggested
an instability of the Pep clone in this vector, so the primary
semen was pex4ormed at a dilution of 9 x 10s plaques on ten
150-ram Luria broth {LBJ/ampieillin plates, using Escher~chia
co//strain Y1088. Twenty-five positive plaques from the pri-
mary screen were resereened by Western blot analysis of the
proteins produced in a high-titer Z-ml minilysate of E. colJ
strain Y1088 grown at 37°C in the presence of LPTG for 6 hr
{Silhavy et al. 1984}~ three isolates produced positive signals.
One phage with a 1.8-kb insert was chosen for fusther analysis.
A f~-galaetosidase-PEP fusion protein was expressed in E. co~~
strain ¥1089 lysogenized with the phage insert, tollowing the
proeedmes of Huynh etal. [1985]. Following temperature shock
and induerion with IPTG, the bacterial cells {from 100-ml eul-
turesJ were collected by eentrifugation, resuspended in 10 mr.t
Tris-HC1 {pHLS), and frozen in liquid ni~ogem Foz protein
analysis, the samples were fraetionated in a 7% SDS-polyacryl-
amide gel for Western blot analysis.
The 1.8-kb Pep insert was gel-purified by GeneClean IBIO
101l, lalx:led with [ot-s2p]dATP [Kmcrshaxa Corp.I by random
priming IFeinbcrg and Vogelstein 1983}, and used to screen a
second eDNA library f~om 8- to 12-ht embryos {Bro,~m and Kaf-
atos 1958}. One-tenth the complexity of the library [and th~c-
f~re 3 × 10" colonies} w~s screened, and seven po,itive clones
were isolate& The inserts in the pNB~ vector ranged in size
from 1.F to 2.7 kb~ th~ clone c~nt~inin~ the 2.7-kb inse.~, des-
ignated p3221, w~s chosen f~r fi~rther analy~s.
Salivary glands were disszeted/ram third instar larvae in 45%
acetic a~id, and polytene e]zromos~mes were squashed onto
subbed microscope slides as described b7 Fardue [1986}. Tie
2.5-kb H_fndl~ fragment item p3221 was isolated b~ GeneClean
{BIO 101}, labeled with biotin-UTP (Bethesda Research Labora-
toriesl by random priming IFeinherg and Vogels*.ein 19831, and
hybridized as described by Paxdue 11986}. The signal was visu-
alized using the DNA Deteerion System from Bethesda Re-
search Laboratories.
Northern blot analyMs
The developmental Northern Falter reported by Haynes et aL
{1990} was reprobed with the 2.5-kb Hind~I fragment from the
Pep eDNA.
The fragment was purified from agarose gels by CeneClean
(BIO 101} and labeled with [a-zZPIdATP {Amcrsham Corp.} by
random priming {Feinbcrg and Vogelstein 1983}. A total of
1 x 109 epm was included in the hybridization~ performed in
the solutions recommended by Maniatis etal. {19821. The hy-
bridization reaerion was allowed to incubate fur 24 hr at 65"C.
The filter was washed twice in Zx SSC, 0.1% SDS~ at room
temperature, and twice in 0.2xSSC~ 0.1% SDS, at 60"C. The
filter was Mr-dried for 15 min, covered with plastic wrap, and
exposed to Kodak X-Omat AR film at - 80°C with an intensi-
fying screen.
Sequence analysis
The insert in p3221 was subeloned in two pieces into the Blue-
Script phagemid tot sequence determination. One 2.5-kb Hin-
dilI fragment covers the 5' end of the gone, extending into the
pNB40 vector, and one 300-bp ~eoRI fragment overlaps ~50 bp
of the HindIII fragment and extends to the 2~coRI site 20 bp into
the vector. These insert fragments were gel-purified by Gone-
Clean {BIO 101) and cloned into the appropriate sites of Blue-
Script Plus phagemid IStratagene, La lolla, CA) in E. co//BB4
strain. Each orientation of each insert was isolated.
A series of nested deletions in each strand was created using
exonuclease nt and SI nuelesse {both from Boehringer Man-
nheim Biochemicals} for both the p3~9.1 and kgtll plasmids.
Prior to ligadon with T4 DNA ligase {Boehringer Marmheim},
the ends o~ the deletions were filled in using Klenow fragment
{Bethesda Research Laboratories} and nucleoside triphosphates.
VCS-M13 helper phage for making single-stranded templates,
dideoxynucleoddes, primers, and Sequenase enzyme for se-
quencing reaerions were all obtained from Stratagene. dATP
labeled with ~sS was purchased from Amersham. Several prim-
ors were synthesized by the University of Virginia Protein and
Nucleic Acid Research Facility.
The contiguous sequences were assembled, and consensus
sequences weffe computed using the ODB UTIL program {Staden
1980}. The consensus sequence was translated into protein se-
quence using the DM program IMount and Conrad 1986}. The
PEP protein sequence was compared to Gcnbank using the
FASTP program (Pealson and Lippman 1988}. The sequences
obtained ~or the Xgtll and the p~l inserts axe identical, ex-
cept for the presence of 58 bp on the amino-terminal side oi the
Xgtll insert, which is missing from the p32Z1 insert.
lmmnnoflnorescenee assays
Immun~flu~rescenee anal}~e~ of polytene daznmosomes were
c~nducted b7 the meth~:ls of Silver zml Elgin [1977}, as mcdi-
GE2~ES ~- DEVF.LOP.M_.E~f 197
40000050

fled by lames and El~in [19S5). PolTte~e chromosomes were
squ~h=d in a 45% ~c~d= ~d-3.7% Io~al~)'d= ~t~ ~-
lutio~ ~fi~y YID~ wa~ used ~ a n~t hyhddoma ~pe~-
t~t~ ~-p~fied goat ~d~odies s~fic ~or the ~rbo~'-
te~d dom~ d ~e l~gest sub~t o~ ~A pd~erase H
(Fisher et ~. 1989) were ~uted 1 : I~ m bloe~g buffer. ~fi-
mo~e F~C-~niugated an6body ~d ~d-goat I~C-
eoniugated mfibody were ho~ obt~ed horn ICN ~m~obi-
do~eals and ~luted l : 100O ~d I : 3~0, respecfivdy. Yox r~-
t~ ~e coverslips were ~pped off the e~omosomes v~th a
razor bhde, ~d the s~d~ were washed ~ree ~m~ ~ ~S at
room temperature.
The c~omosomes w~e photographed ~ou~ a ~i= O~-
omat fluoresc~ce ~eroscope using Kodak Tri-X film. ~ctu~
were printed ns~g ~-eon~ast filters on Kod~ Polyeon~ast
pap~. Devdopmen~ stages were dete~ed by comp~son o~
~e paling pa~ems to ~ose in Table 1 of ~hb~ ~d Ber-
end~ 11978}.
Acknowledgments
We are truly indebted to T.C. James, Paul Adler, and Bob Kadner
(or guidance and assistance, to ~ae Moon Lee and Amo Green-
lea~ [or the provision o( anti-pol II antibodies, to Susan Haynes,
Felix Karim, and Carl Thurnmel [or assistance with the North-
em blot analyses, to Valerie Dietrich and Jack Diani for tech-
nical assistance, and to Keith Yamamoto for suggestions and
advice. This work was supported by National Institutes o(
Health INIH] grant GM39271 to A.L.B., NIH grant GM31532 to
S.C.R.E., and NIH grant 5-S07-RR05431-28, grant IN 149P from
the American Cancer Society, and March of Dimes grant 1-1200
to S.A.A.A.L.B. is the recipient o( an American Cancer Society
Faculty Keseareh Award. Sequence data described in this paper
have been submitted to EMBL/GenBank Data Libraries under
accession number X56689.
The publication costs of this article were defrayed in part by
payment of page charges. This article must therefore be hereby
marked "advertisement" in accordance with 18 USC section
1734 solely to indicate this (act.
Rderences
Amero, S. A., T.C. James, and S.C.K. ]~lgin. 1988. Raising antis-
era to proteins in gel bands. Methods Mo/. Biol. 3: 355-362.
Ashburner, M. 1970. Patterns of puffing activity in the salivary
gland chromosomes of Drosophila. Chromosoma 31: 856-
376.
~r. 1974. Sequential gene activation by ecdysone in poly-
tene chromosomes of Drosophila melanogaster. ]I. The
[eets of inhibitors of protein synthesis. Dev. Biol. 39: 141-
157.
• 1990. Puffs, genes, andhorrnones revisited. Cell 61: 1-3.
Ashburner, M. and H.D. Berendes. 1978. Puffing o( palytene
chromosomes. In Th~ genetics and biology of Drosophila.
led. M. Ashbumer and T.K.F. Wrightlz Vol. 2B, pp. 453-498
Academic Press, New York.
Ashburner, M. and J-l• Bonnet. 1979. The induction of gene ae-
tivit7 in Drosophila by heat shock. Cell 17: 241-254.
Ashbumer, M., C. Chflaara, P. Mehzer, and G. Richards. 1974.
Temporal control of putting activity in polytene chromo-
somes. Cold Spring Harbor S£mp. Qnant. B~ol. 38: 655-~12.
Berg~ J.M. 19B$. Prolapsed structure for the zinc-bin~hng
mains ~rom transcription factor IIIA and related proteins.
Froc. Nat/. Acad. So/. 85: 99-102.
• 1~90. Zinc fingers and ~ther metal-binding dora.tins. ].
BIol. Chem. 265: 6513-5516.
Brown, NI-L an~t 1:.C. Ka~atos. 198~. Functional cDNA libraries
~rom Drosophila embryos. I. MoI. Biol. 203: 425-437.
Burr/.% K.C., C.S. Thummel, C.W. ]ones, F.D. Karim, and D.S.
Hogne~s. 1990. The Drosopt~Ia 74E1: esfly puf~ contains E74,
a complex eedysone-indueible gene that encodes two ets-
related preteins. CelI 61: 85-99.
Caizergues-Fe~er, M., P. Morinttini, C. Curie, B. Lapeyre, N.
Gas, F. Amaldc, and F. Amaldi. 1989. Nucleolin horn Xeno-
pns laevis: eDNA cloning and expression during develop-
ment. Genes ~ Dev. 13: 324-333.
Cavener, D.R. 1987. Comparisoa o( the consensus sequence
flanking t~anslational start sites in Drosophila and verte-
brates. Nucleic Acids Res. 15: 1353-1361.
Cleveland, DAV., S.G. Fischer, M.W. Kimehner, and U.K. Laem-
mli. 1977. Peptide mapping by limited proteolysis in sodium
dodeeyl sulfate and analysis by gal eleetrophoresis./. Biol.
Chem. 252: 1102-1t06.
Cobianchi, F., D.N. SenGupta, B.A. Zmudzka, and S.H. Wilson.
1986. Structure o( rodent helix-destabilizing protein re-
vealed by eDNA cloning. ~. Biol. Chem. 261: 8536-3543.
Dingwall, C. and R.A. Laskey. 1986. Protein import into the cell
nuelens. Annu. Rev. Ce//Biol. 2: 367-390.
Dingwall, C., S.M. Dilworth, S.J. Black, S.E. Kearsey, L.S. CoW
and R.A. Laskey. 1987. Nueleoplasmin eDNA sequence re-
veals polygintamic acid tracts and a duster of sequences
homologous to putative nuclear localization signals. EMBO
/. 6: 69-74.
Dreyfuss, G. 1986. Stroeture and function of nuclear and cyto-
plasmic ribonueleoproteins. Annu. Rev. Ce31 Biol. 2: 459-
498.
Earushaw, W.C. 1987. Anionic regions in nuclear proteins. ].
C~11 Biol. 105: 1479-14~2.
Elgin, S.C.R. and D.W. Miller. 1977. Mass rearing o~ flies and
mass production and hatwesting of embryos. In The genetics
and biology of Drosophila {ed. M. Ashbumer and T.K.F.
Wrightl, Vol. 2A, pp. 112--19,1. Academic Press, New York.
Elgin, S.C.R., S.A. Amero, J.C. Eissenberg, G. l~leisehmarm, D.S.
Gilmour, and T.C. James. 1988. Distribution patterns of
nonhistone chromosomal proteins on polytene chromo-
somes: Functional correlations. In Chromosome strucmr~
andfonction [ed. J.P. Gustafson and R. Appels}, pp. 145-156.
Plenum, New York.
l"einberg, A.P. and B. Vogelstein. 1988. A technique for radiola-
baling DNA restriction endonuelease fragments to high spe-
cific activity. Anal Biochem. 132: 6-13.
]~isher~ P.A., L, Lin~ M. McCormell, A. Greenleaf, J.-M. Lee, and
D.~.. Smith. 1989. Heat shock-induced appearance of RNA
polymerase lI in karyoskeletal protein-enriched Inuelear
"marix"] fractions correlates with transcriptional shutdown
in Drosophila melanogaster. ~. B~oI. Chem. 264: 8464-3469.
Heisehmann, G., G. Pflug~elder, E.K. Steiner, K. Javahetian,
G.C. Howard, J.C. Wang, and S.C.R. Elgin. 1984. Drosophila
DNA topoisomerase I is associated with transcriptionally
active regions of the genome. Proa. Natl. Aead. Saf.
81: 6958-6962.
Galfr6, G. and C. M~ilstein. 1982. Preparation o~ monoclonal
antibodies: Strategies and procedures. Methods EnzymoL
73: 3-46.
Garl~e, J.D. and Mt.L Pardue- 1986. Heat shock locus 98D o[
Drosophila melanogasten A spliced RNA most strongly
eonscn'ed in the intron sequence. Proc. Nat. Aca~t Sci.
83: 1812-1816.
Harrison, S.D. and Ad~ Travers. 1990. The tramtra/< gene en-
ec~ea a Drosophila finger protein that Interacts with r_he
transcriptional regulatory re~ion and sh~vs a novel
G'~J..S & DEVI~.OPSW.I~-E
4000O051

Chic ex-pr~sion pattern. E~IBO [. 9: 207-9-16.
I-la)m,~, S.P,,, G. Raychaud~u~, and ~L. E~yer. 1990.
Dro~o~ HI~9~D~ Io~ ~co~ {o~ prot~ iso~o~
homologous to ~c AI ~rotc~ of m~ h~ero~eneo~
nu~]e~ ~onuc]eopiot~ ~mp]~. Mo/. C~. Biol.
10: ~I~.
Hodge~, ~B., B. Sage, ~d J.D. O'Co~or. 1977. Ecdyson~
~es d~g postemb~o~c davelopment ~ Dmsop~a mel-
anogas~r. Day. Biol. 60: 31~17.
Hul~ark, D., R. ~z, and %V.[. Geh~g. 1986. Trash-
ffoml ~d u~s~dpfi~ consul demurs ~ ~e
hted l~d~ of &e h~t-shoc~ gene fisp~2. C~H 44:
Hu~, T.R., R~. Yo~ ~d R.W. Da~s. 1985. Co~ct~g
~d sere~ eDNA ~br~ies ~ h~i0 ~d ~II. h
Cloning led. D.M. Glove), Vol. I, pp. 49-78. I~ Press, Ox-
lord.
James, T.C. md S.C.R. ~. 1986. Id~t~ica~on d a no~is-
tone chromosomal prote~ assodated ~ hetero~oma~
~ DzosopfiHa malanoga~t~r and its gene. Mol. Call Bid.
6: 886~87~.
~ohnson, P.F. ~d S.L. Me~t. 1989. E~otic
tio~l re~ato~ prof,s. A~u. Rev. Biocfi~. $8: 799-
8S9.
Joho, K.E., M.K. Dath7, E.T. Craw[oral, ~d D.D. Brown. 1990.
~g~ prot~ s~t~a~7 s~]~ ~o TF~ ~t binds
clusivdy to 5S ~A ~ X~o~u~. Call 61: 29~.
Koz~, M. 1989. ~e s~ingmodd for transhfion: ~ up,re.
]. C~H Biol. 108~ 229-241.
~sky, G.P., W.C. Clark, M~ ~tdle, R.D. Gic~, B.A.
Sage, J.D. O'Co~or, ~d R.B. Hodgetts. 1980. ~ducfion
tran~mb]e mRNA for dopa dcc~boxylase in Drosop~a:
~ esfly response to ecdyste~ne. Pmu. Nad. Acad.
~: 417~179.
~em~i, U.K. 1970. ~eavage of strutted prot~s d~g the
ass~bly of the h~d d ba~te~op~ge T4. Natur~ ~7: 68~
685.
Lee, M.S., G.P. Gippe~, K.V. Som~, D.A. Case, ~d P.E.
WriSt. 1989. ~e-~ension~ solu~on s~re of a sin-
~e zinc ~ger DNA-b~ng do~. Sd~nc~ 245: 6~5~37.
Ldevrc~ G. ~r. 1976. A photo~aphic represenm~on ~d ~ter-
pretaffon of ~e ~l~ene ~hromosomes o~ D~osop~ila
~ozaater saliva~ gl~ds. In The geae~ ~d b~olo~ of
Drosop~a [od. M. Ashbumer ~d E. Novits~J, Vo]. In, pp.
~1~6. A~demic P~s, New Yor~
Lewin, B. I9~. Co~em ~d ac~va~on o~ Pol H promot-
es: A t~I d prof,-protOn interacffons. C~H 61: 1161-
1164.
M~atis, T., E.F. Frits~, and ]. Sambrook, eds. 1982. Ex~a~
fion, p~i~tion, ~d ~IEsis of m~A ~om
cegs. ~ Mole~ar ~o~ng: A h~ora~ man~l, pp. 187-
210. ~Id Sp~g Harbor ~borato~, ~Id Sp~g H~bor,
N~w York.
Ma~eld, J.E., L.~ S~m, L~. Silver, ~d S.C.R. EI~n.
1978. A prote~ rel~sed by DNAs~ I ~g~fion d Dr~op~la
nuclei is prd~en6~7 ~s~iat~ wi~ ~s. C~H 14:
5~.
1986. Genetic complem~m~on of a gluc~or~id ~c~tor
defi~ene7 by ~ression of cloned re~ptor ~NA. C~
46: 38~99.
~er, J., ~D. Mc~c~, ~d ~ ~u~ 1985. Repetitive ~c-
~opu~ c~. ~.~O ]. 4: 1~9-1614.
Mode, T., J~. ~m, ~d O. Pon~. 19~. Clo~z of a
l~ed ~ ~ssed a~ ~ ~dystemid re~ated ~
74EF in salivary glands of DrosotvhHa larvze. B~,IBO
3: 289-295.
Mount, D.W. and 13. Cor~ad. 19~6. Improved programs for DNA
and lr~utein sequence analysis. Nnclgie Adds Res. 14: 443-
454.
O'Connell, P. and M. Rosbash. 1984. Sequence, structure, and
codon preference of the Drosophila ribosomal protein ~19
gene. Nuclei~ Adds Res. 12: 5495-5513.
Pardue, M.L 1986. In s~ta hybridization to DNA uf chromo-
somes and nuclei. In Drosophila: A practical approach [ed.
D.B. Roberts}, pp. 111-138. IRL Press, Oxford.
Parker, C.$. and J. Topoi. 1984. A Drosophila RNA polymerase
II transcription factor contains a promoter regian-speeifie
DNA-btndlng activity. Ceil 37: 278-283.
Pearson, W.R. and D.I. Lippman. 1988. Improved tools for bio-
logical sequence comparison. Proc. Natl. Acad.
85: 2444-2448.
Pongs, O. 1988. I~edystexoid-regulated gene expression in Droso- phila melanogaster. Fur. ].
Biochem. 175: 199-204.
Proudfoot, N.J. and tL Whitelaw. 1988. Termination and 3'-end
processing of eukaryotie RNA. In Transcription and splic-
ing, led. B.D. Haines, and D.M. Glover}, pp. 97-129. IRL
Press, Oxford.
Ptaslme, M. 1988. How eukaryotie t~ansetiptional aetivaters
work. 1Vatore 335: 683-689.
Kiehards~ G. 198 I. The radioimmune assay o~ eedystetoid tittes
in Drosophila melanogastar. Mol. Cell. Bndocr~oL 21: 181-
197.
Ritossa, F.M. 1962. A new puffing pattern induced by temper-
ature shock and DNP in Drosophila. Experientia 18: 571-
573.
Ryseck, R.-P., U. Walldoff, and B. Hovemarm. 1985. Two maior
RNA products are transcribed fitom heat-shock locus 93D
Drosophila malanogastar. Chromosoma 9~: 17-20.
Sass, H. 1982. RNA polymerase B in pol~ene chromosomes:
Immunofluereseent and auteradiog~aphie anal)sis during
stimulated and repressed RNA synthesis. Gell 28: 269-278.
Sass, H. and T. Pede~son. 1984. Transcription-dependent local-
ization of U1 and U2 small nuelea~ ribanueleoproteins at
maior sites of gene activity in polytene chromosomes. [.
B1ol. 180-" 911-926.
Segraves, W.A. and D.S. Hogness. 1990. The 1~75 eedysone-in-
dueible gene responsible fort.he 75B e~ly puff in Drosoplu'la
encodes two new members of the steroid receptor super~am-
ily. Genes e~ Dev. 4: 204--210."
Silhavy, TJ., M.L. Berman, and L.W. Enquist. 1984. Pzeparation
of 2-ml high-titer k liquid lysates. In Bxperiments with gen~
fusions, pp. 89-90, Cold Spring Harbor Laboratour, Cold
Spring Harbor, New York.
Sflver~ L.M. and S.C.R. Elgin. 1977. Distribution patterns
three subf~aetions of Drosophila nonhistoae chromosomal
proteins: Possible correlations with gene activity.
11: 971-983.
Spradling, A., M.L. Pardue, and S. Penman. 1977. Messenger
RNA i~ heat-shocked Drosophila cells. ]. Mol. B1ol.
109: 559-587.
Stadea, R. 1989. A new computer method Ior the storage and
manipulation of DNA gel reading data. Nncleiv Acids Res.
8." 3673--3694.
Strtthl~ IL 1989. Helix-turn-helix, zlne-finger, and leuelne-zip-
r~er motifs for eukaryot/e t~anseriptional regulatozy proteins.
Tzends Biuahem. Sci. 14: 137-140.
Sung, P., S. Prakash, and L. Prakash. 1988. The RAD6 protein of
Saccharomyces cer~-is~ae polyubiquinates histories, and its
acidic domain mecliates th2s aefiviW. Gzn~ ~ De;,. 2: 1476-
1485.
199
40000052

Thmx~mel, C.S., K.C. Bu~is, and D.S. Hotness. 1~90. Sl~atial
and teml:oral l~tteras ¢f EX4 ~xanscription duxing Droso-
pldla development. C¢// 61:101-111.
Umess, L.D. and C.S. Thummel. 1990. Molecular interactions
within the ecdyaone regulatox7 he~acby: DNA binding
p~operties of the Drosoptdla ecdysone-inducible E74A pro-
rein. Cell 63: 47-61.
~Veeks, ~.R., D.t~. Ceulter, and A.L. Greenleaf. 1982. Immuno-
logical studies of RNA polyem~ase H using antibodies to
subunits of Drosop1~la and wheat germ en~lme~ 1. Bioi.
Chem. 257: 588~-5891.
Wingender, E. 1988. Compilation of transcription regulating
proteins. Nuc3e/c Acid,~ Re& 16: 1879-1902.
Wu, C. 1984. Two protein-binding sites in chromatin impli-
eared in the activation of heat-shock genes. Nature
309: 2~9-234.
Yost, HJ. and S. Lindquist. 1986. RNA splicing is interrupted by
heat shock and is rescued by heat shock protein synthesis.
C~//45: 185-193.
Zieve, G.W. and R.A. Sautezcr. 1990. Cell biology of the snRNP
particles. Crit. Re~,. Bioc~em. Mol. Biol. 25: 1-46.
Zimmennan, J.L., W. l~etti, and M. Meselson. 1983. Accumula-
tion of a sl~eci~ic subset of D. m~lanogasterheat shock mR-
NAs in normal development withou~ heat shock.
32: 1161-1170.
40000053
